Application of inhibiting endogenous tRF (CUC) in rice in improving rice blast resistance

Abstract

The application discloses application of inhibiting endogenous tRF(CUC) in rice in improving rice blast resistance. The application provides RNA, named tRF(CUC), which is any one of the following: A1) a nucleotide sequence comprising the RNA molecule shown in SEQ ID No. 1; A2) a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the RNA sequence defined in A1) and encoding a nucleic acid molecule having the same function. The application can be used for improving the potential of rice blast resistance of rice in actual field production by constructing a material STTM strain capable of significantly improving the rice blast resistance of rice by inhibiting the expression of endogenous tRF(CUC), thereby effectively reducing the yield loss of rice caused by rice blast.

Description

Technical Field

[0001] This invention belongs to the field of disease resistance breeding, and relates to the application of inhibiting endogenous tRF (CUC) in rice to improve rice blast resistance, specifically involving the inhibition of tRNA derived from rice. Glu CUC The application of an endogenous small RNA tRF (CUC) expression in improving rice blast resistance also involves a method for constructing short tandem target mimic (STTM) lines of tRF (CUC). Background Technology

[0002] Rice ( Oryza sativa Rice is a staple food crop for over 50% of the world's population, cultivated in 85 countries worldwide. Rice blast is the most destructive fungal disease affecting rice yields, causing an average annual loss of 6% globally. A major outbreak can lead to yield reductions of up to 30% in a region. Since the 1980s, my country has experienced three major regional outbreaks of rice blast. 1993 was a particularly severe year for rice blast in my country, primarily concentrated in major rice-producing areas such as southwest my country, the middle reaches of the Yangtze River, and northeast China. The total affected area reached 5.432 million hectares, resulting in losses of billions of kilograms of rice, posing a serious threat to my country's rice production and food security. Internationally, rice blast is the most damaging rice disease in Japan. Rice cultivation accounts for 41-45% of Japan's total arable land area annually, and the annual grain loss due to rice blast is approximately 200 million kilograms. During the major rice blast epidemic in the Higashiyama region of the Kanto region in 1988, the affected area reached about 600% of the normal annual area. Therefore, controlling rice blast is a crucial guarantee for maintaining stable rice production and supply balance, and safeguarding national food security.

[0003] Rice blast is a fungal disease caused by the rice blast fungus (Magnaporum oryzae). Magnaporthe oryzae , M. oryzae*Magnaporum oryzae* is a fungus belonging to the genus *Magnaporum* in the family Magnoliaceae of the class Ascomycota, order Magnolia, and phylum Magnolia. It exhibits typical characteristics of filamentous fungi. The mycelium of *Magnaporum oryzae* is colorless and transparent filamentous, with conidiophores growing in clusters of several, each bearing a conidia at its apex. The conidia are pear-shaped, with two septa in the middle, forming a three-celled structure. *Magnaporum oryzae* is a semi-biotrophic fungus with a relatively conservative life cycle under natural conditions. First, in the autumn of the first year, *Magnaporum oryzae* overwinters primarily through mycelium and conidia on harvested rice stubble and straw. In the spring of the second year, when the temperature rises to 25-28℃ and humidity is suitable, the pathogenic spores begin to germinate again. At 26-28℃ and saturated humidity, a large number of conidia are rapidly produced, further spreading through wind and water, eventually contacting rice tissues and organs, leading to infection. *Magnaporum oryzae* infects rice in various parts, causes diverse symptoms, and has a long duration of damage, occurring throughout the entire growth and reproductive cycle of rice. Based on the differences in the timing and location of pathogen infection in rice tissues, rice blast is traditionally classified into five types: seedling blast, leaf blast, grain blast, node blast, and neck blast. According to the rice blast evaluation standard (NT / T 2624-2014) issued by the Ministry of Agriculture, neck blast and grain blast are collectively referred to as panicle blast. In actual production, leaf blast is the most common. Based on the disease manifestations, leaf blast can be further divided into white spot type, acute type, chronic type, and brown spot type. However, neck blast causes the most severe damage to rice production.

[0004] Rice possesses multiple mechanisms to resist rice blast infection, such as those based on typical disease resistance protein genes. RESISTANCE ( R This includes pathways involving genes, plant hormone responses, secondary metabolites, and microRNA (miRNA)-based RNAi pathways. (Regarding rice blast...) R Gene research has always been of paramount importance, especially in rice. R The gene can express nucleotide-binding site-leucine-rich repeat (NBS-LRR) type disease-resistance proteins. NBS-LRR proteins can recognize effector proteins from pathogens and initiate the effector-triggered immunity (ETI) process, thus containing... R Genetically modified rice materials typically exhibit a rapid and strong immune response to certain physiological races of rice blast fungus containing corresponding avirulent genes, resulting in extremely strong disease resistance. However, these specialized disease-resistant rice materials lack durability and broad-spectrum resistance when facing pathogens that are constantly evolving in the natural environment. Therefore, it is crucial to discover the disease resistance mechanisms of other atypical resistance proteins.

[0005] Small RNAs (sRNAs) play a crucial role in rice's resistance to rice blast infection. Plant hormones regulate various biological processes in plants, and after rice is infected with rice blast, it targets auxin response factor 16 (… ARF16 Increased miR160a expression in rice led to decreased auxin levels, thereby enhancing rice's immunity to rice blast fungus; simultaneously, it targeted superoxide dismutase II (SODII), which catalyzes the dismutation of superoxide anion radicals into oxygen and hydrogen peroxide in rice. SOD2 The expression level of miR398b of the rice blast fungus also increases after infection with rice blast fungus, leading to an increase in reactive oxygen species (ROS) levels in rice and promoting resistance to rice blast fungus infection. Therefore, overexpression of miR160a and miR398b in the susceptible rice variety Lijiang Xintuan Black Rice (LTH) can effectively promote rice resistance to rice blast. In addition, miR7695, a rice-specific microRNA, is another sRNA that positively regulates rice blast resistance. miR7695 targets... OsNramp6 Alternative splicing transcripts, especially the shortest spliced ​​transcripts. OsNramp 6.8 This transcript encodes NRAMP6, a manganese and iron transporter, which is activated when rice is infected by rice blast fungus. OsNramp 6.8 Decreased expression levels lead to localized iron accumulation; therefore, miR7695 enhances rice resistance to rice blast by activating iron signaling pathways. Interestingly, a polycistronic miR166k-166h, composed of two miR166 family members miR166k and miR166h, also positively regulates rice blast resistance. miR166k-166h targets the ethylene pathway through its miR166k-5p region. EIN2 transcripts EIN2.1 and EIN2.2 To enhance resistance to rice blast. Besides the aforementioned sRNAs that positively regulate rice blast resistance, some sRNAs also negatively regulate rice resistance to rice blast. The highly conserved miR169 family in rice targets a class of nuclear transcription factors Y (which regulate stress resistance traits). NY The miR167d gene family negatively regulates rice blast resistance. This is achieved by reducing the number of rice blast resistance genes. ARF12 miR169 reduces rice resistance to rice blast by increasing its expression level. Furthermore, miR169 targets growth regulators... OsGRF In GRF6 , GRF7 , GRF8 and GRF9 To coordinate the disease resistance and yield traits of rice.

[0006] Currently, research on the RNAi mechanism of rice blast resistance mainly focuses on microRNAs. However, various other sRNAs also play diverse roles in the disease resistance process. In recent years, thanks to the advancements in next-generation sequencing technology, sRNAs derived from tRNA have attracted increasing attention. These sRNAs are called tRNA-derived small RNAs (tsRNAs) or tRNA-derived fragments (tRFs). Based on their location on the tRNA, tRFs can be classified into six categories: tRF-5, tRF-3, 5' tRNA half, 3' tRNA half, tRF-1, and internaltRF. tRF-5 refers to tRNA fragments that originate from the 5' end of mature tRNA and extend at least into the D loop and at most into the anticodon stem. Further classification of tRF-5 includes tRF-5a (3' end extending into the D loop), tRF-5b (3' end crossing the D loop and entering the D stem), and tRF-5c. tRF-5c is the longest type of tRF-5, with its 3' end located in the anticodon stem. tRF-3 refers to tRNA fragments originating from the 3' end of tRNA and containing a 3' CCA. tRF-3 is generally divided into two types: 18-nt tRF-3a and 22-nt tRF-3b. 5' tRNA half and 3' tRNA half are generated by tRNA breakage at the anticodon loop and are 31-40 nt in length. tRF-1 is formed by RNase Z cleaving the 3' end of the pre-tRNA precursor, and RNA polymerase III adds a poly U termination signal to its 3' end, resulting in a variety of lengths. The internal tRF consists of the anticodon loop portion of the tRNA.

[0007] As an ancient and conserved sRNA, tRFs have had their important functions increasingly revealed in studies. In animals, researchers have found that tRFs can replace the binding stabilizing protein YBX1 of tumor gene mRNAs, destabilizing many oncogene mRNAs and thus significantly inhibiting cancer cell development. In the sperm of high-fat diet (HFD) mice, tRFs exhibit significantly altered expression profiles and RNA modifications compared to normal mice, and these tRFs can serve as paternal epigenetic factors to facilitate the progeny's expression of paternal disease information. In clinical research, the ratio between tRFs or tRNA half-molecules can serve as a highly efficient indicator of cancer progression-free survival (PFS) and a candidate marker for diagnostic markers.

[0008] In plants, evidence suggests that tRFs regulate developmental processes and stress responses: First, tRFs respond to abiotic stresses. Current reports indicate that UV stress, cold stress, heat stress, peroxide stress, and phosphorus starvation stress all induce upregulation of tRF levels in plants. For example, when Arabidopsis is under phosphorus deficiency stress, tRFs are significantly highly expressed in the roots and leaves. RNase T2 family RNS1 Genes, tRNA under the action of RNS1 protein Gly tRNA Asp The levels of 5' tRNAhalf and 5' tRF produced by cleavage were significantly increased. Secondly, tRFs are involved in plant-microbe interactions. Three exogenous tRFs from rhizobia (named Bj-tRF001, 002, and 003) are delivered to plant root cells and utilize the host's RNAi mechanism to bind to AGO1, silencing auxin-regulated genes in root cells. GmRHD3a / 3b , GmHAM4a / 4b and GmLRX5 Ultimately, this affects the formation of root nodules. Furthermore, apples exhibit high resistance to viral infections, which may be related to changes in the expression levels of several tRFs during apple stem rot virus infection. In the leaves and roots of black pepper infected with Phytophthora capsulatum, 5' tRFs may play a regulatory role in the response to pathogens. During late blight infection of potatoes, pathogen-derived tRFs accumulate in the host, which may be an important reason for potato susceptibility. Third, tRFs mediate transposon silencing. Researchers, through analysis of Arabidopsis pollen sRNA-seq data, found a class of 19-nt 5' tRFs with high abundance. Prediction and functional enrichment of target genes for this class of 5' tRFs revealed that the first major class of target genes were protein-coding genes, while the second major class were transposon elements. Further analysis of the binding sites of tRFs and target genes showed that this class of 19-nt tRFs showed a better concentration of target sites on transposon elements in the genome than on protein-coding genes. Chromatin remodeling factor DDM1 maintains genomic methylation levels and inhibits transposon element activity, while the newly discovered 5' tRF may be a second line of defense for maintaining transposon element methylation levels, in addition to the DDM1 pathway. Fourth, tRFs can bind to polyribosomes to regulate translation. Previous studies have identified a class of tRNAs... AlaThe 5' tRF has an inhibitory effect on protein translation. To prove this conclusion, researchers measured the ribosome profiles before and after treatment with adenine (puromycin). The main function of adenine is to disrupt ribosomes and prematurely terminate the translation process. After adding a 5' tRF named Ala20 to the crude extract of Arabidopsis leaves, a sucrose gradient centrifugation was performed. The gradient fractions were divided into 15 groups, and each group was examined individually. It was found that Ala20 binds well to polyribosomes but not to subribosomes. This indicates that the 5' tRF exerts its inhibitory function on protein translation through interaction with translationally active polyribosome structures. Summary of the Invention

[0009] The technical problem solved by this invention is how to improve rice blast resistance.

[0010] To address the aforementioned technical problems, the first aspect of this invention provides RNA, named tRF(CUC), which is any of the following: A1) The nucleotide sequence includes the RNA molecule shown in SEQ ID No. 1; The RNA sequences defined in A2) and A1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and encode nucleic acid molecules with the same function.

[0011] The tRF(CUC) or its precursor RNA mentioned above is an endogenous RNA of rice.

[0012] The nucleotide sequence of the tRF(CUC) precursor RNA is SEQ ID No. 2.

[0013] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0014] In a second aspect, the present invention provides the application of the RNA described in the first aspect in regulating plant resistance to rice blast; Or the application of RNA as a silencing target as described in the first aspect in regulating plant resistance to rice blast.

[0015] Thirdly, the present invention provides the application of substances that inhibit or reduce the activity or content of the RNA described in the first aspect, or inhibit or reduce the expression of nucleic acids encoded by the RNA described in the first aspect, in improving plant resistance to rice blast. Alternatively, the present invention provides the use of substances that inhibit or reduce the activity or content of the RNA described in the first aspect, or that inhibit or reduce the expression of nucleic acids encoded by the RNA described in the first aspect, in the cultivation of rice blast-resistant plants.

[0016] In the above text, the inhibition or reduction of RNA activity or content can be achieved by gene knockout or gene silencing.

[0017] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0018] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the prevention or reduction of RNA expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0019] In the applications described above, the substance can regulate the expression of the RNA-coding gene or regulate the content of the RNA in at least one of the following six aspects: 1) regulation at the transcriptional level of the coding gene; 2) post-transcriptional regulation of the coding gene (i.e., regulation of splicing or processing of the primary transcript of the coding gene); 3) regulation of RNA transport of the coding gene (i.e., regulation of the transport of the mRNA of the coding gene from the nucleus to the cytoplasm); 4) regulation of the translation of the coding gene; 5) regulation of the degradation of the mRNA of the coding gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the RNA translated from the coding gene).

[0020] The substance may be a reagent for silencing the encoded nucleic acid, such as a reagent for silencing the encoded nucleic acid by homologous recombination, or a reagent for silencing the encoded nucleic acid by CRISPR / Cas9, or a reagent for silencing the encoded nucleic acid by STTM. The reagent for silencing the nucleic acid expression may contain a polynucleotide targeting the RNA, such as siRNA, shRNA, sgRNA, miRNA, antisense RNA, or DNA.

[0021] Specifically, the substance is a substance that silences the expression of the nucleic acid encoding the RNA described in the first aspect.

[0022] Furthermore, the substance expressing the RNA-encoded nucleic acid in the first aspect of silencing includes the STTM silencing system; The STTM silence system includes any of the following: C1) STTM nucleic acid molecules; C2) An expression cassette, recombinant vector, or recombinant bacteria containing the STTM nucleic acid molecule described in C1); The STTM nucleic acid molecule is any one of the following: B1) The nucleotide sequence includes the DNA molecule shown in SEQ ID No. 3; The DNA sequences defined in B2) and A1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and encode nucleic acid molecules with the same function.

[0023] In the above applications, the recombinant vector containing the STTM nucleic acid molecule described in C1) can be constructed using existing plant expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pCAMBIA3301, pCAMBIA2300, pCAMBIA2301, pCAMBIA1300, pCAMBIA 1301, pWM101, pGreen0029, pBI121, pBin19, pCAMBIA1301-UbiN, or other derived plant expression vectors. The plant expression vector may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor. When constructing a recombinant expression vector using the gene, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter or the ubiquitin gene. UbiquitinPromoters such as pUbi and stress-inducible promoter Rd29A can be used alone or in combination with other plant promoters. Furthermore, enhancers, including translational enhancers or transcriptional enhancers, can be used when constructing the recombinant expression vector of this invention. These enhancer regions can be ATG start codons or adjacent start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the recombinant expression vector can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants, antibiotic resistance markers, or chemical resistance marker genes. Alternatively, no selective marker genes can be added, and transformed plants can be directly screened for stress.

[0024] In this invention, the recombinant vector is a recombinant plasmid obtained by constructing an artificially synthesized STTM sequence (SEQ ID No. 3) onto a pCam1300-related expression vector. Specifically, it is the pCam2300:pActin1::STTM vector, which is a vector obtained by homologously recombining the STTM sequence shown in SEQ ID No. 3 into the product of pCam2300:pActin1 enzyme digestion. This vector is used to silence tRF (CUC).

[0025] Fourthly, the present invention provides a method for improving plant resistance to rice blast, as follows: D1) or D2). D1) The method includes the following steps: reducing or inhibiting the RNA activity or content described in the first aspect in the target plant to improve plant resistance to rice blast; The method described in D2) includes the following steps: reducing or inhibiting the expression of the RNA encoding the RNA described in the first aspect in the target plant to improve the plant's resistance to rice blast.

[0026] The improvement of plant resistance to rice blast mentioned above is reflected in any of the following: E1) Reduce rice blast lesions on plant leaves after infection with rice blast fungus; E2) Reduce the accumulation of rice blast fungus in leaves after plant infection with rice blast fungus; E3) Reduces the rate of mycelial expansion of rice blast fungus in leaves after plant infection with rice blast fungus; E4) Reduce yield loss after plants are infected with rice blast fungus.

[0027] Fifthly, the present invention provides a method for cultivating transgenic plants with high resistance to rice blast, as follows: D1) or D2). D1) The method includes the following steps: reducing or inhibiting the RNA activity or content described in the first aspect in the target plant to obtain a transgenic plant; D2) The method includes the following steps: reducing or inhibiting the expression of the RNA encoding the RNA described in the first aspect in the target plant to obtain a transgenic plant; The transgenic plant exhibits higher resistance to rice blast than the target plant.

[0028] In the method described in the fourth or fifth aspect above, the reduction or inhibition of the RNA activity or content in the first aspect of the target plant, or the reduction or inhibition of the expression of the RNA encoding nucleic acid in the first aspect of the target plant, is to silence the expression of the RNA encoding nucleic acid in the first aspect of the target plant.

[0029] The silencing described above is achieved by introducing the recombinant vector containing the STTM nucleic acid molecule described in the third aspect into the target plant.

[0030] In the above method, the recombinant vector is introduced into the target plant, specifically by transforming plant cells or tissues through Agrobacterium-mediated transformation, gene gun method, electroporation method, pollen tube introduction method, liposome fusion method, and any other method that can introduce plasmids, and then cultivating the transformed plant tissues into plants.

[0031] In the above text, the plant or target plant is any one of the following F1) to F4): F1) dicotyledonous plants; F2) monocotyledonous plants; F3) grasses; F4) rice.

[0032] In this invention, the rice variety is preferably a rice variety susceptible to rice blast, such as Zhonghua 11 or Nipponbare (NPB). More specifically, in one embodiment of this invention, the background of the plant is NPB, that is, unless otherwise specified, the background of the transgenic material used is NPB.

[0033] In a sixth aspect, the present invention provides the STTM silencing system described in the third aspect.

[0034] The significant advantage of this invention is that, compared to NPB, by expressing STTM nucleic acid molecules that bind to and inhibit the expression of endogenous tRF (CUC) in rice within NPB, STTM rice lines are obtained, exhibiting significantly improved resistance to rice blast. Furthermore, field yield measurements have shown that, compared to NPB, STTM lines achieve stable yields when facing rice blast fungus infestation. Therefore, STTM lines can be used for breeding or cultivating rice varieties resistant to rice blast. Attached Figure Description

[0035] Figure 1The STTM sequence structure for binding and inhibiting endogenous tRF (CUC) in rice is shown, where the red sequence is the tRF (CUC) sequence and the blue sequence is the complementary sequence of tRF (CUC).

[0036] Figure 2 The results of Northern blotting were obtained for detecting tRF (CUC) content in NPB and STTM dual lines. U6 was used as an internal control small RNA.

[0037] Figure 3 Phenotypic results of NPB and STTM double lines inoculated with *Magnaporum oryzae*. Infection experiments were conducted on NPB and STTM double lines of rice using *Magnaporum oryzae* P131 via scratch-drop infection. The red line segment in the figure represents 1 cm.

[0038] Figure 4 Statistical analysis of plaque length in rice blast fungus inoculated with NPB and STTM dual-line phenotypes. Significance was determined using Student's method. t test, * indicates p <0.05.

[0039] Figure 5 Results of blast fungus accumulation detection using NPB and STTM dual-line phenotypes. OsUBIQUITIN As an internal reference gene, it is used to detect bacterial genes in leaves. MoPot2 The content of [unclear]. Significance was statistically analyzed using Student's [unclear]. t test, ** represents p <0.01.

[0040] Figure 6 This illustrates the process of rice leaf sheath infection by *Bacillus oryzae* in NPB and STTM dual-line rice. The red line segment represents 20 μm.

[0041] Figure 7 This study statistically analyzed the infection status of *Magnapordica oryzae* spores in leaf sheath cells of NPB and STTM double-line rice at 12, 20, 28, 36, and 44 hours after infection. At least 20 *Magnapordica oryzae* spores were counted in each replicate. Significance was determined using Student's Law. t test, ** represents p <0.01.

[0042] Figure 8 The field inoculation phenotypes of NPB and STTM double-line rice with rice blast fungus were determined. Figure 8 Figure a shows the control group. Figure 8 Figure b shows the experimental group inoculated with rice blast fungus.

[0043] Figure 9The results show the yield traits of NPB and STTM double-line rice after field inoculation with rice blast fungus. Figure 9 'a' represents the yield statistics of the sample plot. Figure 9 b represents the weight per thousand grains. Figure 9 c represents the plant height. Figure 9 d represents the effective tiller count. Figure 9 e represents the saturation rate statistic. Significance statistics were performed using a multiple comparison method; the same letter indicates no significant difference, and different letters indicate... p <0.05. Detailed Implementation

[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0046] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0048] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0049] Rice ( Oryza.sativa L.) Nipponbare variety: namely Nipponbare rice ( Oryza sativa L. japonica. cv. Nipponbare Reference: Rice variety "Nipponbare". Agricultural Science and Technology Newsletter, 1973, Issue 2. Available to the public from Peking University.

[0050] The rice blast pathogen races P131 and eGFP-ZB25 used in the experiment were kindly provided by Professor Peng Youliang of China Agricultural University.

[0051] Rice blast fungus race P131: described in the article “Xue M, Yang J, Li Z, Hu S, Yao N, Dean RA, Zhao W, Shen M, Zhang H, Li C, Liu L, Cao L, Xu X, Xing Y, Hsiang T, Zhang Z, Xu JR, Peng YL. Comparative analysis of the genomes of two field isolates of the rice blast fungus Magnaporthe oryzae. PLoS Genet. 2012;8(8):e1002869.”, which is available to the public from China Agricultural University.

[0052] Agrobacterium EHA105: described in “Zhu et al., 2005. The Rice Dwarf Virus P2 Protein interactions with ent-Kaurene Oxidases in vivo, leading to reduced biosynthesis of Gibberellins and rice dwarf symptoms. Plant Physiology. 139:1935-1945.”, available to the public from Peking University.

[0053] pCam2300:pActin1::0CS vector: described in the article “Jianguo Wu & Zhirui Yang et al., 2015. Viral-inducible Argonaute18 confers broad-spectrum virus resistance in riceby sequestering a host microRNA. eLife. 2015 Feb 17;4.”, available to the public from Peking University.

[0054] The pCam2300:pActin1 vector is formed by digesting pCam2300:pActin1::OCS with XbalI and SalI enzymes to remove the OCS sequence.

[0055] Example 1: Construction of STTM rice lines with endogenous tRF (CUC) inhibition The tRF(CUC) sequence is shown in SEQ ID No. 1, and the precursor tRNA from which tRF(CUC) originates is... GluCUC The sequence is shown in SEQ ID No. 2.

[0056] The STTM nucleic acid sequence was ligated into the pCam2300:pActin1 expression vector plasmid, which was modified in our laboratory, to obtain the pCam2300:Actin1::STTM vector. This vector was then transformed into Agrobacterium tumefaciens, and STTM rice lines with endogenously suppressed tRF (CUC) were obtained using Agrobacterium tumefaciens-mediated rice embryo transformation technology. The specific methods are as follows: (1) Design primers with pCam2300:Actin1 expression vector adapter. Based on the tRF(CUC) sequence shown in SEQ ID No. 1, a special DNA sequence STTM nucleic acid molecule (SEQ ID No. 3) was designed and synthesized for binding and inhibiting endogenous tRF(CUC) in rice. The STTM sequence is as follows: Figure 1 As shown. An upstream homologous arm of the pCam2300:pActin1 vector was added to the front of the STTM sequence, and the first 21 bases of the STTM sequence were selected to form the upstream primer. A downstream homologous arm of the pCam2300:pActin1 vector was added to the front of the reverse complementary strand of the last 21 bases of the STTM sequence to form the downstream primer. The primer sequences are as follows (uppercase parts represent vector homologous arms, lowercase parts represent STTM sequence fragments): STTM-F: 5'-CTTGCTGCGCTTTCCTCTAGA atcctaaccagctagactact-3' STTM-R: 5'-CTTGCATGCCTGCAGGTCGAC tccgttgtagtagtctagctg-3' (2) High-fidelity enzyme amplification of the insert fragment Using the DNA molecule shown in SEQ ID No. 3 as a template, STTM-F and STTM-R were used as the forward F primer and the reverse R primer, respectively. The insert fragment of the overexpression vector was amplified using the 2×Super Pfx Master Mix high-fidelity enzyme kit (purchased from Kangwei Century Biotechnology Co., Ltd., catalog number CW2969), and the PCR product obtained was the insert fragment.

[0057] The PCR amplification system is shown in Table 1 below: Table 1 shows the PCR amplification system.

[0058] Perform PCR according to the procedure in Table 2 below: Table 2 shows the program.

[0059] After the insert fragment amplification was completed, agarose gel electrophoresis was performed to detect the PCR product, which was the STTM insert fragment.

[0060] (3) Enzyme digestion and recovery of pCam2300:pActin1 vector The pCam2300:pActin1 vector was subjected to XbalI / SalI double digestion. The digestion reaction system is shown in Table 3 below: Table 3 shows the enzyme digestion system.

[0061] The enzyme digestion reaction was terminated after incubation in a 37°C metal bath for 1 hour. After confirming the correctness of the linearized vector band by agarose gel electrophoresis, the enzyme digestion vector template was recovered by agarose gel electrophoresis to obtain the linearized vector template.

[0062] (4) Homologous recombination of enzyme digestion vector and insert fragment Homologous recombination of the STTM insert obtained in (2) and the linearized vector template obtained in (3) was performed using the One Step Seamless Cloning Mix kit (purchased from Kangwei Century Biotechnology Co., Ltd., catalog number CW3034S). The reaction system was established according to Table 4 below: Table 4 shows the homologous recombination reaction system.

[0063] After gently mixing, react in a 50°C water bath or PCR instrument for 5-15 min. After the reaction, place the EP tube on ice to cool and then directly transform or store at -20°C to obtain the homologous recombination reaction product.

[0064] Subsequent steps include transforming DH5α competent cells, plasmid extraction, transforming Agrobacterium, infecting callus tissue, and obtaining rice mutant plants through a series of processes such as screening, differentiation, and rooting.

[0065] (5) Transformation of receptive state Add 5 μL of the homologous recombination reaction product to 50 μL of competent cells (DH5α), mix, and incubate on ice for 30 min (do not shake); gently remove, heat shock at 42℃ for 60 s, and immediately place on ice for 2 min; add 500 μL of LB liquid medium, and incubate at 37℃ with shaking for 1 hr; spread 100 μL of the bacterial culture onto an LB agar plate containing kanamycin, and incubate overnight at 37℃ with the plate inverted.

[0066] (6) Plasmid extraction Select a single clone of bacteria, extract the plasmid, and send it for sequencing. Once the sequencing is correct, you can obtain the pCam2300:pActin1::STTM vector for Agrobacterium transformation.

[0067] The pCam2300:pActin1::STTM vector is a vector obtained by homologous recombination of the STTM nucleic acid molecule shown in SEQ ID No. 3 into pCam2300:pActin1. This vector is used to silence tRF (CUC).

[0068] (7) Obtaining STTM rice lines The correctly sequenced knockout vector pCam2300:pActin1::STTM was transformed into Agrobacterium tumefaciens EHA105 via electroporation. After verification of the transformation bacteria, NPB embryo callus of the japonica rice variety was transformed according to conventional rice genetic transformation methods (as described in CN201110040681.0 and CN102174565A). T0 generation STTM rice plants were obtained through a series of processes including screening, differentiation, and rooting.

[0069] Genomic DNA was extracted from T0 generation STTM rice plants and amplified by PCR using the following identification primers. The primers for identifying the STTM strain are as follows: STTM-test-F: GGCCTTTCCTCTAGAATCCTA STTM-test-R: TGCCTGCAGGTCGACTCCGTT The rice plants that yielded a 258 bp band from the primers were identified as T0 generation positive STTM rice plants.

[0070] T0 generation positive STTM rice plants were self-crossed for 2 generations to obtain T2 generation STTM rice plants.

[0071] The single-plant PCR amplification was continued using the above method, and the 258 bp positive band was obtained as a positive T2 generation STTM rice plant.

[0072] (8) Northern blotting experiment to detect the inhibition of tRF (CUC) expression in STTM positive lines Two or more positive T2 generation STTM rice plants were obtained from step (7) above. Using the wild-type rice variety Nipponbare (NPB) as a control, 2 g of leaves from each rice material were ground into powder in liquid nitrogen. Total RNA was extracted according to the Invitrogen TRIzol Reagent instructions (Invitrogen Trizol Reagent, cat No. 15596-018), and the concentration was determined for later use. Northern blotting was then performed to detect the tRF (CUC) content in NPB and positive T2 generation STTM rice plants. The specific experimental steps are as follows: a. Preparation of 15% urea-polyacrylamide modified gel (50 mL): First, mix 25 mL of 30% polyacrylamide solution, 5 mL of 10× TBE, and 21 g of urea. Then, add DEPCH2O to bring the volume to 50 mL. Next, add 400 μL of 10% ammonium persulfate (AP) solution and 30 μL of TEMED. Mix well and quickly add the solution to the prepared gel plate using a sterilized 5 mL pipette tip. Leave space for the top layer of stacking gel. Press the separating gel with anhydrous alcohol to flatten it. After the separating gel solidifies, pour off the top layer of alcohol. Once the alcohol has evaporated completely, add the top layer of stacking gel. The stacking gel is prepared using 4% urea-free polyacrylamide gel (10 mL): 1.33 mL of 30% polyacrylamide solution, 1 mL of 10× TBE, 80 μL of 10% ammonium persulfate (AP) solution, and 10 μL of TEMED. Insert the gel comb and wait 10 minutes for the stacking gel to solidify. Then, remove the comb to proceed to the next step.

[0073] b. Sample preparation for loading: Take 20 μg of small RNA, add 2× RNA loading buffer, heat in a metal bath at 94°C for 5 min, then incubate on ice for 2 min, and then proceed to the next step.

[0074] c. Electrophoresis tank installation and sample loading: After setting up the electrophoresis equipment, be careful to place the gel plate slowly to prevent air bubbles from remaining at the bottom. Then, use 1×TBE as the electrophoresis buffer, add several clean ice packs, remove the comb, and use a clean 20 mL syringe to aspirate and blow out any residual gel, precipitated salt ions, and high-concentration urea from the sample wells to facilitate sample loading. After completing the above steps, you can proceed with sample loading. When loading samples, you can place the RNA marker on the side lane.

[0075] d. Electrophoresis: Electrophoresis was performed at a constant voltage of 200 V. After initial electrophoresis for 1 hour, the voltage was switched to a high voltage of 300 V and electrophoresis was continued until the bromophenol blue in the RNA loading buffer (approximately 8 nt at the tip) reached about 2 cm from the bottom of the gel.

[0076] e. Transfer membrane: After electrophoresis, remove the gel plate, cut off the sample well portion and the upper left corner of the gel, and similarly cut off the bromophenol blue band along the upper edge of the band. Then soak the gel in 1× TBE. Cut six layers of filter paper and one N sheet to the same size as the gel. + Membrane, for N + The membrane and filter paper were also immersed in 1× TBE, and three sheets of filter paper and N were placed from bottom to top in a large semi-dry transfer apparatus. + Add membrane, gel, and three sheets of filter paper. Cover the transfer apparatus and set it to a constant current of 450 mA for 45 minutes to transfer the membrane.

[0077] f. Ultraviolet crosslinking: After the transfer is complete, dry the membrane on absorbent paper, then place it face up in a UV crosslinker. Set the energy to 2,000 J and crosslink twice. Do not discard the residual gel after transfer; place it in a metal box, treat it with nucleic acid dye solution, and observe the transfer process.

[0078] g. Pre-hybridization: Gently roll up the membrane with tweezers and place it into the hybridization bottle with the membrane facing inwards. Then add 7 mL of PerfectHybPlus Hybridization Buffer (Sigma, catalog number SLBG7228V) and pre-hybridize at 42°C for 1 hour.

[0079] h. Isotope-labeled probes: Add 10 μL DEPC H2O, 2 μL 10× PNK buffer, 2 μL OligoDNA probe (10 μM), 1 μL T4 PNK, and 5 μL [γ-] to a 1.5 mL centrifuge tube. 32 P]-ATP, reaction at 37℃ for 1 hour; The probes are artificially synthesized DNA sequences. In this invention, the main probes used are those for detecting tRF (CUC) and those for detecting U6, which serves as an internal control small RNA. The sequences are as follows: tRF(CUC)-probe:5'- ATCCTAACCAGCTAGACTACAACGGA -3' U6-probe: 5'-CACGCTTAACCTAAGAGTTCT-3' The labeled probes were prepared using the T4 polynucleotide kinase reaction kit (NEW ENGLAND Biolabs, catalog number M0201V). The reaction system for labeling the probes is shown in Table 5 below: Table 5 shows the reaction system for the labeled probes.

[0080] i. Hybridization: After prehybridization, the labeled probes were added to the hybridization solution in the hybridization bottle and hybridized overnight at 42°C (24 hours). j. Washing the film: Wash the membrane with 20 mL of 2×SSC solution containing 0.1% SDS for 10 min; then wash the membrane with 20 mL of 1×SSC solution containing 0.1% SDS for 10 min, repeat once; after washing, use tweezers to remove the membrane and place it on absorbent paper, and use absorbent paper to dry the membrane surface, then wrap the membrane with plastic wrap, place it in a dark clip with the front side of the membrane facing up, use an isotope detector to detect the isotope signal on the membrane surface, then place a phosphor screen on the membrane and close the dark clip.

[0081] k. Phosphorus Scanning Screen: The phosphorus screen pressing time is determined based on the strength of the isotopic signal on the membrane. The phosphorus screen is then scanned and photographed using a Typhoon FLA 9000 (GE Healthcare). Hybridized membranes can be deprobe-treated with 0.1% SDS at 100°C, and then rehybridized with a new probe. This process can be repeated 3-5 times.

[0082] The results are as follows Figure 2 As shown, compared with NPB, the tRF (CUC) band is almost invisible in positive T2 generation STTM rice plants, indicating that the expression of endogenous tRF (CUC) in positive T2 generation STTM rice plants is suppressed.

[0083] Positive T2 generation STTM rice plants are designated as positive STTM rice and used in subsequent experiments.

[0084] Example 2: Compared to NPB, STTM rice lines with suppressed endogenous tRF (CUC) expression showed significantly enhanced resistance to rice blast. 1. Rice blast resistance test Rice Nipponbare NPB and two positive STTM rice lines, STTM #1 and STTM #2 obtained in Example 1, were planted in a rice culture room. The temperature was maintained at 28-30℃, humidity at approximately 70%, and cultured for 4-5 weeks under 12-hour light and 12-hour darkness conditions. Leaf fragments from the same position of the second leaf from the top were then incised with a scalpel, making three equally spaced incisions at the widest point of the leaf, leaving wounds without breaking the plant tissue. The leaves were then placed in a petri dish containing distilled water. 5-10 μL of a suspension of rice blast fungus P131 spores (concentration approximately 2 × 10⁻⁶) was then added. 5 Apply a drop (1 in 1 ml, water as solvent) to the wound, then cover the petri dish with the lid to maintain humidity. Transfer the inoculated rice leaves to a dark and humid place at 26°C and incubate for 24 hours, then transfer them to normal light conditions for continued incubation. After 10 days, the disease incidence is recorded.

[0085] See results Figure 3 It can be seen that, compared with NPB after inoculation with rice blast fungus, the leaf lesions of the two positive STTM rice lines STTM #1 and STTM #2 after inoculation with rice blast fungus were significantly reduced.

[0086] The length of leaf lesions was counted, and the results are as follows: Figure 4 As shown, compared with NPB after inoculation with rice blast fungus, the leaf lesion length of the two positive STTM rice lines STTM #1 and STTM #2 after inoculation with rice blast fungus was significantly reduced.

[0087] 2. Accumulation of rice blast fungus in leaves Leaves (3 leaves each) from two rice lines, STTM #1 and STTM #2, which were inoculated with rice blast fungus 10 days prior, were mixed and ground thoroughly. The mixed genomic DNA of rice and rice blast fungus was then extracted using the CTAB method. The detailed procedure is as follows: (1) Pack the rice sample into a 2.0 mL centrifuge tube containing zirconium dioxide beads, label it, and store it in liquid nitrogen; (2) Take out the 2.0 mL centrifuge tube containing the sample in liquid nitrogen and put it into a grinder for 1 min; (3) Add 600 μL of CTAB solution to each 2.0 mL centrifuge tube and heat the centrifuge tube in a 65℃ metal bath for 1 hr; (4) Centrifuge at 13,000 rpm for 10 min at room temperature, and transfer the supernatant to a new 1.5 mL centrifuge tube; (5) Add 500 μL of chloroform to a 1.5 mL centrifuge tube and mix by inverting the tube. (6) Centrifuge at 13,000 rpm for 10 min at room temperature, and transfer the supernatant to a new 1.5 mL centrifuge tube; (7) Add an equal volume of isopropanol to each 1.5 mL centrifuge tube and precipitate at -20℃ for at least 30 min; (8) Centrifuge at 13,000 rpm for 10 min at room temperature and discard the supernatant; (9) Add 1 mL of 75% ethanol to each 1.5 mL centrifuge tube, invert several times, and centrifuge at 13,000 rpm for 5 min at room temperature; (10) Discard the supernatant, centrifuge at 13,000 rpm for 2 min at room temperature, remove excess 75% ethanol, and air dry the precipitate at room temperature for 5 min; (11) Add 50 μL ddH2O to each 1.5 mL centrifuge tube to dissolve the precipitate for at least 1 hour, and store at 4°C for later use.

[0088] After obtaining the DNA, Real-time qPCR can be performed to detect the expression levels of *Magnapordica oryzae* genes in leaves of different strains, thereby reflecting the *Magnapordica oryzae* content. OsUBIQUITIN As an internal reference gene for rice, the rice blast fungus gene is... MoPot2 The reaction system for Realtime-qPCR (reagents were from the 2× M5 HiPer Realtime PCR Super mix kit, purchased from Beijing Polymer Biotechnology Co., Ltd., catalog number MF013-01) is shown in Table 6 below: Table 6 shows the Realtime-qPCR reaction system.

[0089] Among them, the detection of rice gene Os UBIQUITIN The primers are: OsUbiquitin-RT-qPCR-F:AACCAGCTGAGGCCCAAGA OsUbiquitin-RT-qPCR-R:ACGATTGATTTAACCAGTCCATGA Detection of rice blast fungus genes MoPot2 The primers are: MoPot2-RT-qPCR-F:ACGACCCGTCTTTACTTATTTGG MoPot2-RT-qPCR-R: AAGTAGCGTTGGTTTTGTTGGAT Perform RT-qPCR according to the procedure in Table 7 below: Table 7 shows the Realtime-qPCR reaction procedure.

[0090] The results are as follows Figure 5 As shown, compared with NPB after inoculation with rice blast fungus, the rice blast fungus gene was present in the leaves of the two positive STTM rice lines STTM #1 and STTM #2 after inoculation with rice blast fungus. MoPot2 The decreased expression level indicates a significant reduction in the accumulation of rice blast fungus.

[0091] Example 3: Compared to NPB, the mycelial expansion rate of rice blast fungus spores in the leaf sheaths of STTM rice lines is slower. Rice strains Nipponbare NPB and two STTM positive STTM lines (STTM #1 and STTM #2) obtained in Example 1 were planted in a rice culture room. The temperature was maintained at 28-30℃, humidity at approximately 70%, and cultured for 4-5 weeks under 12-hour light and 12-hour dark conditions. Leaf sheaths were harvested from healthy, robust rice seedlings and placed in a sealed, moisture-retaining box lined with sterile paper soaked in water for use in infection experiments. The cultured rice blast fungus spores (ZB25-GFP) were scraped off and the spore concentration was adjusted to 7-10 × 10⁻⁶ using sterile double-distilled water. 4 / mL, and then the spore suspension of the adjusted concentration is injected into the leaf sheath cavity with a syringe, and the infection is timed. The observation and recording are carried out using a confocal microscope according to the designed observation time points.

[0092] Before observation, a temporary section needs to be prepared. The specific method is to add an appropriate amount of distilled water to a glass slide, place the thinned leaf sheath epidermis as thin as possible on the glass slide with the inside facing up, cover it with a coverslip, observe the temporary section, take a picture, and record the state of the leaf sheath cells when the rice blast fungus spores infect the cells.

[0093] The results are as follows Figure 6 As shown, compared with NPB, after 12 hours (hpi), 20 hours, 28 hours, 36 hours and 44 hours of infection of rice leaf sheaths of STTM #1 and STTM #2, the infection progress of rice blast fungus spores in the leaf sheath cells of STTM #1 and STTM #2 was significantly slowed down.

[0094] At each time point, the spore infection status on the leaf sheath cells of each rice line was statistically analyzed according to six states: no appressoria, formed appressoria, formed short hypha, formed long hypha, infected neighboring single cells, and infected cells far away. At least 20 spore infection statuses were photographed at each time point.

[0095] Percentage of spores in a specific state at each time point (spore state percentage) = Number of spores in a specific state at that time point / Total number of randomly observed spores at that time point * 100% The results are as follows Figure 7 As shown, statistical analysis revealed that, compared to NPB, the mycelial expansion rate of rice blast fungus spores in the leaf sheath cells of STTM #1 and STTM #2 was significantly slower after 12, 20, 28, 36, and 44 hours of infection with STTM #1 and STTM #2.

[0096] Example 4: Compared to NPB, STTM rice lines showed greater resistance to rice blast in field yield trait tests. Two rice lines, STTM #1 and STTM #2, of Nipponbare NPB and STTM positive rice were planted in the field. The field yield trait determination experiment was carried out in October 2023 at the experimental farm of Sichuan Agricultural University in Wenjiang District, Chengdu, Sichuan Province. The growth period of the rice was roughly between the late grain-filling stage and the yellow ripening stage.

[0097] Before conducting field yield trait testing on rice, it is necessary to test rice in both a healthy mock nursery and a diseased nursery (the diseased nursery being a naturally occurring rice blast disease nursery from the research group of Wang Wenming at Sichuan Agricultural University). M.oryzae The whole rice plant was photographed. The whole rice plant was dug up directly from the corresponding field and then buried in a flowerpot at the same depth before being photographed. Figure 8 The photo shows rice paddies in a health nursery. Figure 8 The photo in image b shows rice in a diseased nursery.

[0098] In this invention, each experimental group and each strain was planted in four quadrats, each quadrat having an area of ​​0.5 m². 2Each plot was planted with 5 rows, and 10 rice plants were planted in each row. Yield determination mainly involves calculating the dry weight (grain weight) of rice seeds harvested in each quadrat, with four technical replicates for each line. Thousand-grain weight is calculated by randomly selecting 1,000 plump grains from each quadrat and calculating their total weight, with four technical replicates for each line. Plant height is measured from the ground surface to the tip of the upright panicle, with 5 plants selected per quadrat, totaling 20 plants across four quadrats, and twenty technical replicates for each line. Effective tiller number is calculated by counting the number of tillers per plant that produces panicles, with 5 plants selected per quadrat, totaling 20 plants across four quadrats, and twenty technical replicates for each line. Plumping percentage is calculated as the percentage of the total weight of all plump grains per plant relative to the total weight of all plump and unfilled grains per plant, with 5 plants selected per quadrat, totaling 20 plants across four quadrats, and twenty technical replicates for each line.

[0099] Statistical calculations show that, in a healthy nursery, the average yield of NPB (non-performing bovine rice) per 0.5 m² plot (grain weight per 0.5 m²) is 1.532 kg / 0.5 m². 2 The average yield of STTM #1 was 1.582 kg / 0.5 m². 2 The average yield of STTM #2 was 1.694 kg / 0.5 m². 2 There was no statistically significant difference in the average quadrat yield between the NPB and STTM dual-line populations; however, in the diseased nursery, the average quadrat yield of NPB decreased to 1.245 kg / 0.5 m². 2 The average yield of STTM #1 decreased to 1.519 kg / 0.5 m². 2 The average yield of STTM #2 decreased to 1.535 kg / 0.5 m². 2 At this point, both STTM #1 and STTM #2 showed significantly higher average yields than NPB, with STTM #1 decreasing by 3.98% and STTM #2 by 9.39%. Compared to NPB's 18.73%, the STTM double-line strains demonstrated more stable yields and greater resistance to rice blast. Statistical results are shown below. Figure 9 a.

[0100] Regarding thousand-grain weight, in healthy nurseries, the average thousand-grain weight of NPB was 22.89 g, STTM #1 was 24.65 g, and STTM #2 was 25.26 g. STTM #1 and STTM #2 were significantly higher than NPB in terms of thousand-grain weight. However, in diseased nurseries, the average thousand-grain weight of NPB decreased to 20.45 g, STTM #1 decreased to 21.98 g, and STTM #2 decreased to 22.14 g. At this point, STTM #1 and STTM #2 were still significantly higher than NPB in terms of average thousand-grain weight. Therefore, compared to NPB, the STTM dual-line strains showed greater resistance to rice blast. Statistical results are shown below. Figure 9 b.

[0101] Regarding plant height, in the healthy nursery, the average plant height of NPB was 99.43 cm, STTM #1 was 106.3 cm, and STTM #2 was 110.1 cm. STTM #1 and STTM #2 were significantly taller than NPB. In the diseased nursery, the average plant height of NPB decreased to 93.1 cm, STTM #1 decreased to 101.1 cm, and STTM #2 decreased to 106.5 cm. STTM #1 and STTM #2 were still significantly taller than NPB, with STTM #1 showing a 4.89% reduction and STTM #2 a 3.27% reduction. Compared to NPB's 6.37% reduction, the STTM double lines showed greater resistance to rice blast. Statistical results are shown below. Figure 9 c.

[0102] Regarding the number of effective tillers, in the healthy nursery, NPB had an average of 13.55 effective tillers, STTM #1 had an average of 15.3 effective tillers, and STTM #2 had an average of 16.9 effective tillers. STTM #1 showed no statistically significant difference compared to NPB, while STTM #2 had significantly more effective tillers than NPB. In the diseased nursery, the average number of effective tillers decreased to 10.05 for NPB, 13.8 for STTM #1, and 13.4 for STTM #2. Although the average number of effective tillers decreased in all three lines, the reduction was 9.8% for STTM #1 and 20.71% for STTM #2. Compared to NPB's 25.83%, the STTM double-line strains showed greater resistance to rice blast. Statistical results are shown below. Figure 9 d.

[0103] Regarding seed filling rate, in healthy nurseries, the average seed filling rate of NPB was 84.56%, STTM #1 was 84.68%, and STTM #2 was 84.75%; in diseased nurseries, the average seed filling rate of NPB was 84.05%, STTM #1 was 84.59%, and STTM #2 was 84.36%. There was no significant difference in seed filling rate between the NPB and STTM lines in either healthy or diseased nurseries. Statistical results are shown below. Figure 9 e.

[0104] In conclusion, compared with NPB, STTM rice lines showed greater resistance to rice blast in field yield trait tests.

[0105] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

[0106] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. RNA, which is any of the following: A1) The nucleotide sequence includes the RNA molecule shown in SEQ ID No. 1; The RNA sequences defined in A2) and A1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and encode nucleic acid molecules with the same function.

2. The application of the RNA described in claim 1 in regulating plant resistance to rice blast; Or the application of the RNA described in claim 1 as a silencing target in regulating plant resistance to rice blast.

3. The use of substances that inhibit or reduce the activity or content of the RNA described in claim 1, or that inhibit or reduce the expression of nucleic acids encoded by the RNA described in claim 1, in improving plant resistance to rice blast.

4. The use of substances that inhibit or reduce the activity or content of the RNA of claim 1, or that inhibit or reduce the expression of nucleic acids encoded by the RNA of claim 1, in the cultivation of rice blast-resistant plants.

5. The application according to claim 3 or 4, characterized in that: The substance is a substance that silences the expression of the nucleic acid encoding the RNA of claim 1.

6. The application according to claim 5, characterized in that: The substance includes the STTM silencing system; The STTM silence system includes any of the following: C1) STTM nucleic acid molecules; C2) An expression cassette, recombinant vector, or recombinant bacteria containing the STTM nucleic acid molecule described in C1); The STTM nucleic acid molecule is any one of the following: B1) The nucleotide sequence includes the DNA molecule shown in SEQ ID No. 3; The DNA sequences defined in B2) and B1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and encode nucleic acid molecules with the same function.

7. A method for improving plant resistance to rice blast, as shown in D1) or D2). D1) The method includes the following steps: reducing or inhibiting the RNA activity or content of the target plant as described in claim 1, thereby improving the plant's resistance to rice blast; D2) The method includes the following steps: reducing or inhibiting the expression of the RNA encoding the RNA of claim 1 in the target plant to improve plant resistance to rice blast.

8. A method for cultivating transgenic plants with high resistance to rice blast, comprising the following D1) or D2): D1) The method includes the following steps: reducing or inhibiting the RNA activity or content of claim 1 in the target plant to obtain a transgenic plant; D2) The method includes the following steps: reducing or inhibiting the expression of the RNA-encoded nucleic acid of claim 1 in the target plant to obtain a transgenic plant; The genetically modified plant exhibits higher resistance to rice blast than the target plant.

9. The method according to claim 7 or 8, characterized in that: The reduction or inhibition of the RNA activity or content in the target plant as described in claim 1, or the reduction or inhibition of the expression of the RNA encoding nucleic acid in the target plant as described in claim 1, is to silence the expression of the RNA encoding nucleic acid in the target plant as described in claim 1; And / or, the silencing is achieved by introducing the recombinant vector containing the STTM nucleic acid molecule as described in claim 6 into the target plant.

10. The STTM silencing system of claim 6.

Images