A caps molecular marker detection technology related to soybean haplotype, and detection primer, method and application thereof
By developing CAPS molecular marker technology, primer pairs were designed using the SNP sites of the Glyma.17G121500 gene fragment and enzyme digestion was performed, solving the problem of rapid identification of soybean haplotypes and realizing efficient screening and improvement of soybean breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-02
AI Technical Summary
The lack of effective molecular markers in existing technologies for rapid identification of soybean haplotypes limits the progress of soybean plant architecture improvement and breeding.
We developed CAPS molecular marker technology based on PCR amplification and restriction endonuclease digestion. Primer pairs were designed using the SNP sites of the Glyma.17G121500 gene fragment, and the soybean haplotype I and haplotype II were distinguished by digestion with BShNI endonuclease.
This technology enables rapid and accurate determination of soybean haplotypes, providing a stable and efficient detection tool for soybean molecular marker-assisted breeding, thereby improving breeding efficiency and the accuracy of variety selection.
Smart Images

Figure CN122128466A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to a CAPS molecular marker detection technology related to soybean haplotypes, as well as its detection primers, methods and applications. Background Technology
[0002] Soybeans, as an important global food crop, provide 40% of plant protein and 30% of edible oil, and are also a core raw material for the feed industry. Therefore, cultivating new high-yield and stable-yield soybean varieties has become a strategic need.
[0003] Changes in crop stem branching traits during domestication have a significant impact on yield. In soybeans, previous studies have explored different modules of branching regulation, including... micro156b–SPL Modules and GmDT2 Genes. Studies have found... GmmiR156b It is a key gene that regulates soybean branching and ideal plant architecture; overexpression GmmiR156b This allows soybeans to exhibit multi-branching and high yield characteristics, representing an ideal soybean plant type. Furthermore, field trial results show that overexpression... GmmiR156b It significantly increases the number of branches, main stem nodes, main stem thickness, and number of trifoliate leaves in soybeans, but does not affect plant height; overexpression GmmiR156b It significantly increases the number of pods per plant and the size of seeds, resulting in a 46%–63% increase in yield per plant. It is a key factor in determining stem differentiation. GmDT2 Genes act as negative regulators of soybean branching; loss of their function can increase the number of branches and improve yield.
[0004] The importance of branching to soybean yield can be summarized in three main points: First, soybean varieties with strong branching generally produce more effective branches, resulting in more pods and thus increasing total yield. Second, stronger branching leads to larger leaf area, optimizing effective light exposure and contributing to higher soybean yield. Third, branching traits in soybeans can improve plant architecture, significantly impacting yield. Therefore, researching how to regulate soybean branching traits is of great significance for improving soybean yield and agricultural development. Currently, the lack of genes and molecular markers directly controlling soybean cotyledon node branching limits molecular breeding efforts for soybean plant architecture improvement. In recent years, genes involved in soybean plant architecture... DT1 , DT2 , SOC1a , SOC1b , FT2a , FT5a, micro156b–SPL Once cloned, people gained a completely new understanding of the response mechanism of soybean stem growth habits.
[0005] With the continuous development and improvement of molecular marker technology, molecular marker-assisted selection (MAS) has become an effective strategy that can significantly save manpower and resources and accelerate the breeding process. The core advantage of this technology is that it can achieve precise breeding by detecting target genotypes without relying on phenotypic identification. The derived molecular marker CAPS (Cleaved Amplified Polymorphic Sequences) marker, which combines PCR amplification and restriction enzyme digestion, is a SNP detection technology based on specific primer PCR and restriction endonuclease digestion. It possesses characteristics such as co-dominance, site specificity, ease of operation, and low cost, and is currently widely used in crop genotype identification, genetic mapping, map-based cloning, and molecular marker-assisted breeding.
[0006] In soybean, SSR markers have become one of the most commonly used marker types due to their high polymorphism, genetic stability, and ease of manipulation. Furthermore, with the accumulation of soybean genomic information, SNP markers have gradually become the preferred tool for high-throughput screening. Studies have found that MAS plays an important role in soybean disease resistance breeding, stress resistance breeding, yield trait improvement, and quality trait improvement. Meanwhile, previous laboratory studies... GmBRC1 The relationship between haplotype and soybean basal branching was studied (Hongtao Ji et al., "Domestication-medicated erect growth confines soybean basal branching by upregulating..."). GmBRC1a and GmBRC1 b). Research found that in GmBRC1a Of the two haplotypes, haplotype II has a significantly higher number of branches than haplotype I, indicating that haplotype II is the dominant haplotype. Through analysis of... GmBRC1 Studies of the geographical distribution characteristics of haplotypes can reveal... GmBRC1 Haplotype differentiation is coupled with latitudinal environmental adaptation, in which... BRC1a Haplotype II is an excellent haplotype adapted to the central region and a key factor in promoting basic branching of soybeans during domestication.
[0007] Therefore, if a co-dominant molecular marker technology based on PCR amplification and restriction endonuclease digestion—CAPS (Cleaved Amplified Polymorphic Sequences)—could be developed for rapid identification... GmBRC1 By identifying haplotypes and screening out superior germplasm resources, we can provide strong technical support for soybean in molecular identification and assisted breeding. Summary of the Invention
[0008] The purpose of this invention is to provide a CAPS molecular marker detection technology related to soybean haplotypes, as well as its detection primers, methods, and applications.
[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a CAPS molecular marker associated with soybean haplotypes, the CAPS molecular marker being based on... Glyma.17G121500 The SNP site at the 575th base of the gene fragment was designed, and the mutant base of the SNP site was G or C, and the genotype was GC or CC. Soybean varieties with genotype GC are haplotype I; Soybean varieties with genotype CC are haplotype II; The Glyma.17G121500 The gene fragment is shown in SEQ ID NO.1.
[0010] Preferably, the CAPS molecular marker is designed based on the SNP site at Chr17:9693175 in the soybean genome Glycine max Wm82.a2.v1 version, where the mutant base of the SNP site is G or C, and the genotype is GC or CC. Soybean varieties with genotype GC are haplotype I; Soybean varieties with genotype CC are haplotype II.
[0011] Preferably, soybean varieties with the CC genotype have a significantly higher number of branches than soybean varieties with the GC genotype.
[0012] This invention also provides the application of a reagent for detecting CAPS molecular markers in the rapid determination of soybean haplotype types, wherein the CAPS molecular marker is the aforementioned CAPS molecular marker; The reagents include primer pairs and restriction endonucleases; The primer pairs are shown in SEQ ID NO.2~3; The restriction endonuclease is BShNI endonuclease.
[0013] This invention also provides the application of reagents for detecting CAPS molecular markers in soybean-assisted breeding and screening of high-quality soybean germplasm, wherein the CAPS molecular marker is the aforementioned CAPS molecular marker; The reagents include primer pairs and restriction endonucleases; The primer pairs are shown in SEQ ID NO.2~3; The restriction endonuclease is BShNI endonuclease.
[0014] The present invention also provides a primer pair for rapidly determining soybean haplotypes, as shown in SEQ ID NO. 2~3.
[0015] This invention also provides a method for rapidly determining soybean haplotype types, comprising the following steps: (1) Extract soybean genomic DNA; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primer pairs to obtain PCR amplification products; (3) The PCR amplification product obtained in step (2) is digested with enzymes to obtain the digested product; (4) Determine the haplotype type based on the number or size of fragments in the enzyme digestion product; The primer pairs are shown in SEQ ID NO.2~3.
[0016] Preferably, the PCR amplification reaction system comprises: 0.8-1.2 μL of genomic DNA, 10-20 μL of 2×Taq polymerase, 10-15 μL of distilled water, and 0.4-0.6 μL each of forward and reverse primers; The concentration of the genomic DNA is 20-30 ng / μL; The concentrations of the upstream and downstream primers are independently 1.5~2.5 μmol / L; The PCR amplification reaction program is as follows: pre-denaturation at 93℃~97℃ for 4~6 min; denaturation at 93℃~97℃ for 28~32 s, annealing at 55℃~57℃ for 28~32 s, extension at 70℃~74℃ for 72~78 s, 28~32 cycles; and final extension at 70℃~74℃ for 9~11 min.
[0017] Preferably, the enzyme used for digestion is a BShNI endonuclease; The enzyme digestion system consisted of: 8-12 μL of PCR amplification product, 0.8-1.2 μL of BShNI restriction enzyme, 1.5-2.5 μL of 10× buffer, and 15-20 μL of sterile water. The concentration of the BShNI endonuclease is 8-12 U / µL; The enzyme digestion conditions are 35℃~40℃ for 5~60 minutes.
[0018] The present invention also provides a kit for rapidly determining soybean haplotypes, the kit comprising the primer pairs shown in SEQ ID NO. 2-3 and the BSHNI restriction enzyme.
[0019] Beneficial effects
[0020] This invention identifies a SNP site significantly associated with soybean haplotype type through genome-wide association analysis of local soybean varieties. The site is located at Chr17:9693175 in the soybean genome Glycine max Wm82.a2.v1 version. A CAPS molecular marker was developed for this site.
[0021] This invention provides a method for rapidly determining soybean haplotypes. Experiments have shown that the primer pairs provided by this invention can specifically detect the genotype of soybean CAPS molecular marker sites. This technology can serve as a novel tool for molecular marker-assisted breeding and has significant application value and practical significance for crop genetic improvement. Attached Figure Description
[0022] Figure 1 These are haplotype gene amplification products from different soybean varieties; Figure 2 Results of haplotype enzyme digestion for different soybean varieties; Figure 3 This is the cleavage site of the BShNI endonuclease. Detailed Implementation
[0023] In this invention, Glyma.17G121500
[0024] In this invention, the primer pairs are as shown in SEQ ID NO.2~3; Upstream primer SEQ ID NO.2: ACCTTCCTCAACGCAATGA; Downstream primer SEQ ID NO.3: TGCATCAGAAACAAGTACTC.
[0025] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0026] Example 1
[0027] Development of CAPS molecular markers
[0028] This invention targets the branching trait of soybean cotyledonary nodes. Through genome-wide association analysis of natural soybean populations, SNP loci significantly associated with the target trait were identified. This locus is located at Chr17:9693175 in the soybean genome, Glycine maxWm82.a2.v1 version, corresponding to… Glyma.17G121500 At the 575th base of the gene, a mutation of either C or G results in two variant types: haplotype I (genotype GC) and haplotype II (genotype CC). Germplasm materials carrying haplotype II often exhibit branching at the cotyledonary nodes.
[0029] Based on the restriction enzyme polymorphism of this SNP site, BShNI was screened as the tool enzyme, and specific primers covering the site were designed using Primer3 to amplify an 816 bp fragment. The PCR and restriction enzyme digestion system was optimized, and a CAPS marker detection method was established. Validated on multiple soybean materials, this marker can accurately distinguish between two haplotypes, providing a stable and efficient detection tool for molecular-assisted breeding of soybean branching traits.
[0030] Table 1. Basic information on single nucleotide polymorphism sites of Chr17:9693175
[0031] Example 2
[0032] Design of specific primers
[0033] Download from Phytozome (http: / / www.phytozome.net) Glyma.17G121500Gene sequence was obtained, and PCR primers were designed using the online software Primer3 (version 4.1.0, http: / / primer3.sourceforge.net). The expected length of the PCR product of the primer pair is 816 bp. Theoretically, after digestion with BshNI restriction enzyme, two fragments of 560 bp and 256 bp can be obtained.
[0034] Upstream primer F: ACCTTCCTCAACGCAATGA (SEQ ID NO.2); Downstream primer R: TGCATCAGAAACAAGTACTC (SEQ ID NO.3).
[0035] The primer pair design was based on the CAPS molecular marker design in Example 1.
[0036] Example 3
[0037] Application of specific primers in the rapid differentiation of soybean haplotypes
[0038] 1. Extracting genomic DNA
[0039] In this embodiment, genomic DNA was extracted from nine soybean materials: GDL003(GC), GDL064(GC), GDC083(GC), GDW009(GC), GDW065(CC), GDW095(GC), GDW037(CC), GDW067(CC), and GDW078(CC). These samples were published in "Natural Variation of a PPR Coding Gene SST1 Confers Salt Tolerance During Soybean Domestication".
[0040] 2. PCR amplification
[0041] Using the soybean genomic DNA to be tested as a template, PCR amplification was performed using the primer pairs from Example 2 to obtain PCR amplification products; The above PCR amplification reaction system (containing PCR reagents with primer pairs) is 30 μL, including: 1 μL of 25 ng / μL genomic DNA, 15 μL of 2×Taq polymerase, 13 μL of distilled water, and 0.5 μL of each of 2 μmol / L primers.
[0042] The PCR amplification reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 75 s, 30 cycles; final extension at 72℃ for 10 min; stored at 4℃.
[0043] The above PCR reaction was performed on a PCR amplification thermal cycler from ABI (Applied Biosystems, USA).
[0044] 30 μL of the PCR amplification products corresponding to the above primer pairs were taken and analyzed by 1.0% agarose gel electrophoresis to detect whether the target fragment was amplified. PCR amplification was performed on DNA from nine soybean varieties with known haplotypes (GDL003, GDL064, GDC083, GDW009, GDW065, GDW095, GDW037, GDW067, GDW078). All nine materials yielded a single PCR product of 816 bp, similar in length to the target fragment. Figure 1 As shown. Figure 1 The corresponding soybean varieties are represented by numbers only.
[0045] 3. Enzyme digestion
[0046] The PCR products obtained from the primer pairs were digested with BshNI restriction enzyme.
[0047] The above enzyme digestion reaction system is 30 μL: 10 μL of PCR amplification product, 1 μL of BShNI endonuclease (10 U / µL), 2 μL of 10× buffer, and 17 μL of sterile water.
[0048] The enzyme digestion reaction system was placed in a PCR instrument, digested for 30 minutes, and then removed to obtain the enzyme digestion product.
[0049] The above enzyme digestion conditions are as follows: digestion at 37℃ for 30 min; inactivation at 65℃ for 10 min; and storage at 4℃.
[0050] The BShNI restriction enzyme digestion products were analyzed by 1% agarose gel electrophoresis. If the digestion products contained fragments of 560 bp and 256 bp (products containing three fragments were incompletely cleaved), the soybean being tested was a soybean variety of haplotype II with genotype CC; if the digestion products contained an 816 bp fragment, the soybean being tested was a soybean variety of haplotype I with genotype GC. Figure 2 .
[0051] The 560bp fragment of the soybean variety with genotype CC is shown in SEQ ID NO.4, and the 256bp fragment is shown in SEQ ID NO.5.
[0052] SEQ ID NO.4: ACCTTCCTCAACGGCAATGACCTAATCTCGTACCCTAACCAACCATTTTGCTTTAGGCCTTTTTCCTTTGAAAGCAACCCAACTTATAATTTTTCAAAAGAAGAAGCCAATTCCAATTACGCCCTTCCTCCTCCTCCACCTCCTCCTCCTTTGTCCTTTTTCCAATCTCCCTTTGACGAAAATATCTTCCTAGAACACCACCACCATGACTTGCTCCTACTTCATCAGTACTCTCTGACTGACTCTGGAGTATCAAAAAACCTTGAAGTTGTGGCCGAAATCTCGCCAATTCCTTGCCCTGAACAAGGTGGAATTGCGATGGAGCACACTCCAAGAAAGAGATCCAGCAAGAGAGACCGCCACAGCAAGATCAACACCGCGAGAGGCCTCAGGGATCGAAGAATGAGGCTGTCCCTCGAAGTCGCGAAGCGGTTTTTCGGGTTGCAAGACATGCTAGGCTTTGACAAGGCCAGCAAAACCGTGGAGTGGTTACTGAACCAAGCAAAGGGTGAAATCAAACAACTTGCAAGGGAAAAAACAAGTGTTGTTGGTGGTGGTGC。
[0053] SEQ ID NO.5: CAAGAGTGCATCATCAACTTCGGAATGCGAAGGGGTGTCTAGCTTGGACGAGGTTGCAGTGAGTACTGGAGGAGTTAATAACGAGGAGCAAGAGAGGGAGACAGTACCAAACATGATGAAGAGAAGAAAAAGTAAGGTTTGTAGAAAGAGTGCATTCAATGCTATTGATAAGGAATCGAGGGAAAAGGCAAGAGAAAGGGCAAGGGAAAGAACAAGAGAGAAGATGAGAACTCGGAGAGTACTTGTTTCTGATGCA。
[0054] The 816bp fragment obtained by digesting the soybean variety with the genotype GC is shown in SEQ ID NO.6; SEQ ID NO.6: .
[0055] The genotype results from enzyme digestion were consistent with the known genotypes. The test results are shown in Table 2.
[0056] Table 2 Genotypes of different soybean varieties
[0057] The working principle of analyzing the target using enzyme digestion results (enzyme digestion sites) is as follows: Figure 3As shown.
[0058] Figure 3 Type I indicates soybean varieties with haplotype I, and Type II indicates soybean varieties with haplotype II. The positions marked with BShNI are restriction enzyme sites.
[0059] This invention identifies a SNP locus significantly associated with soybean haplotype type through genome-wide association analysis of local soybean varieties. The locus is located at Chr17:9693175 in the soybean genome Glycine max Wm82.a2.v1 version. A CAPS molecular marker was developed targeting this locus. This invention provides a rapid method for determining soybean haplotype type. Experiments have shown that the primer pairs provided in this invention can specifically detect the genotype of the soybean CAPS molecular marker locus. This technology can serve as a novel tool for marker-assisted breeding and has significant application value and practical significance for crop genetic improvement.
[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A CAPS molecular marker associated with soybean haplotypes, characterized in that, The CAPS molecular marker is based on Glyma.17G121500 The SNP site at the 575th base of the gene fragment was designed, and the mutant base of the SNP site was G or C, and the genotype was GC or CC. Soybean varieties with genotype GC are haplotype I; Soybean varieties with genotype CC are haplotype II; The Glyma.17G121500 The gene fragment is shown in SEQ ID NO.
1.
2. The CAPS molecular marker according to claim 1, characterized in that, The CAPS molecular marker was designed based on the SNP site at Chr17:9693175 in the soybean genome Glycine max Wm82.a2.v1 version, where the mutant base of the SNP site is G or C, and the genotype is GC or CC. Soybean varieties with genotype GC are haplotype I; Soybean varieties with genotype CC are haplotype II.
3. The CAPS molecular marker according to claim 1 or 2, characterized in that, Soybean varieties with genotype CC have significantly more branches than soybean varieties with genotype GC.
4. The application of a reagent for detecting CAPS molecular markers in the rapid determination of soybean haplotypes, characterized in that, The CAPS molecular marker is the CAPS molecular marker as described in any one of claims 1 to 3; The reagents include primer pairs and restriction endonucleases; The primer pairs are shown in SEQ ID NO.2~3; The restriction endonuclease is BShNI endonuclease.
5. The application of reagents for detecting CAPS molecular markers in soybean-assisted breeding and screening of high-quality soybean germplasm, characterized in that... The CAPS molecular marker is the CAPS molecular marker as described in any one of claims 1 to 3; The reagents include primer pairs and restriction endonucleases; The primer pairs are shown in SEQ ID NO.2~3; The restriction endonuclease is BShNI endonuclease.
6. A primer pair for rapidly determining soybean haplotype types, characterized in that, The primer pairs are shown in SEQ ID NO.2~3.
7. A method for rapidly determining soybean haplotype types, characterized in that, Includes the following steps: (1) Extract soybean genomic DNA; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using primer pairs to obtain PCR amplification products; (3) The PCR amplification product obtained in step (2) is digested with enzymes to obtain the digested product; (4) Determine the haplotype type based on the number or size of fragments in the enzyme digestion product; The primer pairs are shown in SEQ ID NO.2~3.
8. The method according to claim 7, characterized in that, The PCR amplification reaction system consisted of: 0.8–1.2 μL of genomic DNA, 10–20 μL of 2×Taq polymerase, 10–15 μL of distilled water, and 0.4–0.6 μL each of forward and reverse primers. The concentration of the genomic DNA is 20-30 ng / μL; The concentrations of the upstream and downstream primers are independently 1.5~2.5 μmol / L; The PCR amplification reaction program is as follows: pre-denaturation at 93℃~97℃ for 4~6 min; denaturation at 93℃~97℃ for 28~32 s, annealing at 55℃~57℃ for 28~32 s, extension at 70℃~74℃ for 72~78 s, 28~32 cycles; and final extension at 70℃~74℃ for 9~11 min.
9. The method according to claim 7, characterized in that, The enzyme used in the enzyme digestion was a BShNI endonuclease. The enzyme digestion system consisted of: 8-12 μL of PCR amplification product, 0.8-1.2 μL of BShNI restriction enzyme, 1.5-2.5 μL of 10× buffer, and 15-20 μL of sterile water. The concentration of the BShNI endonuclease is 8-12 U / µL; The enzyme digestion conditions are 35℃~40℃ for 5~60 minutes.
10. A reagent kit for rapidly determining soybean haplotype types, characterized in that, The kit includes the primer pairs shown in SEQ ID NO. 2-3 and the BShNI endonuclease.