Use of rhbdf2 / arpc1b as a target in screening for drugs to inhibit or treat triple-negative breast cancer

By targeting RHBDF2 and ARPC1B to regulate the proliferation and apoptosis of TNBC cells, the problem of radiotherapy resistance in TNBC was solved, and the sensitivity and efficacy of radiotherapy were improved.

CN122146880APending Publication Date: 2026-06-05SHANXI CANCER HOSPITAL

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANXI CANCER HOSPITAL
Filing Date
2026-03-06
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Triple-negative breast cancer (TNBC) is resistant to radiotherapy, lacks effective predictive indicators and molecular mechanisms, resulting in unsatisfactory treatment outcomes and a high recurrence rate.

Method used

By knocking out or inhibiting the targets RHBDF2 and ARPC1B, the proliferation, apoptosis, and radiosensitivity of TNBC cells are regulated. Combined with targeted inhibition of RHBDF2 and ARPC1B expression, the sensitivity of TNBC cells to radiotherapy is improved.

Benefits of technology

It significantly inhibits the proliferation, migration, and invasion of TNBC cells, weakens stem cell-like characteristics, improves the sensitivity to radiotherapy, and reduces the risk of tumor growth and recurrence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146880A_ABST
    Figure CN122146880A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and provides application of RHBDF2 / ARPC1B as a target in screening drugs for inhibiting or treating triple-negative breast cancer. Knocking out RHBDF2 enhances apoptosis of TNBC cells, significantly inhibits proliferation, migration and invasion of the TNBC cells, improves the sensitivity of the TNBC cells to radiotherapy, increases the sensitivity of the TNBC cells to radiotherapy-induced apoptosis, and significantly inhibits the stemness of the TNBC. Down-regulating RHBDF2 inhibits proliferation, migration and spheroid formation of the TNBC cells, and improves the sensitivity of the TNBC cells to radiotherapy in vitro and in vivo. It is proved that ARPC1B is downstream of RHBDF2, and knocking out RHBDF2 can significantly down-regulate the expression of ARPC1B. Overexpression of ARPC1B can reverse the inhibition of cell proliferation, spheroid formation, migration and invasion and the improvement of radiotherapy sensitivity caused by down-regulation of RHBDF2.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of RHBDF2 / ARPC1B as a target in screening drugs to inhibit or treat triple-negative breast cancer. Background Technology

[0002] Breast cancer is one of the most prevalent and impactful cancers worldwide, affecting millions of people each year. It is the most frequently diagnosed cancer among women, accounting for approximately 25% of all cancer cases, and is also the leading cause of cancer death among women globally [1,2]. Triple-negative breast cancer (TNBC) is a highly aggressive and heterogeneous subtype of breast cancer characterized by the absence of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression, which limits the use of targeted therapies. This subtype accounts for approximately 15-20% of all breast cancer cases, has a poor prognosis, limited treatment options, and a high recurrence rate [3].

[0003] Radiation therapy is the cornerstone of TNBC treatment, especially in reducing local recurrence after surgery. However, a significant proportion of TNBC patients exhibit resistance to ionizing radiation (IR), leading to treatment failure and disease progression [4-6]. Despite advancements in radiation therapy techniques such as intensity-modulated radiotherapy (IMRT) and image-guided radiotherapy (IGRT), clinical outcomes for drug-resistant TNBC patients remain unsatisfactory [7,8].

[0004] In recent years, with the advancement of molecular biology and medical technology, more and more studies have focused on the molecular mechanisms of radiotherapy resistance. These mechanisms include the enhancement of DNA damage repair mechanisms, such as the upregulation of homologous recombination (HR) and non-homologous end joining (NHEJ) pathways, which enable cancer cells to survive radiation-induced DNA damage [9,10]. In addition, the presence of the tumor microenvironment (TME), especially tumor-associated fibroblasts (CAFs) and the infiltration of immune cells, has been shown to contribute to radioresistance by promoting tumor survival and immune evasion

[11] . Furthermore, cancer stem cells (CSCs) exhibit intrinsic resistance to radiotherapy and other therapies, and their persistence is a major challenge to radiotherapy resistance

[12] . Currently, there is a lack of reliable predictive indicators to assess the sensitivity of TNBC patients to radiotherapy, and the molecular mechanisms of radiotherapy resistance in TNBC patients have not been fully elucidated. Therefore, exploring molecular mechanisms and finding new targets to improve radiosensitivity is of great significance for improving the treatment efficacy and survival rate of TNBC, while also promoting the application of precision medicine in breast cancer treatment.

[0005] The protein encoded by the RHBDF2 (rhomboid 5 homolog 2) gene (iRhom2) is an inactive rhomboid protein that regulates proteolysis and signal transduction processes, particularly the epidermal growth factor receptor (EGFR) pathway. Activation of EGFR ligands promotes downstream signaling cascades, including the MAPK / ERK and PI3K / AKT pathways, which are crucial for cell proliferation, survival, and differentiation [13,14]. Studies have shown that mutations in the RHBDF2 gene may lead to changes in the structure and localization of the iRhom2 protein, resulting in abnormal changes in the EGFR signaling pathway and thus increasing the risk of esophageal cancer

[15] . In addition, RHBDF2 mRNA expression is significantly upregulated in endometrial cancer tissues and is associated with poor prognosis in patients. Mechanistically, RHBDF2 activates the YAP1 pathway by upregulating PKMYT1 expression, thereby promoting the proliferation, invasion, migration, and epithelial-mesenchymal transition (EMT) of endometrial cancer cells

[16] . Furthermore, overexpression of RHBDF2 can activate TGF-β signaling and enhance the invasiveness of gastric cancer cells

[17] . Therefore, RHBDF2 is considered a potential molecular target for cancer therapy. However, the role and biological function of RHBDF2 in radiotherapy tolerance of TNBC have not yet been discovered. Summary of the Invention

[0006] This invention provides the application of RHBDF2 / ARPC1B as a target in screening drugs to inhibit or treat triple-negative breast cancer.

[0007] The present invention is achieved by the following technical solution: the application of RHBDF2 / ARPC1B as a target in screening drugs to inhibit or treat triple-negative breast cancer (TNBC).

[0008] Furthermore, knocking out RHBDF2 enhances TNBC cell apoptosis, significantly inhibits TNBC cell proliferation, migration and invasion, increases TNBC cell sensitivity to radiation, increases TNBC cell sensitivity to radiation-induced apoptosis, and significantly inhibits the stem cell-like nature of TNBC.

[0009] Furthermore, inhibiting or reducing the expression of RHBDF2 can suppress the proliferation, invasion, and spheroidization of TNBC cells, increase the sensitivity of TNBC cells to radiation, and inhibit the stem cell-like nature of TNBC.

[0010] Furthermore, the RHBDF2 regulates the proliferation, apoptosis, stem cell-like nature, and radiosensitivity of TNBCs through ARPC1B.

[0011] Knocking out ARPC1B inhibits the stem cell-like characteristics induced by RHBDF2 overexpression.

[0012] Combined targeted inhibition or reduction of RHBDF2 and ARPC1B expression can suppress the stem cell-like nature of TNBC and enhance the sensitivity of TNBC to radiation.

[0013] This invention evaluates the function of RHBDF2 in TNBC proliferation, colony formation, apoptosis, migration, spheroidization, tumorigenesis, and radiosensitivity through in vitro and in vivo loss-of-function or overexpression experiments. The biological roles of RHBDF2 and ARPC1B were determined using quantitative real-time PCR (qRT-PCR), Western blotting, and reversion assays. Downregulation of RHBDF2 not only inhibited TNBC cell proliferation, migration, and spheroidization but also increased the radiosensitivity of TNBC cells in vitro and in vivo. Bioinformatics and Western blotting analysis confirmed that ARPC1B is a downstream of RHBDF2, and knockout of RHBDF2 significantly downregulated ARPC1B expression. Importantly, overexpression of ARPC1B reversed the inhibition of cell proliferation, spheroidization, migration, and invasion caused by RHBDF2 downregulation, as well as the enhancement of radiosensitivity.

[0014] This invention first demonstrates that RHBDF2 expression is significantly increased in TNBC tissues, which can serve as an independent prognostic factor. Furthermore, downregulation of RHBDF2 inhibits TNBC cell proliferation, invasion, and spheroidization, while simultaneously increasing TNBC cell sensitivity to radiotherapy by positively regulating ARPC1B expression. Attached Figure Description

[0015] Figure 1 To investigate the effect of downregulating RHBDF2 on the migration, invasion, and proliferation of triple-negative breast cancer cells; Figure A shows the mRNA expression level of RHBDF2 in five breast cancer cell lines and one normal breast cell line; B shows the effect of RHBDF2 on TNBC cell proliferation detected by the CCK-8 assay; C shows the number of TNBC cell colonies formed after downregulating RHBDF2; D shows the anti-apoptotic and pro-apoptotic effect of RHBDF2 as detected by Annexin-V / FITC double staining; the bar graph shows the percentage of apoptotic cells; E shows the effect of RHBDF2 knockdown on TNBC cell migration as determined by the scratch assay (scale bar = 100µm); F shows the effect of downregulating RHBDF2 on the invasion ability of TNBC cells as verified by the Transwell assay (scale bar = 100µm). All data are expressed as mean ± standard deviation of at least three independent experiments. Unpaired Student's t-test was used to calculate P values: P < 0.05; P < 0.01; P < 0.001; Figure 2To inhibit RHBDF2 and weaken the characteristics of triple-negative breast cancer stem cells and enhance radiosensitivity; Figure A shows the proliferation of RHBDF2 knockdown TNBC cells under combined / non-radiotherapy (IR) treatment using the CCK-8 assay; B shows the apoptosis of RHBDF2 knockdown TNBC cells under combined / non-IR treatment using TUNEL staining; C shows the apoptosis of lentiviral shRHBDF2-infected TNBC cells under combined / non-IR treatment using flow cytometry; D shows the expression of stem cell markers in RHBDF2 knockdown TNBC cells using Western blot; E shows the spheroidization assay of RHBDF2 knockdown TNBC cells; and F shows the flow cytometry sorting analysis of RHBDF2 knockdown TNBC cells. All data are expressed as mean ± standard deviation from at least three independent experiments. Unpaired Student's t-tests were used to calculate P values: P < 0.05; P < 0.01; P < 0.001. Figure 3 This study demonstrates how RHBDF2 regulates the proliferation and apoptosis of triple-negative breast cancer cells via ARPC1B. Figure A shows a positive correlation between RHBDF2 and ARPC1B expression (P<2.2e-16, R=0.58); B shows ARPC1B mRNA expression in TNBC cells after RHBDF2 knockdown; C shows the mRNA expression of ARPC1B and RHBDF2 in TNBC cells after RHBDF2 overexpression or (and) ARPC1B knockdown; D shows the protein expression of RHBDF2 and ARPC1B in TNBC cells after RHBDF2 overexpression or (and) ARPC1B knockdown detected by Western blot; E shows the effect of RHBDF2 overexpression or (and) ARPC1B knockdown on TNBC cell proliferation using the CCK-8 assay; F shows TUNEL staining for apoptosis in TNBC cells after RHBDF2 overexpression or (and) ARPC1B knockdown; G shows flow cytometry analysis of apoptosis in TNBC cells infected with lentivirus shARPC1B or (and) RHBDF2. Figure 4RHBDF2 enhances the characteristics of triple-negative breast cancer stem cells and reduces radiosensitivity by upregulating ARPC1B. Figure A shows the proliferation of TNBC cells after RHBDF2 overexpression and / or ARPC1B knockdown under combined / non-radiotherapy (IR) treatment, detected by CCK-8 assay; B shows the apoptosis of TNBC cells after RHBDF2 overexpression and / or ARPC1B knockdown under combined / non-IR treatment, detected by TUNEL staining; C shows the expression of stem cell markers in TNBC cells after RHBDF2 knockdown and / or ARPC1B overexpression, analyzed by Western blot; D shows the spheroidization assay of TNBC cells after RHBDF2 knockdown and / or ARPC1B overexpression; E shows the flow cytometry sorting analysis of TNBC cells after RHBDF2 knockdown and / or ARPC1B overexpression. Figure 5 Downregulation of RHBDF2 can inhibit TNBC proliferation and induce radiosensitivity in vivo; In the figure: A is the tumor images of nude mice in each group; B is the tumor volume (left) and weight (right); C is the immunohistochemical results of RHBDF2 and KI-67; D shows that downregulation of RHBDF2 can significantly reduce the expression of stemness markers. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and all materials publicly cited herein and cited by them are incorporated herein by reference.

[0018] Equivalent technologies of the specific embodiments described herein that are readily apparent to those skilled in the art through routine experimentation are included in this application.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all standard laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from regular biochemical reagent stores.

[0020] I. Materials and Methods 1. Cell Culture: The MDA-MB-231 and MDA-MB-468 cell lines were triple-negative (no HER2 / neu amplification, no progesterone or estrogen receptor) cell lines, obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). MDA-MB-231 and MDA-MB-468 were cultured in L-15 medium using leak-proof bottles. The medium contained 10% FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin, and was cultured at 37°C with 5% CO2.

[0021] 2. Irradiation: Cells were irradiated with X-rays using an RS2000 Pro225 biological irradiator manufactured by Rad Source Technologies, Georgia, USA, at a dose rate of 600 cGy / min. Cells in the logarithmic growth phase were selected, and irradiation was performed at room temperature. The control group received only sham irradiation (0 Gy). After irradiation, the cells were returned to standard culture conditions for subsequent experimental analysis.

[0022] 3. Western Blotting: Cell samples were dissolved on ice with 1% Triton solution and quantified using Coomassie blue G250 staining. Lysates were then separated by SDS / PAGE and transferred to a nitrocellulose membrane (Millipore, Bedford, Ma, USA). After blocking with 5% skim milk and TBST, the membrane was incubated overnight at 4°C with the specified primary antibody, followed by incubation at room temperature for 30 minutes with the specified horseradish peroxidase-conjugated secondary antibody. Finally, the target protein bands were detected using a super-Signal Western Pico Chemilum-nescent Substrate (Pierce, Rockford, IL, USA).

[0023] 4. Immunohistochemistry (IHC): Breast cancer and adjacent normal tissue specimens were washed three times with PBS buffer after dewaxing and hydration, followed by antigen extraction. Antigen recovery was performed using autoclaving in citrate buffer (pH 6.0) for 2-3 minutes. The specimens were then incubated in 3% H2O2 for 15 minutes at near room temperature to eliminate intrinsic peroxidase activity. Sections were incubated with primary antibody overnight at 4°C, and the immunohistochemical reaction was detected using an anti-mouse / rabbit IHC detection kit (Dako, Glostrup, Denmark). Staining intensity was calculated as follows: 0 (no staining), 1 (weak staining), 2 (moderate staining), and 3 (strong staining). The percentage of positively stained cells was calculated as follows: 0 (no staining), 1 (1-10% of cells stained), 2 (10-50% of cells stained), and 3 (more than 50% of cells stained). Sections were observed under a microscope (400x or 200x) (Olympus Japan). Examine Ki-67 to assess cell proliferation.

[0024] 5. Quantitative Real-Time PCR (qRT-PCR): Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and the concentration of total RNA was quantified by measuring absorbance at 260 nm. Reverse transcription was performed using the Prime ScriptRT kit (TaKaRa, Japan). After setting the program according to the instructions of the SYBR Premix Ex Taq II kit (TaKaRa, Japan), real-time quantitative PCR was performed on a 7500 Real-Time PCR instrument (Applied Biosystems, CA, USA). PCR conditions were: 95℃, 30s, 95℃, 5s for 45 cycles, 59℃, 25s; relative mRNA expression levels were calculated using the threshold cycle and 2-ΔΔCt method. Primer sequences are shown in Table 1.

[0025] Table 1: Primer sequences 6. Plasmid Construction and Cell Transfection: Three short hairpin (sh)RNAs (shRHBDF2-1, shRHBDF2-2, and shRHBDF2-3) targeting three different human RHBDF2 gene loci were synthesized. Target cells transfected with RHBDF2-expressing (or RHBDF2 knockout) lentiviruses or control vectors were selected for 2 weeks with 2 μg / ml puromycin. The sequences of shRHBDF2-1, shRHBDF2-2, and shRHBDF2-3 are as follows: shRHBDF2-1 (SEQ ID NO.7): CGCCTCCAAGGTGAAGCACTT; shRHBDF2-2 (SEQ ID NO.8):AGCGGAAGGACTGCTCGGAGA; shRHBDF2-3 (SEQ ID NO. 9): GCGGAACAAAGGTGTGTACGA.

[0026] 7. Cell proliferation analysis: The proliferation capacity of BRCA cells was detected using the Cell Counting Kit 8 (CCK-8). Cell suspensions (5000 cells / well) were seeded in triplicate into 96-well plates and cultured at 37°C and 5% CO2, either untreated or after a single 4 Gy irradiation treatment. 10 μl of CCK-8 reagent was added to each well, and the plates were incubated for 1–4 hours until a visible color change occurred. The optical density (OD) at 450 nm was measured at 0, 24, 48, 72, 96, and 120 hours.

[0027] 8. Colony formation test: Cells (MDA-MB-231 and MDA-MB-468: 2 × 10⁻⁶) 3 Cells were trypsinized, counted, and cultured for 2 weeks in plates containing 10% FBS and 5% CO2. Cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes, and then stained with 1% crystal violet at 37°C for 30 minutes. Colonies were counted and photographed.

[0028] 9. Wound healing test: Cells from each group were cultured at a density of 5 × 10⁶ cells per well. 5 Cells were seeded in a number of wells into six-well plates. After the cells covered the entire bottom, longitudinal scratches were made using a 200µl pipette tip. After washing three times with sterile PBS, serum-free culture medium was added. The plates were then placed in a cell culture incubator for further culture, and photographs were taken at 0 and 48 h for observation.

[0029] 10. Apoptosis: Apoptosis was quantitatively detected using the Annexin V-FITC / PI double staining method (BD Pharmingen). 2×10⁻⁶ cells were used. 5 Cells were seeded overnight in 6-well plates, then irradiated with 0 or 4 Gy and cultured for 24 hours before cell harvesting. The suspended and scraped cells were pooled, centrifuged, granulated, washed once with ice-cold PBS, and resuspended in binding buffer (10 mM HEPES-NaOH [pH 7.4], 140 mM NaCl, 2.5 mM CaCl2) to 10 μL. 6The concentration was set at / ml. Then, 0.1ml of cell suspension was transferred to a 5ml tube and incubated with 0.005ml Ann-V and 0.005ml PI in the dark at 25°C for 15 minutes. After staining, the apoptosis rate was analyzed using flow cytometry (CytoFLEX LX, Beckman Coulter).

[0030] 11. Transwell migration assay: Transwell chambers (24 wells, 8 mm pore size) were purchased from Corning Incorporated (New York, USA). 100 μl of Matrigel (BD Biosciences, San Jose, CA, USA) and serum-free medium were diluted 1:6 and spread onto the filter screen of the upper wells. The cells were then incubated in a 37°C CO2 incubator for 4-6 hours until gel formation. Cells in logarithmic growth phase were grown under starvation conditions for 12-24 hours, then digested with trypsin, washed 1-2 times with PBS, and resuspended in serum-free medium. Cells (5 × 10⁶ cells / well) were then transferred to the filter screen. 4 Cells were loaded into the upper chamber at 100 µl / well. The lower layer of the chamber filter (8 µm pore size) contained 10% FBS as a chemotactic attractant. Migrating and invading cells on the lower surface of the membrane were fixed with methanol and stained with 0.1% crystal violet. After rinsing with PBS, cell counting images were captured by randomly selecting 5 fields of view per well under a 400x microscope (company name).

[0031] 12. Spheroidization Assay: Harvest monolayer cultures with trypsin and gently transfer to form a single-cell suspension. Add serum-containing medium to inactivate trypsin, then centrifuge at 2000 rpm for 5 min to collect cells. Resuspend cell particles in spheroidizing medium composed of DMEM / F12 (1:1) containing 2% serum-free B27 supplement (17504-044, Invitrogen) and 20 ng / ml EGF (AF-100-15, PeproTech), spaced at 9.5 cm³ / cm². 2 Hole 4×10 4 The number of cells was determined by culturing the cells in 6-well ultra-low adhesion plates.

[0032] 13. Flow cytometry and cell sorting: First, BC cells were trypsinized, harvested, and washed with PBS buffer, then 2×10⁻⁶ cells were sorted. 5 Single-cell suspensions were incubated with anti-human CD44 (FITC conjugate, order number: 555478) and anti-human CD133 (PE conjugate, order number: 555428) in 400 μl of flow buffer at room temperature for 30 min. Finally, the percentage of labeled cells was analyzed using a CytoFLEXLX flow cytometer (Beckman).

[0033] 14. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay: MDA-MB-231 and MDA-MB-468 cells were cultured in 12-well plates, treated with IR, washed with cold PBS, and fixed with 4% paraformaldehyde. TUNEL assays were performed using the TMR (red) TUNEL apoptosis detection kit (Servicebio G1502-50T) according to the manufacturer's instructions. Finally, cell nuclei were stained with DAPI, and fluorescence signals were acquired using a fluorescence microscope (IX71; Olympus Corporation, Tokyo, Japan).

[0034] 15. In vivo tumorigenicity testing: All animal experimental procedures were conducted in accordance with the guidelines for animal welfare and ethics review and approved by the Animal Experiment Ethics Committee of Shanxi Cancer Hospital. Experimental animals were housed in a specific pathogen-free (SPF) environment, with the temperature controlled at 22±1℃, humidity at 50%-60%, and a 12-hour light / dark cycle. Every effort was made to minimize animal suffering during the experiments, including the use of anesthetics during invasive procedures, and humane endpoints were established for the terminal stages of the experiments.

[0035] Six-week-old female BALB / c nude mice were used. MDA-MB-231 control cells (shNC) or RHBDF2 knockdown cells (shRHBDF2) were added at a concentration of 1×10⁻⁶. 6 Administer a dose per mouse subcutaneously to the fat pad of the right mammary gland. Inoculate until the tumor volume reaches 70–100 mm. 3 Subsequently, the mice were divided into a radiotherapy group and a non-radiotherapy group, with 6 mice in each group. They received fractionated radiotherapy at 5 × 2 Gy intervals (48 h). Tumor volume was measured every 5 days using calipers, and the formula was: V = 0.5 × length × width. 2 At the end of the experiment, the tumor tissue was dissected, fixed in formalin, embedded in paraffin, and then used for histopathological analysis.

[0036] 16. Statistical Analysis: Statistical analysis was performed using SPSS (version 23.0, SPSS Inc.) or GraphPad Prism software (version 6.0, USA). Data are expressed as mean ± SD, and differences were analyzed using t-tests. A p-value less than 0.05 was considered statistically significant. All data are expressed as mean ± standard deviation (SD).

[0037] II. Experimental Results 1. Downregulation of RHBDF2 inhibits the migration, invasion, and proliferation of TNBC cells: qRT-PCR was used to detect the expression level of RHBDF2 mRNA in cell lines. The results showed that compared with HBL-100 cells, the mRNA level of RHBDF2 was significantly increased in MDA-MB-231 and MDA-MB-468 cells. Figure 1A). Based on the screening results, we selected the shRHBDF2 sequence with high knockout efficiency to construct RHBDF2 knockout breast cancer cell models in the MDA-MB-231 and MDA-MB-468 cell lines. By evaluating infection efficiency and gene knockout efficiency, we demonstrated the successful construction of RHBDF2 dual-target gene knockout MDA-MB-231 and MDA-MB-468 cell models.

[0038] CCK8 assay results showed that RHBDF2 knockout could inhibit the proliferation of breast cancer cells. Figure 1 B). Cell colony formation assays also showed that, compared to control cells, RHBDF2 knockout resulted in fewer and smaller cell colonies (B). Figure 1 C). Flow cytometry results showed that RHBDF2 knockout enhanced apoptosis in breast cancer cells (C). Figure 1 D). In addition, wound healing test ( Figure 1 E) and Transwell test ( Figure 1 The results of F) indicate that RHBDF2 gene knockout significantly inhibits the migration and invasion of breast cancer cells. In summary, these experimental results demonstrate that RHBDF2 knockout plays a crucial role in inhibiting the malignant progression of TNBC breast cancer.

[0039] 2. Inhibition of RHBDF2 weakens the stemness of TNBC and enhances its radiosensitivity: After radiotherapy, the survival rates of TNBC breast cancer cell lines MDA-MB-231 and MDA-MB-468 decreased significantly. Compared with the control group, the RHBDF2 knockout group showed a stronger inhibitory rate on cell proliferation, indicating that RHBDF2 knockout increased the sensitivity of cells to radiotherapy. Figure 2 A). Based on this, the apoptosis rate of these cells significantly increased after RHBDF2 knockout, indicating that RHBDF2 knockout increased the sensitivity of cells to radiotherapy-induced apoptosis. Figure 2 B). Flow cytometry results indicate that RHBDF2 plays a role in regulating radiotherapy-induced apoptosis in breast cancer cells. Figure 2 C). Cancer stem cells (CSCs) possess characteristics such as self-renewal, differentiation, and drug resistance, and are the root cause of tumor recurrence and metastasis. The high proportion of cancer stem cells in TNBC may be a significant reason for radiotherapy resistance. We found that RHBDF2 knockout significantly inhibited CSC-like characteristics (steminess), specifically manifested as downregulation of stem cell marker expression (…). Figure 2 D) Decreased ability to form spherical shapes ( Figure 2 E) and a decrease in the proportion of positive cells ( Figure 2 F). Therefore, these results suggest that high expression of RHBDF2 may be an important factor regulating the stem cell-like characteristics and radiosensitivity of TNBC breast cancer.

[0040] 3. RHBDF2 regulates TNBC proliferation and apoptosis via ARPC1B: To elucidate the molecular mechanism by which RHBDF2 regulates breast cancer progression, we screened the STRING database and identified ARPC1B, a candidate molecule that strongly interacts with RHBDF2. Spearman gene correlation analysis in GEO showed a positive correlation between RHBDF2 and ARPC1B. Figure 3 A). qRT-PCR analysis showed that the expression level of ARPC1B was significantly decreased after RHBDF2 knockout ( Figure 3 B). To clarify the potential roles of RHBDF2 and ARPC1B in breast cancer cells, the expression of RHBDF2 and ARPC1B in MDA-MB-231 and MDA-MB-468 cells was interfered, respectively. The successful construction of the cell models was verified by qRT-PCR and Western blot. Figure 3 C-3D). Functional recovery experiments revealed that ARPC1B knockout could partially rescue the RHBDF2 overexpression-induced cell phenotype, exhibiting changes in proliferation, apoptosis, and downstream pathway protein expression. Figure 3 (E, 3F, 3G). These results further confirm that RHBDF2 promotes the malignant progression of TNBC breast cancer through ARPC1B.

[0041] 4. RHBDF2 enhances the stemness of TNBC and weakens its radiosensitivity by upregulating ARPC1B: Studies have shown that ARPC1B promotes the phosphorylation of p65 and the expression of STAT3 by stabilizing IFI16 and HuR, thereby promoting the radiotherapy resistance of glioma stem cells

[18] . We speculate that RHBDF2 may regulate the radiosensitivity of breast cancer through ARPC1B. After radiotherapy, the cell inhibition rate and apoptosis rate of the RHBDF2+shARPC1B group were significantly higher than those of the RHBDF2+shCtrl group, indicating that under the condition of RHBDF2 overexpression, knocking out ARPC1B can significantly improve the sensitivity of cells to radiotherapy ( Figure 4 (A, 4B). These results further confirm that RHBDF2 reduces radiosensitivity through ARPC1B overexpression.

[0042] Given that RHBDF2 promotes TNBC progression through cooperation with ARPC1B, we were interested to see if it could influence radiosensitivity by modulating CSC-like properties. We performed reversal experiments in RHBDF2-overexpressing and ARPC1B-knockout TNBC cell lines. Stem cell marker expression, spheroid formation, and flow cytometry-sorted positive cells showed that ARPC1B knockout could partially salvage the stem cell-like properties induced by RHBDF2 overexpression. Figure 4(C, 4D, 4E). Therefore, RHBDF2 enhances stem cell-like properties in an ARPC1B-dependent manner. In summary, these results indicate that combined targeting of RHBDF2 and ARPC1B can alleviate stem cell-like properties, thereby improving radiosensitivity.

[0043] 5. Downregulation of RHBDF2 inhibits TNBC proliferation and induces radiosensitivity in vivo: Cell experiments showed that inhibiting RHBDF2 expression significantly reduced TNBC proliferation, weakened TNBC stemness, and enhanced its radiosensitivity. Therefore, the role of RHBDF2 in vivo was further investigated. MDA-MB-231 cells were transfected with lentivirus-RHBDF2-shRNA and lentivirus-RHBDF2-Vector to construct a stable cell line. The above cells (1×10⁻⁶) were then... 6 Injected into the fat pads of nude mice, in situ tumor formation was induced with or without radiation. It was found that the tumor weight was lightest in the RHBDF2 shRNA + IR group, with a significant difference. Figure 5 A, 5B). Furthermore, the immunohistochemical results of RHBDF2 and Ki67 in the RHBDF2 shRNA + IR group were significantly lower than those in the control group ( Figure 5 C). Western blot analysis of tumor tissue revealed that downregulation of RHBDF2 significantly reduced the expression of stemness markers (C). Figure 5 D). These data indicate that knocking out RHBDF2 can inhibit tumor growth in TNBC and improve radiosensitivity.

[0044] Breast cancer (BC) is the most frequently diagnosed cancer in women and the second leading cause of cancer-related death worldwide

[19] . TNBC has a worse prognosis compared to HR-positive BC. More than 50% of patients relapse within the first 3–5 years after diagnosis

[20] , and the median overall survival (OS) is 10.2 months with current therapies

[21] . Due to the limited availability of therapies for TNBC, radiotherapy (IR) remains a common treatment option for patients with lymph node or brain metastases. Therefore, it is urgent to develop strategies to improve TNBC sensitivity. Our study validates that RHBDF2 plays a key role in the progression of TNBC, particularly in tumor proliferation and invasion. We found that RHBDF2 is upregulated in TNBC through cell expression validation. Through cell function tests and animal models, we concluded that RHBDF2 promotes the dry-like properties and radiosensitivity of TNBC by upregulating ARPC1B. The occurrence and development of TNBC may be driven by RHBDF2, and knocking out RHBDF2 may be a promising strategy for treating radiotherapy resistance to TNBC.

[0045] In addition, iRhoms are involved in many different cellular control processes, but are most typically characterized as regulatory cofactors of the metalloproteinase ADAM17, and therefore also as regulatory cofactors of inflammation and growth factor signaling [22,23]. Furthermore, iRhoms, belonging to the rhomboid superfamily of pseudoproteases, are also involved in mitochondrial morphology and endoplasmic reticulum (ER)-associated protein degradation (ERAD)

[24] . iRhom1 and iRhom2 are associated with intracellular Ca2+. 2+ The key mediator of signaling, IP3 receptor interaction, regulates ER stress-induced Ca2+. 2+ Transport to mitochondria is a major cause of mitochondrial membrane depolarization and cell death

[25] . Recently, the N-terminal fragments produced by iRhom2 cleavage have entered the nucleus and altered the transcriptome, ultimately affecting gene expression

[26] . Tumorigenesis can lead to dysregulation of apoptosis and gene mutations, suggesting that we can achieve anti-tumor effects by intervening in the target gene RHBDF2.

[0046] ARPC1 (actin-associated protein 2 / 3 complex subunit 1) is one of the subunits of ARPC and is a protein containing WD repeats, composed of two isoforms, ARPC1A and ARPC1B. ARPC1B regulates various cellular functions such as cell division and migration by promoting the polymerization of actin in the cell nucleus

[27] . Liu et al. recently found that ARPC1B in macrophages can promote the motility and epithelial-mesenchymal transition (EMT) of glioma cells

[28] . Overexpression of ARPC1B increases the invasiveness and metastatic ability of tumors and leads to poor prognosis in patients with prostate cancer

[29] . In addition, actin-associated protein 2 / 3 (Arp2 / 3) also regulates the physiological functions of immune cells, such as immune defense and surveillance

[30] . ARPC1B can promote the recruitment of tumor-associated macrophages in the immune microenvironment of gliomas, thereby promoting the migration, invasion and epithelial-mesenchymal transition of glioma cells

[31] . TNBC is a highly immune-invasive tumor with a poor prognosis. The immune microenvironment of TNBC is closely related to radiotherapy resistance.

[0047] The high proportion of stem cells (CSCs) in TNBC may be a significant reason for radiotherapy resistance. CSCs are heterogeneous and have different markers, such as CD44 / CD24, ALDH1, CD133, and EPCAM [32-34]. Stem-related pathways, such as Janus kinase 2 (JAK2) / signal transduction and activator of transcription 3 (STAT3) signal transduction,

[35] tyrosine protein kinase Src signal transduction,

[36] Hedgehog signal transduction, and

[37] Wnt / β-catenin signal transduction

[38] are more active in TNBC tumors. Therefore, radiotherapy efficacy can be enhanced by inhibiting stem cell-related signaling pathways or targeting stem cell markers. In addition, tumor stemness can also be regulated by epigenetic mechanisms such as DNA methylation and histone modification [39,40]. Furthermore, microenvironmental factors such as hypoxia, inflammation, and immunosuppression may reduce the efficacy of radiotherapy [41,42]. Therefore, research on tumor stemness and radiotherapy resistance mechanisms can help develop individualized treatment plans for TNBC patients, improve treatment outcomes, and reduce treatment costs for patients and the medical burden on society.

[0048] In summary, we have identified a novel target for radiotherapy resistance in TNBC. Our research shows that RHBDF2 is overexpressed in TNBC and promotes cancer cell proliferation, apoptosis, migration, and spheroidization. Furthermore, RHBDF2 upregulates ARPC1B, thereby increasing radiotherapy tolerance, which may provide a therapeutic target for treating this disease.

[0049] References: 1. Harbeck, N. and M. Gnant, Breast cancer. Lancet, 2017. 389(10074):p. 1134-1150.doi: 10.1016 / S0140-6736(16)31891-8. 2. Sung H, Ferlay J, Siegel R, Laversanne M, Soerjomataram I, JemalA, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence andMortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209–249. doi: 10.3322 / caac.21660. 3. Garrido-Castro AC, Lin NU, Polyak K. Insights into molecularclassifications of triple-negative breast cancer: improving patient selectionfor treatment. Cancer Discov. 2019;9(2):176–198. doi: 10.1158 / 2159-8290.CD-18-1177. 4. Upadhyay, R. and J.G. Bazan, Advances in Radiotherapy for BreastCancer.Surg Oncol Clin N Am. 2023 Jul;32(3):515-536. doi: 10.1016 / j.soc.2023.03.002. 5. Chen Jian, Tingting Wu, Lulu Wang, Chen Gao, Zhiwen Fu, et al.Biomimetic Nanoplatform for Dual-Targeted Clearance of Activated andSenescent Cancer-Associated Fibroblasts to Improve Radiation Resistance inBreast Cancer. Small. 2024 Jun;20(25):e2309279. doi: 10.1002 / smll.202309279. 6. Christoph Reinhold Arnold, Julian Mangesius, Iana Portnaia, UteGanswindt, Hendrik Andreas Wolff. Innovative therapeutic strategies toovercome radioresistance in breast cancer. Front Oncol. 2024 May 30:14:1379986.doi: 10.3389 / fonc.2024.1379986. 7. Weina Li, Guohui Han, Feng Li, Peng Bu, Yating Hao, et al., Cancercell-derived exosomal miR-20a-5p inhibits CD8(+) T-cell function and confersanti-programmed cell death 1 therapy resistance in triple-negative breastcancer. Cancer Sci. 2024 Feb;115(2):347-356.doi: 10.1111 / cas.16036. 8. Andrei Fodor, Chiara Brombin, Paola Mangili, Fulvio Borroni,Marcella Pasetti. Impact of molecular subtype on 1325 early-stage breastcancer patients homogeneously treated with hypofractionated radiotherapywithout boost: Should the indications for radiotherapy be more personalized?Breast. 2021 Feb:55:45-54.doi: 10.1016 / j.breast.2020.12.004. 9. Shaymaa E El Feky, Karen Adel Fakhry, Amr M Hussain, Fawziya A RIbrahim, Mohamed Ibrahim Morsi. MLKL regulates radiation-induced death inbreast cancer cells: an interplay between apoptotic and necroptotic signals.Med Oncol. 2024 Jun 12;41(7):172.doi: 10.1007 / s12032-024-02415-4. 10. Qiaodan Deng, Jiankun Qiang, Cuicui Liu, Jiajun Ding, JuchuanliTu, et al., SOSTDC1 Nuclear Translocation Facilitates BTIC Maintenance andCHD1-Mediated HR Repair to Promote Tumor Progression and Olaparib Resistancein TNBC. Adv Sci (Weinh). 2024 Aug;11(29):e2306860.doi: 10.1002 / advs.202306860. 11. Han Chen, Xue Han, Yue Zhang, Ke Wang, Da Liu,et al. Bruceine Dsuppresses CAF-promoted TNBC metastasis under TNF-α stimulation by inhibitingNotch1-Jagged1 / NF-κB(p65) signaling. Phytomedicine. 2024 Jan:123:154928. doi:10.1016 / j.phymed.2023.154928. 12. Tangming Guan, Mei Li, Yan Song, Jiayi Chen, Jiaxin, et al.TangPhosphorylation of USP29 by CDK1 Governs TWIST1 Stability and OncogenicFunctions.Adv Sci (Weinh). 2023 Apr;10(11):e2205873.doi: 10.1002 / advs.202205873. 13. Thiviyani Maruthappu, Anissa Chikh, Benjamin Fell, Paul JDelaney, Matthew A Brooke, et al., Rhomboid family member 2 regulatescytoskeletal stress-associated Keratin 16. Nat Commun. 2017 Jan 27:8:14174.doi: 10.1038 / ncomms14174. 14. Vishnu Hosur, Kenneth R Johnson, Lisa M Burzenski, Timothy MStearns, Richard S Maser, et al., Rhbdf2 mutations increase its proteinstability and drive EGFR hyperactivation through enhanced secretion ofamphiregulin. Proc Natl Acad Sci U S A. 2014 May 27;111(21):E2200-9.doi:10.1073 / pnas.1323908111. 15. Diana C Blaydon, Sarah L Etheridge, Janet M Risk, Hans-ChristianHennies, Laura J, et al. RHBDF2 mutations are associated with tylosis, afamilial esophageal cancer syndrome.Am J Hum Genet. 2012 Feb 10;90(2):340-6.doi: 10.1016 / j.ajhg.2011.12.008. 16. Ying Zhao. Mechanism of RHBDF2 regulating endometrial cancer cellinvasion and metastasis through Pkmyt1 mediated YAP1 pathway. Jinzhou MedicalUniversity. 2022. 17. Takatsugu Ishimoto , Keisuke Miyake , Tannistha Nandi, Masakazu Yashiro, Nobuyuki Onishi, et al. Activation of Transforming Growth FactorBeta 1 Signaling in Gastric Cancer-Associated Fibroblasts Increases Their Motility, Via Expression of Rhomboid 5 Homolog 2, and Ability to Induce Invasiveness of Gastric Cancer Cells. Gastroenterology.2017 Jul;153(1):191-204.e16.doi:10.1053 / j.gastro.2017.03.046. ARPC1B promotes mesenchymal phenotype maintenance and radiotherapy resistanceby blocking TRIM21-mediated degradation of IFI16 and HuR in glioma stem cells.J Exp Clin Cancer Res. 2022 Nov 16;41(1):323.doi:10.1186 / s13046-022-02526-8. 19.James Ferlay, Muriel Colombet, Isabelle Soerjomataram, DonaldM Parkin, Marion Pineros, et al. Cancer statistics for the year 2020: an overview. Int J Cancer. 2021 Apr 5.doi:10.1002 / ijc.33588. 20.Bianchini G, Balko JM, Mayer IA, Sanders ME, Gianni L. Triple-negative breast cancer: challenges and opportunities of a heterogeneousdisease. Nat Rev Clin Oncol. 2016 Nov;13(11):674-690.doi: 10.1038 / nrclinonc.2016.66. 21.Marra A, Viale G, Curigliano G. Recent advances in triple negativebreast cancer: the immunotherapy era. BMC Med. 2019 May 9;17(1):90.doi:10.1186 / s12916-019-1326-5. 22.Matthew Freeman. The rhomboid-like superfamily: molecularmechanisms and biological roles.Annu Rev Cell Dev Biol. 2014:30:235-54.doi:10.1146 / annurev-cellbio-100913-012944. 23.Geesala R, Issuree PD and Maretzky T. The role of iRhom2 inmetabolic and cardiovascular-related disorders. Front Cardiovasc Med. 2020Nov 24:7:612808.doi: 10.3389 / fcvm.2020.612808. 24.Sun Z, Brodsky JL. Protein quality control in the secretorypathway. J. Cell Biol. 2019;218:3171–3187. doi: 10.1083 / jcb.201906047. 25.Iqbal Dulloo, Peace Atakpa-Adaji, Yi-Chun Yeh, Clémence Levet,Sonia MuliyiliRhom, et al. pseudoproteases regulate ER stress-induced celldeath through IP3 receptors and BCL-2.Nat Commun. 2022 Mar 10;13(1):1257.doi:10.1038 / s41467-022-28930-4. 26.Iqbal Dulloo, Michael Tellier, Clémence Levet, Anissa Chikh, BoyanZhang, et al. Cleavage of the pseudoprotease iRhom2 by the signal peptidasecomplex reveals an ER-to-nucleus signaling pathway.Mol Cell. 2024 Jan 18;84(2):277-292.e9.doi: 10.1016 / j.molcel.2023.12.012. 27. Constantin F Urban, David Ermert, Monika Schmid, Ulrike Abu-Abed,Christian Goosmann, et al. Neutrophil extracellular traps containcalprotectin, a cytosolic protein complex involved in host defense againstCandida albicans.PLoS Pathog. 2009 Oct;5(10):e1000639. doi: 10.1371 / journal.ppat.1000639. 28.Liu T, Zhu C, Chen X, Wu J, Guan G, Zou C, Shen S, Chen L, ChengP, Cheng W, et al. Dual role of ARPC1B in regulating the network betweentumor-associated macrophages and tumor cells in glioblastoma. Oncoimmunology.2022;11(1):2031499.doi: 10.1080 / 2162402X.2022.2031499. 29. Yaser Gamallat, Hend Zaaluk, Ealia Khosh Kish, Ramy Abdelsalam,Konstantinos Liosis, et al. ARPC1B is associated with lethal prostate cancerand its inhibition decreases cell invasion and migration in vitro. Int J MolSci. 2022 Jan 27;23(3):1476.doi: 10.3390 / ijms23031476. 30. Lyra O Randzavola, Katharina Strege, Marie Juzans, Yukako Asano,Jane C Stinchcombe, et al. Loss of ARPC1B impairs cytotoxic T lymphocytemaintenance and cytolytic activity.J Clin Invest. 2019 Dec 2;129(12):5600-5614.doi: 10.1172 / JCI129388. 31. Christine Schauer, Christina Janko, Luis E Munoz, Yi Zhao,Deborah Kienhöfer, et al. Aggregated neutrophil extracellular traps limitinflammation by degrading cytokines and chemokines.Nat Med. 2014 May;20(5):511-7.doi: 10.1038 / nm.3547. 32.Lee, K. L., Kuo, Y. C., Ho, Y. S.&Huang, Y. H. Triple-negativebreast cancer: current understanding and future therapeutic breakthroughtargeting cancer stemness.Cancers (Basel). 2019 Sep 9;11(9):1334.doi:10.3390 / cancers11091334. 33. Andrew Sulaiman, Sarah McGarry, Xianghui Han, Sheng Liu, LishengWang. CSCs in breast cancer-one size does not fit all: therapeutic advancesin targeting heterogeneous epithelial and mesenchymal CSCs. Cancers (Basel).2019 Aug 7;11(8):1128.doi: 10.3390 / cancers11081128. 34. Sousa B, Ribeiro AS, Paredes J. Heterogeneity and plasticity ofbreast cancer stem cells. Adv. Exp. Med. Biol. 2019;1139:83–103. doi:10.1007 / 978-3-030-14366-4_5. 35. Lauren L C Marotta, Vanessa Almendro, Andriy Marusyk, MichailShipitsin, Janina Schemme,et al. The JAK2 / STAT3 signaling pathway is requiredfor growth of CD44+CD24– stem cell–like breast cancer cells in human tumors.JClin Invest. 2011 Jul;121(7):2723-35.doi: 10.1172 / JCI44745. 36. Jun Tian, Fatmah Al Raffa, Meiou Dai, Alaa Moamer, BaharakKhadang, et al. Dasatinib sensitises triple negative breast cancer cells tochemotherapy by targeting breast cancer stem cells.Br J Cancer. 2018 Dec;119(12):1495-1507.doi: 10.1038 / s41416-018-0287-3. 37. Aurélie S Cazet, Mun N Hui, Benjamin L Elsworth , Sunny Z Wu,Daniel Roden, et al. Targeting stromal remodeling and cancer stem cellplasticity overcomes chemoresistance in triple negative breast cancer.NatCommun. 2018 Jul 24;9(1):2897.doi: 10.1038 / s41467-018-05220-6. 38. Felipe C Geyer, Magali Lacroix-Triki, Kay Savage, Monica Arnedos,Maryou B Lambros,et al. β-Catenin pathway activation in breast cancer isassociated with triple-negative phenotype but not with CTNNB1 mutation .ModPathol. 2011 Feb;24(2):209-31.doi: 10.1038 / modpathol.2010.205. 39.Nguyen T B Nguyen,Sira Gevers,Rutger N U Kok,Lotte M Burgering,Hannah Neikes,et al.Lactate controls cancer stemness and plasticity throughepigenetic regulation.Cell Metab.2025 Feb 4:S1550-4131(25)00002-6.doi:10.1016 / j.cmet.2025.01.002. 40. Tikam Chand Dakal , Reya Rene Philip , Ravi Bhushan , PriyankaVijay Sonar , Senthilkumar Rajagopal, et al. Genetic and epigeneticregulation of non-coding RNAs: Implications in cancer metastasis, stemnessand drug resistance.Pathol Res Pract. 2025 Feb:266:155728.doi: 10.1016 / j.prp.2024.155728. 41. Sergio Rey , Luana Schito , Marianne Koritzinsky , Bradly GWouters. Molecular targeting of hypoxia in radiotherapy. Adv Drug Deliv Rev.2017 Jan 15:109:45-62.doi: 10.1016 / j.addr.2016.10.002. 42. Yuting Ma, Heng Yang, Jonathan M Pitt, Guido Kroemer, Laurence Zitvogel. Therapy-induced microenvironmental changes in cancer. J Mol Med(Berl). 2016 May;94(5):497-508.doi: 10.1007 / s00109-016-1401-8.

[0050] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of RHBDF2 / ARPC1B as a target in screening drugs to inhibit or treat triple-negative breast cancer (TNBC).

2. The application according to claim 1, characterized in that: Knocking out RHBDF2 enhances TNBC cell apoptosis, significantly inhibits TNBC cell proliferation, migration and invasion, increases TNBC cell sensitivity to radiation, increases TNBC cell sensitivity to radiation-induced apoptosis, and significantly inhibits the stem cell-like nature of TNBC.

3. The application according to claim 1, characterized in that: Inhibiting or reducing the expression of RHBDF2 can suppress the proliferation, invasion, and spheroidization of TNBC cells, increase the sensitivity of TNBC cells to radiation, and inhibit the stem cell-like nature of TNBC cells.

4. The application according to claim 2 or 3, characterized in that: The RHBDF2 regulates the proliferation, apoptosis, stem cell-like nature, and radiosensitivity of TNBCs through ARPC1B.

5. The application according to claim 4, characterized in that: Knocking out ARPC1B inhibits the stem cell-like characteristics induced by RHBDF2 overexpression.

6. The application according to claim 4, characterized in that: Combined targeted inhibition or reduction of RHBDF2 and ARPC1B expression can suppress the stem cell-like nature of TNBC and enhance the sensitivity of TNBC to radiation.