A method for the directed biosynthesis of xanthan gum with a swallowing safety guide
By designing a coupling index of interfacial friction coefficient and tensile relaxation behavior, an engineered strain of xanthan gum with traceless knockout of gumF and gumG and enhanced gummL was constructed. This solved the problems of performance fluctuation and resistance gene residue of xanthan gum in dysphagia foods, and realized the directed biosynthesis of dysphagia-safe xanthan gum with low friction and high cohesion, which is suitable for dysphagia foods and special medical purpose formula foods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHAANXI UNIV OF SCI & TECH
- Filing Date
- 2026-02-28
- Publication Date
- 2026-06-05
AI Technical Summary
The existing xanthan gum has problems with incomplete performance evaluation in the field of dysphagia food, and cannot accurately control side chain modification, resulting in large batch performance fluctuations. In addition, traditional genetically engineered strains have problems with resistance gene residues and poor stability, making it difficult to meet the requirements of swallowing safety and texture stability.
Using the interface friction coefficient-stretch relaxation behavior coupling index as the design target, the expression of the gumF and gumG genes was enhanced by knocking out the gumF and gumG genes without scarring, and a resistant chromosome-engineered strain was constructed to achieve directional regulation of the proportion and distribution of xanthan gum side chain groups, ensuring low interface friction and high cohesion characteristics in a simulated throat environment.
It achieves improved batch stability of xanthan gum, reduces the frictional resistance of food boluses on the pharyngeal mucosa and the risk of residue adhering to the wall, improves swallowing safety, is suitable for foods with swallowing disorders, meets the strict requirements of clinical nutrition management, and has food safety and reliability for industrial production.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of synthetic biology and functional food technology, specifically relating to a method for the directional biosynthesis of xanthan gum with swallowing safety as the guiding principle. Background Technology
[0002] Xanthan gum has a wide and important application in the fields of dysphagia foods and special medical purpose formula foods. Dysphagia is common in the elderly and patients with neurological diseases such as stroke and Parkinson's disease. When these patients consume liquid or semi-liquid foods, food boluses are prone to scattering, sticking to the diaphragm, or remaining in the pharynx, which can lead to serious problems such as aspiration or aspiration pneumonia. In clinical nutrition management, thickeners are commonly used to control the consistency and flowability of liquid foods to ensure the safe consumption of patients. Xanthan gum, due to its unique properties, has become an extremely widely used thickener in this field. Xanthan gum is an extracellular acidic heteropolysaccharide produced by the fermentation of Xanthomonas aeruginosa. Its main chain consists of β-1,4 linked glucose residues, and its side chains consist of mannose-glucuronic acid-mannose, with acetyl and pyruvate modifications. This unique structure endows xanthan gum with significant shear-thinning properties, meaning that the viscosity of the fluid decreases when subjected to shear force. It also exhibits high viscosity stability and tolerance to degradation by salivary amylase. These properties make it ideal for use in foods for dysphagia and special medical purposes, providing patients with safe and suitable food.
[0003] However, several problems remain to be solved in the practical application of xanthan gum. Currently, the evaluation of xanthan gum performance is mostly limited to shear viscosity and conventional viscoelastic parameters. However, the human swallowing process is extremely complex, involving not only shear deformation but also fluid stretching and fracture, as well as interfacial friction and slippage between the bolus and the moist mucosa. Shear viscosity alone cannot fully reflect two key properties: first, the bolus's ability to cohede and clump together, which is related to maximum stretch viscosity, relaxation time, and droplet aspect ratio. Good cohesion and clumping ability helps the bolus pass smoothly through the throat, reducing residue; second, the bolus's ability to lubricate and reduce drag on the throat mucosa, which is related to the interfacial friction coefficient. If the interfacial friction coefficient is too high, the bolus is more likely to remain attached to the walls of the epiglottis, pyriform crypt, etc., increasing the risk of aspiration. Furthermore, the degree of side-chain modification of xanthan gum in industrial production varies significantly from batch to batch, leading to large fluctuations in the rheological properties and swallowing safety of different batches, making it difficult to meet the stringent requirements for textural stability and safety in foods specifically designed for swallowing disorders.
[0004] To address the aforementioned issues, existing technologies have been explored and attempted to address these problems. In recent years, researchers have attempted to regulate the degree of side-chain modification of xanthan gum by genetically engineering Xanthomonas aeruginosa. For example, by adjusting... gumThe expression of genes related to acetyltransferase and pyruvate transferase within gene clusters can alter the content of acetyl and pyruvate groups within a certain range, aiming to improve the properties of xanthan gum. However, most existing strain modifications primarily aim to increase yield or viscosity, and often employ free plasmid expression systems. These systems have several drawbacks: they require antibiotic screening, increasing production costs and operational complexity; plasmids have poor stability and are prone to loss during fermentation; and in industrial continuous fermentation, genetic traits are easily degraded, leading to unstable strain performance and an inability to consistently produce xanthan gum that meets requirements. Furthermore, the introduction of resistance genes limits its application in the food industry, as residual resistance genes in food may pose potential risks to human health.
[0005] In summary, while existing technologies have explored the performance regulation of xanthan gum to some extent, significant shortcomings remain. Firstly, a synergistic design system centered on swallowing tribological and stretching rheological indices has not yet been established, making it impossible to precisely design and optimize key performance aspects of the swallowing process at the molecular structural level. Secondly, the crucial impact of the ratio and distribution of acetyl and pyruvate groups on fluid-mucosal interface frictional properties and stretching relaxation behavior is not clearly defined, resulting in blind spots in structural design. Furthermore, existing technologies cannot achieve precise control over the acetyl / pyruvate group ratio and distribution, leading to structural randomness from the outset and consequently, large performance fluctuations across different batches of products. Moreover, the constructed engineered strains suffer from problems such as residual exogenous resistance genes and inability to achieve long-term stable continuous fermentation, hindering the industrial-scale stable production of structurally customized xanthan gum and failing to meet the stringent requirements for xanthan gum in foods specifically designed for swallowing disorders. Summary of the Invention
[0006] To address the issue that existing xanthan gum technologies do not focus on key swallowing performance, this invention proposes a swallowing safety-oriented directional biosynthesis method for xanthan gum. Using the interface friction coefficient-stretch relaxation behavior coupling index as the design target, the proportion and distribution of xanthan gum side chain groups are precisely controlled. Industrial-scale directional synthesis is achieved through multi-site reconstruction of non-resistant chromosomes, reducing residues on the walls of swallowing-impairing fluid foods and improving batch stability.
[0007] To achieve the above objectives, the present invention provides the following technical solution: a method for the directional biosynthesis of xanthan gum with swallowing safety guidance, comprising the directional synthesis of swallowing-safe xanthan gum using engineered strains, wherein the engineered strain is Xanthomonas auricula-judae. Xanthomonas campestris As the starting strain, the engineered strain satisfies: gumF The gene was knocked out without a trace; gumG The gene was knocked out without a trace; gumLThe gene promoter is replaced in situ with a strong promoter to increase the level of pyruvate modification; and the chromosome of the engineered strain does not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
[0008] Furthermore, the ratio and distribution of acetyl and pyruvate groups on the side chains of the swallowable xanthan gum molecule are directionally regulated, and the specific regulation method satisfies at least one of the following: 1) By inhibiting or completely removing the side-chain acetylation-related factors gumF Genes and gumG The function of genes; 2) By enhancing the effects related to side-chain acetone acidification gumL Gene expression.
[0009] Furthermore, the interfacial friction coefficient μ of the swallowable xanthan gum measured in a friction test system containing mucin is not greater than 0.60.
[0010] Furthermore, the interfacial friction coefficient μ was determined under the following conditions: at 37°C, in an aqueous system containing 5 mg / mL to 20 mg / mL of mucin, the test was conducted using a pin-disc or triborheometer, with a normal load of 0.5 N to 5 N and a sliding speed of 1 mm / s to 50 mm / s.
[0011] Furthermore, after the engineered strain was inoculated into a seed culture medium and cultured, it was transferred to a fermenter for aerobic fermentation at 25℃-32℃ and pH 6.5-7.5 for 48 h-96 h without adding antibiotics. After fermentation, the fermentation broth was heated to inactivate the bacteria and centrifuged to remove the cells. Extracellular polysaccharides were extracted by isopropanol precipitation to obtain swallowable xanthan gum.
[0012] The present invention also provides a xanthan gum with swallowing safety as its guiding principle, which is prepared by the above-mentioned method of directional biosynthesis of xanthan gum with swallowing safety as its guiding principle.
[0013] The present invention also provides an engineered bacterial strain for producing xanthan gum with swallowing safety guidance, wherein the engineered bacterial strain is Xanthomonas. Xanthomonas campestris As the starting strain, the engineered strain satisfies: gumF The gene was knocked out without a trace; gumG The gene was knocked out without a trace; gumL The gene promoter is replaced in situ with a strong promoter to increase the level of pyruvate modification; and the chromosome of the engineered strain does not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
[0014] Furthermore, the engineered strain achieves double recombination via suicide vector-mediated homologous recombination technology, completing... gumF Gene, gumG Scarless gene knockout andgumL In situ replacement of gene promoters, while utilizing sacB A sucrose-lethal reverse screening method was used to obtain recombinant strains that do not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
[0015] Furthermore, after 100 consecutive passages under conditions without antibiotic selection pressure, the engineered strain's gel production structure parameters remained stable and did not undergo significant degradation.
[0016] This invention also provides the use of xanthan gum with swallowing safety guidance in the preparation of liquid foods, semi-fluid foods or special medical purpose formulations for dysphagia.
[0017] Compared with the prior art, the present invention has at least the following beneficial effects: This invention provides a method for the targeted biosynthesis of xanthan gum with swallowing safety as the core objective. By constructing engineered strains capable of precisely controlling side chain modifications, it achieves a targeted match between the molecular structure of xanthan gum and swallowing function. For the first time, it uses swallowing tribology and tensile rheology as core constraints for product design. Compared to traditional fermentation production methods, this method no longer relies on random synthesis from natural strains. Instead, through precise genetic modification, it directly controls the ratio and distribution of acetyl and pyruvate groups on the xanthan gum side chains. This results in a product that simultaneously possesses low interfacial friction and high cohesive aggregation characteristics in a simulated pharyngeal mucosa environment, significantly improving swallowing safety and effectively reducing the risks of bolus scattering, pharyngeal residue, and aspiration. It truly achieves a shift from passive thickening to active adaptation to swallowing physiology.
[0018] The engineered strain used in this invention is Xanthomonas aeruginosa as the starting strain, through... gumF , gumG Gene knockout without scarring and gumL The in-situ gene promoter replacement strategy enables precise multi-site modification at the chromosome level without introducing any exogenous plasmid backbone or antibiotic resistance genes, ensuring high food safety. This synthetic method completely eliminates the dependence of traditional genetically engineered strains on free plasmids, inducers, and antibiotic selection pressures, eliminating industrial production risks such as resistance gene diffusion, plasmid loss, and unstable genetic traits from the source. Stable fermentation is possible without antibiotics, and the gum structure and properties do not degrade during continuous subculturing. This solves key problems that have long existed in industrial production, such as large batch-to-batch fluctuations and uncontrollable quality. It provides a stable, reliable, and compliant biosynthetic pathway for the large-scale, continuous, and low-cost production of xanthan gum specifically for dysphagia, possessing significant industrialization advantages.
[0019] The directed biosynthesis method of this invention achieves a complete chain from structural design, strain modification, fermentation preparation, and functional evaluation. Through precise control at the strain level, xanthan gum is directly endowed with ideal swallowing adaptability, eliminating the need for subsequent complex physical or chemical modifications. The process is simple, green, and efficient. The prepared swallowing-safe xanthan gum exhibits synergistically optimized comprehensive properties in shear rheology, tensile rheology, and interfacial lubrication. It not only meets the stringent requirements of clinical nutrition management for consistency stability but also significantly reduces the feeding risk for patients with swallowing disorders. This method not only broadens the application depth of xanthan gum in the field of special medical purpose formulation foods but also provides a new approach and demonstration model for the functionalization and precise design of polysaccharide thickeners, possessing significant technical, clinical, and social value.
[0020] The engineered strain provided by this invention uses Xanthomonas aeruginosa as the starting strain, through... gumF , gumG Gene knockout without scarring and gumL In-situ replacement of the gene promoter enabled targeted regulation of the modification levels of acetyl and pyruvate groups on the xanthan gum side chains, enabling the stable synthesis of swallow-safe xanthan gum with low interfacial friction and high cohesiveness. The strain's chromosome contains no exogenous plasmid backbone or residual antibiotic resistance genes, meeting the safety requirements for food-grade microorganisms and allowing direct application in the production of food and special medical purpose food ingredients. Furthermore, this engineered strain exhibits stable genetic traits, allowing for continuous passage without antibiotic selection pressure while maintaining the gum-producing structure and properties without degradation. This effectively solves the problems of instability, easy degradation, and limited safety associated with traditional recombinant bacterial plasmids, providing core strain support for the stable industrial preparation of swallow-safe xanthan gum, demonstrating outstanding practicality and industrialization prospects.
[0021] The xanthan gum described in this invention, designed for swallowing safety, can be widely used in liquid foods, semi-liquid foods, and special medical purpose formulations for dysphagia. It significantly reduces the frictional resistance between the food bolus and the pharyngeal mucosa, enhances food bolus cohesion, and reduces residue buildup in the epiglottis and pyriform recess, thereby lowering the risk of aspiration and aspiration pneumonia. Furthermore, this xanthan gum maintains stable consistency in complex matrices such as milk, fruit juice, and high-salt, high-calcium solutions, demonstrating strong applicability and providing safer, palatable, and stable clinical nutritional support for individuals with dysphagia, thus possessing significant clinical application value. Attached Figure Description
[0022] Figure 1 For use gumF, gumG Seamless removal and gumL Schematic diagram of a suicide vector structure with promoter replacement; A: pK18mobsac B- ΔgumF Vector spectrum; B: pK18mobsacB- ΔgumG Vector spectrum; C: pK18mobsacB-ΔgumL Carrier map. Figure 2 To compare the tribological results of different xanthan gum samples under a mucin-containing simulated environment, the macroscopic frictional forces of Mucin, Mucin-XG, Mucin-DPXG, and Mucin-DAXG were measured using a pin-disc tribometer. (Note: XG: unmodified control; Mucin: porcine gastric mucin, zero acetyl (DAXG), zero pyruvate (DPXG)). Figure 3 Comparison of shear rheology and viscoelastic / thermal rheological behavior of xanthan gum with different fine structures. (Note: XG: unmodified control, XG1: zero acetyl (DAXG), XG2: low acetyl, XG3: zero pyruvate (DPXG), XG4: low pyruvate). Detailed Implementation
[0023] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0024] This invention provides a method for the targeted biosynthesis of xanthan gum with swallowing safety as the guiding principle, the specific steps of which include: Step 1: Establish a multidimensional evaluation system that includes interfacial tribological and tensile rheological indices. Determine the target structural parameters by evaluating xanthan gum samples with different side chain modification structures. The multidimensional evaluation system includes at least two components: first, measuring the interfacial friction coefficient μ in a system containing artificial mucin and / or simulated saliva; and second, measuring at least one of the following parameters using a capillary fracture rheometer and / or high-speed imaging: droplet aspect ratio, maximum tensile viscosity, and relaxation time.
[0025] Step 2: Construct an engineered strain for xanthan gum production that does not contain any exogenous antibiotic resistance gene residues, enabling it to synthesize xanthan gum that meets the target structural parameters.
[0026] Step 3: Ferment the engineered strain without adding antibiotics to obtain fermentation broth.
[0027] Step 4: Inactivate the fermentation broth, remove bacterial cells, and extract polysaccharides to obtain a customized xanthan gum product.
[0028] Further, the fermentation process must be carried out under aerobic conditions suitable for the growth and gum production of Xanthomonas aeruginosa, and no antibiotics are added to exert selective pressure throughout the process; this fermentation method can stably obtain structurally customized xanthan gum products, and the products can maintain structural characteristics consistent with the target side chain modification ratio and distribution.
[0029] Example 1 The specific steps for determining the structural parameters of xanthan gum for swallowing safety guidance are as follows: Step 1: To determine the xanthan gum side chain modification parameters suitable for swallowing safety, structural gradient samples with different acetyl and pyruvate group contents were designed, including a natural control group, a high acetyl low pyruvate group, a low acetyl low pyruvate group, and a low / zero acetyl high pyruvate group.
[0030] Step 2: In the tribological test, the sample is prepared as a 0.5-1.5 wt% aqueous solution, and 5-20 mg / mL artificial mucin and simulated saliva system are added. The interfacial friction coefficient μ is measured at 37℃ using a pin-disc or triborheometer under a normal load of 0.5-5N and a sliding speed of 1-50 mm / s to determine the characteristic velocity range related to swallowing residue.
[0031] The interfacial friction coefficient μ was determined according to the friction test method described in the examples. The mucin-containing system was preferably prepared using porcine gastric mucin or an equivalent mucin preparation (e.g., 5-20 mg / mL), and a simulated salivary ion system was added. The friction pair material could be one or more of stainless steel, glass, or elastomer materials. During the test, the frictional force and normal force were recorded during the velocity scan, and μ was calculated. The value of μ was preferably the average value after reaching steady state, or the average value within the characteristic velocity range related to the swallowing process. The test was repeated at least three times for each sample, and the average value was taken as the result.
[0032] Requirements: The interfacial friction coefficient μ of xanthan gum in a friction test system containing mucin should not be greater than 0.60, preferably not greater than 0.56, and more preferably not greater than 0.52; Step 3: In the tensile rheological test, a capillary fracture rheometer combined with a high-speed camera system is used to record the tensile fracture process of the droplet, and the droplet aspect ratio (AR), maximum tensile viscosity (ηE,max) and relaxation time (λ) are obtained.
[0033] Under the same xanthan gum mass fraction, temperature, and test conditions, compared with the commercially available natural xanthan gum control sample, the customized xanthan gum of this invention exhibits a longer relaxation time λ and / or a higher maximum tensile viscosity ηE,max and / or a larger droplet aspect ratio AR, thus demonstrating stronger tensile fracture resistance and clump-forming ability.
[0034] Preferably, the improvement is characterized by a statistically or engineeringally significant improvement in at least one indicator relative to the control.
[0035] Step 4: By comprehensively analyzing the interfacial friction coefficient and tensile rheological parameters, xanthan gum structural combinations that simultaneously satisfy low friction and suitable cohesion are selected as the target for engineered bacteria to synthesize.
[0036] Example 2 like Figure 1 As shown, this invention constructs three targeted suicide vectors (pK18mobsacB - ΔgumF , pK18mobsacB - ΔgumG , pK18mobsacB - ΔgumL ), respectively used for gumF , gumG The seamless knockout of genes and promoter replacement of the gumL gene provide core tools for constructing food-grade antibiotic-free engineered bacteria. The specific construction steps are as follows: Step 1: Using xanthomonascampestris-HZB218409, a xanthomonas-producing bacterium, as the chassis strain, multi-site gene reconstruction was performed using chromosome-free homologous recombination technology based on suicide vectors.
[0037] Step 2, First build gumF and gumG Gene knockout vectors and gumL The gene promoter was replaced with a vector, and a recombinant fragment containing upstream and downstream homologous arms was ligated into a suicide vector. The vector was then introduced into the basal bacteria via electroporation. Single-exchange-integrated strains were screened on antibiotic-containing plates, and after culturing in antibiotic-free medium, reverse selection was performed on plates containing 10% sucrose to induce a second homologous recombination and loss of the vector backbone.
[0038] Step 3: Perform PCR identification and antibiotic susceptibility testing on the obtained recombinant strain to confirm its effectiveness. gumF and gumG Gene knockout without scars and gumL The promoter was successfully replaced in situ, and the absence of exogenous resistance genes in the chromosome was verified. The resulting engineered strain was used for the targeted biosynthesis of xanthan gum, the target structure.
[0039] Furthermore, the construction of this engineered strain relies on a specific vector system that integrates... sacB Reverse filter tags and cat The resistance gene, relying on the homologous recombination mechanism to complete gene editing, successfully avoids the antibiotic dependence problem of free plasmid expression system, solves the pain point of genetic trait degradation in industrial continuous fermentation, realizes food-grade modification of Xanthomonas, provides core tools for the targeted regulation of the degree of acetyl and pyruvate modification, and ensures the stability and controllability of xanthan gum molecular structure customization at the strain level. Specifically, this engineered strain achieves double crossover through homologous recombination mediated by this suicide vector, utilizing... sacB Recombinant strains without a carrier backbone were obtained by sucrose-lethal reverse screening; and the gel production structure parameters of this strain remained stable and did not degrade significantly after 100 consecutive passages without antibiotic selection pressure.
[0040] Preferably, the primer sequences and gene sequences used in the above steps are as follows:
[0041] gumF sequence gumG sequence gumL sequence ATGGCCAACGCTTTACTGCAGAAATGGGTGGACGCGCGGAACGTCGCGCATTGTTCTGGTGGCAGCCCAAAAACGGTGGCGTGAACATGGGGGATCACCTGTCGAAGGTGATCGTGTCGTGCGTGTTGGCGTTGCAGGACAAGACACTTCTGGAAAAACGCGATTTGCGCAAGAAGCTGATCGCAACCGGGTCGGTGC TGCATTTCGCCAAAGATGGCGACACCGTATGGGGAAGCGGTATCAACGGCAAGATTCCAGCCGAGCGCAATACGTTCAGCACGCTGGACGTACGCGCGGTACGCGGTCCCAAGACCCGCGCGTTTTTGCTGGAACGTGGCATCGCCGTGCCTGAGGTCTACGGAGACCCGGGATTGCTGACCCCGATGTTTTTCCCCGC CGACGCCCTCGGCCCGGTGACCAAGCGTCCGTTCGCGATCGTGCCGCAGTTCAACGAGCCGGTTGAAGTACAGCGCCTACGCCGAGGATCTGGTGTTCCCCAACGTCAAGCCGGCCGCCTTCATGAGTGCGCTGCTGGGTGCAAAATTTGTCATCAGCAGTTCGCTGCACGGCCTGATCCTTGCCGAAGCCTATGG CATCCCGGCGGTGTATCTGGACTGGGGCGACGGCGAAGACCGTTTCAAGTACGACGACGACTACCACGGCACCAGGCGCATGCAATGGCATGCCGGCCACAGCGTGGAAGAAGGCATGGAACTGGGCGGCGACGGCAGTTTCGATCTTGGACGCTTGGAGGCAGGATTGCTGGCTGCGTTCCCTTACGATTTGGGGTGA Example 3 The specific steps for conducting antibiotic-free fermentation and structural consistency verification are as follows: Step 1: After inoculating the engineered strain from Example 2 into seed culture medium, it was transferred to a 5 L fermenter for aerobic fermentation. Fermentation was carried out at 25-32℃ and pH 6.5-7.5 for 48-96 h, without the addition of antibiotics.
[0042] Step 2: After fermentation, the fermentation broth was heated to inactivate the cells and centrifuged to remove the cells. Extracellular polysaccharides were extracted using the isopropanol precipitation method. The obtained polysaccharides were analyzed for acetyl and pyruvate group content, molecular weight, and monosaccharide composition to verify their structural characteristics.
[0043] Furthermore, the stability of the engineered bacteria was verified under continuous subculture or continuous fermentation conditions. The structural consistency was evaluated by comparing the side chain modification ratio and molecular weight of products from different generations.
[0044] To prove that the extracellular polysaccharide synthesized by the engineered strain of this invention is xanthan gum and not other extracellular polysaccharides, the following method was used for identification: after fermentation, the supernatant was precipitated with isopropanol and dried to obtain a polysaccharide sample; the sample was then acid-hydrolyzed and its monosaccharide composition was determined by liquid chromatography. The results showed that the polysaccharide was mainly composed of glucose, mannose, and glucuronic acid, which is consistent with the typical monosaccharide composition characteristics of xanthan gum; combined with the typical shear thinning and viscoelastic fingerprint characteristics (G′>G″) of the polysaccharide, it was thus proved that the extracellular polysaccharide synthesized by the engineered strain of this invention is xanthan gum.
[0045] Example 4 The functional verification was conducted in a swallowing simulation environment. The specific steps are as follows: Step 1: Prepare a 1.0 wt% solution of the customized xanthan gum obtained in Example 3 and compare it with commercially available natural xanthan gum.
[0046] Step 2: In tribological testing, the interfacial friction coefficient μ was measured in a system containing artificial mucin. The results showed that the customized sample had a lower friction coefficient within the swallowing characteristic velocity range. Combined with... Figure 2 Data analysis revealed that the pure mucin group had the highest friction coefficient (μ≈0.7), indicating poor lubrication of the pharyngeal mucosa. The addition of xanthan gum reduced the friction coefficients of all systems to varying degrees, confirming that xanthan gum effectively enhances the sliding ability of food boluses on the mucosal surface. Specifically, the customized xanthan gums with zero pyruvate (DPXG) and zero acetyl (DAXG) groups (Mucin-DPXG, Mucin-DAXG) exhibited significantly lower friction coefficients than the unmodified control (Mucin-XG), decreasing to μ≈0.55-0.6. This indicates that the absence of acetyl and pyruvate groups on the side chains significantly reduces interfacial frictional resistance between the food bolus and the mucosal surface, decreasing the risk of food residue adhering to the pharyngeal wall and thus improving swallowing safety.
[0047] The above results are consistent with the conclusions of tribological tests, clarifying the regulatory effect of side chain modification on swallowing lubrication performance and providing direct experimental basis for the design index of low-friction lubrication at the interface.
[0048] Step 3, in the tensile rheological test, the droplet aspect ratio (AR), maximum tensile viscosity (ηE,max), and relaxation time (λ) were measured. The results showed that the customized xanthan gum sample could maintain or improve cohesion while exhibiting excellent tensile stability. Combined with... Figure 3 Analysis shows that the above-mentioned tensile rheological properties are closely related to the side chain modification and molecular structure of xanthan gum, directly reflecting the ability of food masses to aggregate. Figure 3 The revealed structure-rheological properties are consistent.
[0049] Figure 3 The results showed that all samples exhibited typical shear-thinning characteristics, making them suitable for swallowing. The customized modified xanthan gum (XG1-XG4) had better tensile rheological properties than the unmodified control (XG): the zero-acetyl sample (XG1) had the best ηE,max, λ and AR stability, and the strongest cohesiveness and tensile stability; the low-acetyl (XG2) and low-pyruvate (XG4) samples were next; although the zero-pyruvate sample (XG3) had slightly weaker tensile stability, it was still suitable for swallowing and better than the control.
[0050] In summary, tensile rheological testing and Figure 3 The analysis corroborates each other, showing that the directional regulation of the ratio and distribution of acetyl and pyruvate groups in the xanthan gum side chain can optimize key tensile parameters and achieve a synergistic improvement in cohesion and tensile stability, providing experimental support for the design of "cohesive agglomeration (tensile relaxation)" parameters.
[0051] Step 4: To verify the feasibility and advantages of structure-customized xanthan gum (including xanthan gum prepared from the above-mentioned engineered strains) in the preparation of dysphagia fluid foods, semi-fluid foods, or special medical purpose formulations, the consistency grade of samples was further tested in milk, fruit juice, and high-salt, high-calcium simulated food matrices. The results showed that structure-customized xanthan gum could stably maintain the consistency grade of dysphagia diets in complex matrices. The core application advantage of this xanthan gum is that it can reduce the risk of food boluses sticking to the walls of the epiglottis and / or piriform crypts. This reduction effect can be characterized by the reduction of the interfacial friction coefficient μ. Moreover, it can maintain a stable consistency grade in food matrices containing calcium ions, salt, or acid, and is especially suitable for dysphagia formulation systems with milk-based, fruit juice-based, or high electrolyte content.
Claims
1. A method for directional biosynthesis of xanthan gum guided by swallowing safety, characterized in that, Swallowable xanthan gum was synthesized using engineered strains, with Xanthomonas being a key engineered strain. Xanthomonas campestris As the starting strain, the engineered strain satisfies: gumF The gene was knocked out without a trace; gumG The gene was knocked out without a trace; gumL The gene promoter is replaced in situ with a strong promoter to increase the level of pyruvate modification; and the chromosome of the engineered strain does not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
2. The method for directional biosynthesis of xanthan gum guided by swallowing safety according to claim 1, characterized in that, The ratio and distribution of acetyl and pyruvate groups on the side chains of the swallowable xanthan gum molecule are directionally regulated, and the specific regulation method must satisfy at least one of the following: 1) By inhibiting or completely removing the side-chain acetylation-related factors gumF Genes and gumG The function of genes; 2) By enhancing the effects related to side-chain acetone acidification gumL Gene expression.
3. The method for directional biosynthesis of xanthan gum guided by swallowing safety according to claim 1, characterized in that, The interfacial friction coefficient μ of the swallowable xanthan gum measured in a friction test system containing mucin is no greater than 0.
60.
4. The method for directional biosynthesis of xanthan gum guided by swallowing safety according to claim 3, characterized in that, The interfacial friction coefficient μ was determined under the following conditions: at 37℃, in an aqueous system containing 5mg / mL-20mg / mL of mucin, the test was conducted using a pin-disc or triborheometer, with a normal load of 0.5 N-5N and a sliding speed of 1 mm / s-50 mm / s.
5. The method for directional biosynthesis of xanthan gum guided by swallowing safety according to claim 1, characterized in that, After the engineered strain was inoculated into a seed culture medium and cultured, it was transferred to a fermenter for aerobic fermentation. The fermentation was carried out at 25℃-32℃ and pH 6.5-7.5 for 48 h-96 h without the addition of antibiotics. After fermentation, the fermentation broth was heated to inactivate the bacteria and centrifuged to remove the cells. The extracellular polysaccharides were extracted by isopropanol precipitation to obtain swallowable xanthan gum.
6. A xanthan gum formulation with swallowing safety guidance, characterized in that, It is prepared by a swallowing safety-oriented directional biosynthesis method of xanthan gum according to any one of claims 1 to 5.
7. An engineered bacterial strain for producing xanthan gum with swallowing safety guidance, characterized in that, The engineered strain is Xanthomonas. Xanthomonas campestris As the starting strain, the engineered strain satisfies: gumF The gene was knocked out without a trace; gumG The gene was knocked out without a trace; gumL The gene promoter is replaced in situ with a strong promoter to increase the level of pyruvate modification; and the chromosome of the engineered strain does not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
8. The engineered bacterial strain for producing xanthan gum with swallowing safety guidance according to claim 7, characterized in that, The engineered strain achieved double crossover through suicide vector-mediated homologous recombination technology, completing... gumF Gene, gumG Scarless gene knockout and gumL In situ replacement of gene promoters, while utilizing sacB A sucrose-lethal reverse screening method was used to obtain recombinant strains that do not contain exogenous plasmid backbone sequences or antibiotic resistance gene residues.
9. An engineered bacterial strain for producing xanthan gum with swallowing safety guidance according to claim 7, characterized in that, The engineered strain maintained stable gel production structure parameters and did not undergo significant degradation after 100 consecutive passages under conditions without antibiotic selection pressure.
10. The use of the xanthan gum of claim 6, which is designed for swallowing safety, in the preparation of fluid foods, semi-fluid foods, or foods for special medical purposes for dysphagia.