PCR primer, detection kit and detection method for identification of sciaenops ocellatus

By using PCR technology and specific primer combinations, the problem of pufferfish identification has been solved, enabling accurate identification of Pufferfish from the Genus *Pufferfish* and the Genus *Pufferfish*, thus improving the reliability of law enforcement evidence.

CN122146893APending Publication Date: 2026-06-05EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Filing Date
2026-04-02
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately identify pufferfish samples with damaged morphological features, resulting in law enforcement's inability to effectively combat illegal operations and a lack of crucial evidence.

Method used

Using PCR technology, specific primer combinations were designed for the identification of Pufferfish from the Genus *Tetranychus* and the Genus *Tetranychus*. Species identity was confirmed by combining PCR detection and electrophoretic analysis with the NCBI database.

Benefits of technology

It has enabled the accurate identification of 18 species of Pufferfish from the Multigenus Pufferfish and 4 species of Pufferfish from the Genus Tetraodon, filling the gap in identification standards and improving the reliability of law enforcement evidence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146893A_ABST
    Figure CN122146893A_ABST
Patent Text Reader

Abstract

The application provides PCR primers, detection kits and detection methods for identification of river toads. The PCR primers comprise Plectropomus primers and Lethrinus primers, the sequences of the upstream primer and the downstream primer of the Plectropomus primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively, and the sequences of the upstream primer and the downstream primer of the Lethrinus primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively. The application further provides a detection kit for identification of river toads, and also provides a corresponding detection method. The method of the application effectively realizes the detection of 18 Plectropomus and 4 Lethrinus river toad fishes, and does not have a detection reaction with other fishes, and fills the blank of the standard related to the identification of river toad fish species.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, and relates to the identification of different species of pufferfish, and particularly to a PCR detection kit and detection method for pufferfish identification. Background Technology

[0002] Pufferfish, scientifically known as *Tetraodon spp.*, belongs to the animal kingdom, phylum Chordata. Chordata ), subphylum Chordata, class Osteichthyes ( Osteichthyes ), Radial Finfishes ( Actinopterygii ), Pufferfish ( Tetraodontiformes ), Tetraodontia ( Tetraodontoidei ), Tetraodontidae ( Tetraodontidae Of these, there are about 40 species of tetrodotodontid fish distributed along the coast of my country, with the main species belonging to the genus *Tetraodon* (from the Polygemonic period). Takifugu [Formerly known as Oriental Pufferfish ( Fugu )] and the genus Tetraodon ( Lagocephalus According to FishBase, the genus *Pueraria* contains 24 species, and the genus *Pueraria* contains 9 species. In my country, there are 18 species of *Pueraria* and 7 species of *Pueraria*.

[0003] Pufferfish, known as the "King of Fish," is considered the premier of the "Three Delicacies of the Yangtze River." my country has a long tradition of consuming pufferfish, especially in the Jiangsu and Zhejiang regions. However, almost all types of pufferfish contain tetrodotoxin (TTX), a neurotoxin; ingesting 0.5-3 mg of TTX can be fatal to humans.

[0004] In regions with a long tradition of pufferfish consumption, poisoning incidents due to the consumption of wild pufferfish occur annually. Fish species identification is an indispensable key piece of evidence in regulatory enforcement and case investigation. Currently, pufferfish identification is typically based on traditional morphological classification. However, the samples seized by law enforcement officers are often morphologically damaged, consisting only of small pieces or segments of fish, with crucial morphologically identifying parts (such as the head, skin, and fins) missing. These samples cannot be identified using traditional morphological methods. This lack of crucial evidence hinders effective punishment of illegal operators in many cases, resulting in insufficient deterrence and failing to curb such illegal activities.

[0005] Currently, there are no applicable standards. Direct sequencing, as the authoritative method for DNA identification, can accurately distinguish different pufferfish species by analyzing sequence differences in specific gene fragments. Based on this, this invention proposes a pufferfish identification method based on PCR (Polymerase Chain Reaction) technology, applicable to the identification of common pufferfish species in my country. Summary of the Invention

[0006] The present invention aims to establish a pufferfish identification technique using RCR technology for the identification of common pufferfish species in my country.

[0007] This technology can effectively distinguish 18 species of Pufferfish in the genus *Pueraria* and 4 species in the genus *Pueraria*, including *Pueraria scutellatus* (*Pueraria scutellatus*). Takifugu alboplumbeus ), Two-spotted pufferfish ( Takifugu bimaculatus ), Dark-striped pufferfish ( Takifugu fasciatus ), Chrysanthemum yellow pufferfish ( Takifugu flavidus ), pufferfish ( ) Takifugu oblongus ), the pufferfish ( ), Takifugu ocellatus ), spotted pufferfish ( Takifugu plagiocellatus Purple pufferfish ( Takifugu porphyreus ), False-eyed pufferfish ( Takifugu pseudommus ), Redfin Pufferfish ( Takifugu rubripes ), Dense-spotted pufferfish ( Takifugu stictonotus ), Yellowfin pufferfish ( Takifugu xanthopterus ), mole-spotted pufferfish ( Takifugu chrysops ), pufferfish with worm spots ( Takifugu exascurus ), Black Spotted Pufferfish ( Takifugu niphobles ), Leopard Pufferfish ( Takifugu pardalis ), Strychnoid pufferfish ( Takifugu stictonotus ), Polyterpenoid pufferfish ( Takifugu vermicularis ); The brown-spotted pufferfish (also known as the brown-spotted spiky pufferfish) belongs to the genus *Pteranodon*. lagocephalus spadicecus ), Darkfin pufferfish ( lagocephalus gloveri ), pufferfish (Gong's rabbit head pufferfish) lagocephalus guentheri ), rabbit-headed pufferfish ( lagocephalus lagocephalus ).

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, this invention provides a primer composition for identifying pufferfish, comprising primers for the genus *Pueraria*, primers for the genus *Tetranychus*, and a universal primer. The sequences of the upstream and downstream primers for *Pueraria* are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the sequences of the upstream and downstream primers for *Tetranychus* are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; and the sequences of the upstream and downstream primers for the universal primer are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0010] The specific sequences of the primer composition are as follows:

[0011] Upstream primer for the genus *Tetraodon*: CGTTACAGCCCATGCATTCG (SEQ ID NO.1).

[0012] Downstream primer for the genus *Tetraodon*: GGTACAGGATGG GGTCTCCT (SEQ ID NO.2).

[0013] Upstream primer for the genus *Tetraodon*: TCTGCCCTA TCAACTTTCGATGGTA (SEQ ID NO.3).

[0014] Downstream primer for *Tetraodon*: AATTTGCGCGCCTGCTGCCTTCCTT (SEQ ID NO.4).

[0015] 18S rDNA upstream primer: TCTGCCCTATCAACTTTCGATGGTA (SEQ ID NO.5).

[0016] 18S rDNA downstream primer: AATTTGCGCGCCTGCTGCCTTCCTT (SEQ ID NO.6).

[0017] In a second aspect, the present invention provides a detection kit for identifying pufferfish, comprising the primer composition described above, and further comprising reagents for PCR detection, such as conventional reagents like PCR reaction premix and double-distilled water.

[0018] Both the upstream and downstream primers are in powder form and are dissolved in double-distilled water at a concentration of 10 μmol / L.

[0019] In a third aspect, the present invention provides a method for identifying pufferfish using the above-described kit, comprising the following steps:

[0020] Reaction system construction: 12.5 μL of PCR reaction premix (2×), 0.5 μL each of two pairs of forward and reverse primers (10.0 μmol / L); 1.0 μL of DNA template (adjust the sample DNA concentration to 10 ng / μL ~ 100 ng / μL with double-distilled water), and make up the reaction system to 25.0 μL with double-distilled water; perform two replicates for each sample.

[0021] Reaction program: After pre-denaturation at 95 ℃ for 5 min, begin cycling: denaturation at 95 ℃ for 15 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 20 s, 35 cycles, followed by a final extension at 72 ℃ for 5 min. The reaction system and program can be adjusted according to the requirements of different gene amplification instruments and PCR reagents.

[0022] Electrophoretic detection of PCR amplification products: Prepare 1% agarose gels using 1×TAE electrophoresis buffer. Mix 5 μL of PCR amplification product with 1 μL of 6× loading buffer (electrophoresis front indicator) and load the mixture into the wells of the gel plate. Label the gel with a DNA marker of appropriate molecular weight. Perform electrophoresis at 5 V / cm to 10 V / cm. After electrophoresis, observe, photograph, record, and analyze the results using a gel imaging system.

[0023] Sequencing verification of PCR amplification products: If any target DNA fragment of the expected size is detected by electrophoresis, the corresponding PCR product can be directly sequenced for analysis.

[0024] Results confirmed: Using the NCBI database to confirm the species, when the percentage identity between the two is >98.5%, the pufferfish species corresponding to the test sample and the comparison sequence are considered to be the same species.

[0025] The beneficial protections and effects of this invention are as follows:

[0026] The method of this invention effectively detects 18 species of Pufferfish from the Polygean genus and 4 species of Pufferfish from the genus Tetraodontidae, and does not react with other fish species, filling the gap in the current lack of applicable standards for identifying pufferfish species. Attached Figure Description

[0027] Figure 1 For lead-spotted pufferfish ( Takifugu alboplumbeus ), Two-spotted pufferfish ( Takifugu bimaculatus ), Dark-striped pufferfish ( Takifugu fasciatus ), Chrysanthemum yellow pufferfish ( Takifugu flavidus ), pufferfish ( ) Takifugu oblongus ), the pufferfish ( ), Takifugu ocellatus ), spotted pufferfish ( Takifugu plagiocellatus Purple pufferfish ( Takifugu porphyreus ), False-eyed pufferfish ( Takifugu pseudommus ), Redfin Pufferfish ( Takifugu rubripes ), Dense-spotted pufferfish ( Takifugu stictonotus ), Yellowfin pufferfish ( Takifugu xanthopterus ), mole-spotted pufferfish ( Takifugu chrysops ), pufferfish with worm spots ( Takifugu exascurus ), Black Spotted Pufferfish ( Takifugu niphobles ), Leopard Pufferfish ( Takifugu pardalis ), Strychnoid pufferfish ( Takifugu stictonotus ), Polyterpenoid pufferfish ( Takifugu vermicularis ); Brown-spotted rabbithead pufferfish ( lagocephalus spadicecus ), Darkfin pufferfish ( lagocephalus gloveri ), pufferfish (Gong's rabbit head pufferfish)lagocephalus guentheri ), rabbit-headed pufferfish ( lagocephalus lagocephalus Primer validation results for nucleic acid sequences of 22 pufferfish species, where green arrows indicate the binding positions of primers on the nucleic acid sequences of the species.

[0028] Figure 2 Electrophoresis images of representative samples for PCR identification during the implementation process (1: Pufferfish chrysantha; 14: Pufferfish bisporus; 18: Pufferfish scaberra; 19: Pufferfish scaberra, M: DNA marker, the band sizes from top to bottom are 1500, 1000, 800, 600, 400, 200 bp, B is ddH2O).

[0029] Figure 3 Electrophoresis images for PCR identification of actual samples (1: Yellowfin Pufferfish; 2: Bow-spotted Pufferfish; 3: Dense-spotted Pufferfish; 4: Purple Pufferfish; 5: Yellowfin Pufferfish; 6: Dense-spotted Pufferfish; 7: False-eyed Pufferfish; 8: Purple Pufferfish; 9: Redfin Pufferfish; 10: Dark-striped Pufferfish; 11: Spotted Pufferfish; 12: Lead-spotted Pufferfish; 1 3: Horizontal-striped pufferfish; 14: Double-striped pufferfish; 15: Chrysanthemum-yellow pufferfish; 16: Chrysanthemum-yellow pufferfish; 17: Dark-striped pufferfish; 18: Brown-spotted rabbit-head pufferfish; 19: Dark-finned rabbit-head pufferfish; 20: Chrysanthemum-yellow pufferfish (cooked); 21: Chrysanthemum-yellow pufferfish (cooked); 22: Grass carp; 23: Cod; 24: Large yellow croaker; M: DNA marker (band sizes from top to bottom are 1500, 1000, 800, 600, 400, 200 bp).

[0030] Figure 4 The results of sequencing analysis of representative sample 14 (Double-spotted pufferfish) were compared with the NCBI database.

[0031] Figure 5 The results of sequencing analysis of representative sample 18 (brown-spotted rabbit pufferfish) were compared with the NCBI database. Detailed Implementation

[0032] The implementation of the present invention will be described in detail below with reference to the embodiments of the present invention. The following embodiments are implemented under the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] The steps for identifying pufferfish in this invention are as follows:

[0035] (1) Sample preparation

[0036] Use a sterile scalpel (scissors) to cut open a whole fish or fish piece, and extract 1g-2g of uncontaminated muscle tissue. Grind the sample thoroughly into a paste using a sterile mortar.

[0037] (2) DNA extraction

[0038] Extract DNA template from samples using a marine animal tissue genomic DNA extraction kit, following the instructions. The resulting genomic DNA concentration should ideally be >100 ng / mL, and the OD value should be... 260 / OD 280 A value of around 1.9 is preferred for subsequent experiments.

[0039] (3) PCR reaction

[0040] Reaction system: 12.5 μL of PCR reaction premix (2×), 0.5 μL each of two pairs of forward and reverse primers (10.0 μmol / L); 1.0 μL of DNA template (adjust sample DNA concentration to 10 ng / μL–100 ng / μL with double-distilled water), and bring the reaction system to a final volume of 25.0 μL with double-distilled water; perform two replicates for each sample. Primer information is shown in Table 1.

[0041] Reaction program: After pre-denaturation at 95 ℃ for 5 min, begin cycling: denaturation at 95 ℃ for 15 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 20 s, 35 cycles, followed by a final extension at 72 ℃ for 5 min. The reaction system and program can be adjusted according to the requirements of different gene amplification instruments and PCR reagents.

[0042] Table 1 Primer Information Table

[0043]

[0044] Figure 1 The results of primer validation for nucleic acid sequences from 22 pufferfish species are shown, with green arrows indicating the binding sites of the primers on the nucleic acid sequences of these species. This demonstrates that the designed primers can bind to the target sequences.

[0045] (4) Comparison settings

[0046] a) Negative control: DNA extracted from muscle tissue of non-pufferfish (such as grass carp and other common freshwater or saltwater fish) was used as a template and amplified using the above reaction system and procedure.

[0047] b) Positive control: DNA extracted from pufferfish muscle tissue was used as a template and amplified using the above reaction system and procedure.

[0048] c) Blank control: Replace the template DNA with an equal volume of double-distilled water and amplify using the above reaction system and procedure.

[0049] d) Internal control: DNA extracted from the muscle tissue of the sample to be tested was used as a template and amplified using the above reaction system and procedure.

[0050] (5) Electrophoretic detection of PCR amplification products

[0051] Prepare a 1% agarose gel using 1×TAE electrophoresis buffer. Mix 5 μL of PCR amplification product with 1 μL of 6× loading buffer (electrophoresis front indicator) and load the mixture into the wells of the gel plate. Label the gel with a DNA marker of appropriate molecular weight. Perform electrophoresis at 5 V / cm–10 V / cm. After electrophoresis, observe, photograph, record, and analyze the results using a gel imaging system.

[0052] Figure 2 Electrophoresis images of PCR identification of samples of *Pueraria lobata*, *Pueraria lobata*, *Pueraria lobata*, and *Pueraria lobata* are shown. Figure 3 The electrophoresis images of PCR identification of various actual samples are shown. Among them, there are 2 samples of pufferfish with dense spots, pufferfish with yellow chrysanthemum, pufferfish with purple color, and pufferfish with dark stripe, while the remaining varieties are 1 representative sample.

[0053] (6) Gel imaging analysis

[0054] After electrophoresis, the agarose gel is removed and placed on a gel imaging system for imaging. The size of the amplified bands is estimated based on DNA molecular weight standards, and the electrophoresis results are archived electronically or photographed using a photographic system.

[0055] (7) Sequencing verification of PCR amplification products

[0056] If any target DNA fragment of the expected size is detected by electrophoresis, the corresponding PCR product can be directly sequenced for analysis.

[0057] (8) Analysis of Pufferfish Varieties

[0058] To confirm the sample using the NCBI database, open the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), click "BLAST," select "nucleotide BLAST" (blastn), and enter the sample sequencing sequence in the query box or upload a file containing the sequence. Select the database: Nucleotides: "nr / nt" (non-redundant nucleotide database). Other parameters can usually use their default values. Click the "BLAST" button to submit the task. View the matching results in the "Descriptions" tab. In the alignment results, prioritize sequences with high percentage identity (Sort by percent identity). When the percentage identity is >98.5%, the sample and the pufferfish species corresponding to the aligned sequence are considered the same species. See the example results below. Figure 4 and Figure 5 .

[0059] (9) Quality control

[0060] The test results are considered invalid if any of the following conditions are not met.

[0061] a) Blank control: No target band was amplified by PCR.

[0062] b) Negative control: No target band was amplified by PCR.

[0063] c) Positive control: shows the target band for PCR amplification.

[0064] d) Internal control: Positive control, negative control, and test sample all showed the target band for PCR amplification.

[0065] (10) Statement of results

[0066] The sample was amplified with a specific sequence of the genus *Pueraria*, indicating that a species of pufferfish from the genus *Pueraria* was detected in the sample. Based on the analysis results in (8), it can be stated that "the pufferfish in this sample belongs to the genus *Pueraria*, and the specific species is the species described in the analysis results in (8)".

[0067] The pufferfish-specific sequence of the sample was amplified, indicating that a pufferfish species of the pufferfish genus was detected in the sample. According to the analysis results of (8), it is stated that "the sample is a pufferfish belonging to the pufferfish genus, and the specific species is (8) analysis results".

[0068] The specific sequences of the genus *Tetraodon* and the genus *Tetraodon* were not amplified in the sample, indicating that no target pufferfish DNA component was detected in the sample, and the statement was "no pufferfish component was detected in this sample".

[0069] (11) Pollution prevention measures

[0070] Measures to prevent cross-contamination during the testing process shall be implemented in accordance with the provisions of GB / T 27403.

[0071] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. A primer composition for identifying pufferfish, characterized in that, The primers include primers for the genus *Pueraria* and the genus *Tetranychus*. The sequences of the upstream and downstream primers for *Pueraria* are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the sequences of the upstream and downstream primers for *Tetranychus* are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

2. The primer composition for pufferfish identification according to claim 1, characterized in that, It also includes universal primers, the sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

3. The primer composition for pufferfish identification according to claim 1, characterized in that, The primer composition This method can effectively distinguish 18 species of pufferfish from the genus *Takifugu* and 4 species from the genus *Takifugu*. The *Takifugu* species include *Takifugu alboplumbeus*, *Takifugu bimaculatus*, *Takifugu fasciatus*, *Takifugu flavidus*, *Takifugu blongus*, *Takifugu ocellatus*, *Takifugu plagiocellatus*, *Takifugu porphyreus*, *Takifugu pseudommus*, *Takifugu rubripes*, and *Takifugu rubripes*. stictonotus), yellowfin pufferfish (Takifugu xanthopterus), spotted pufferfish (Takifugu chrysops), worm-spotted pufferfish (Takifugu exascurus), black-spotted pufferfish (Takifugu niphobles), leopard-spotted pufferfish (Takifugu pardalis), stictonotus pufferfish (Takifugu stictonotus), worm-spotted pufferfish (Takifugu vermicularis); Pufferfish of the genus Lagocephalus include Lagocephalus spadicecus (also known as the brown-spotted pufferfish), Lagocephalus gloveri (the dark-finned pufferfish), Lagocephalus guentheri (the guentheri), and Lagocephalus lagocephalus (the pufferfish with the fins).

4. A detection kit for identifying pufferfish, characterized in that, The primer composition comprises any one of claims 1 to 3.

5. The detection kit for pufferfish identification according to claim 4, characterized in that, It also contains reagents for PCR detection, including PCR reaction premix and double-distilled water.

6. The detection kit for pufferfish identification according to claim 4, characterized in that: in, The concentrations of both the upstream and downstream primers were 10 μmol / L.

7. A method for identifying pufferfish using the detection kit according to any one of claims 4 to 6, characterized in that, Includes the following steps: Reaction system construction: 12.5 μL of 2×PCR reaction premix, 0.5 μL each of Puppis multiges primer and Puppis harechis primer; 1.0 μL of DNA template, and the reaction system was brought to 25.0 μL with double-distilled water; Reaction program: Pre-denaturation at 95℃ for 5 min followed by cycling: denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 20 s, 35 cycles, extension at 72℃ for 5 min. Electrophoretic detection of PCR amplification products: Prepare 1% agarose gel using 1×TAE electrophoresis buffer; mix 5 μL of PCR amplification product with 1 μL of 6× loading buffer as an electrophoresis front indicator, and then spot the mixture into the wells of the gel plate; label the gel with a DNA marker of appropriate molecular weight; perform electrophoresis at 5 V / cm to 10 V / cm; after electrophoresis, observe, photograph, record, and analyze the results using a gel imaging system. Sequencing verification of PCR amplification products: If any target DNA fragment of the expected size appears after electrophoresis, the corresponding PCR product will be directly sequenced for analysis. Results confirmed: When comparing the samples using the NCBI database, if the percentage similarity between the two samples is greater than 98.5%, the pufferfish species corresponding to the tested sample and the compared sequence are considered to be the same species.

8. The method for identifying pufferfish according to claim 7, characterized in that: in, The concentration of the DNA template is 10 ng / μL to 100 ng / μL.