Use of an ikk inhibitor for the preparation of a medicament for restoring pancreatic islet function

Abstract

This invention discloses the application of IKK inhibitors in the preparation of drugs to restore pancreatic islet function. IKK inhibitors can effectively improve the problem of pancreatic β-cell differentiation defects, significantly increase the number of pancreatic β-cells, enhance the insulin secretion capacity of islet cells, and specifically upregulate the expression of key functional genes of pancreatic β-cells such as INS and NKX6.1 genes, thus repairing pancreatic islet function damage. This solves the technical problem that current treatments for type 1 diabetes can only replace insulin and relieve blood sugar symptoms, but cannot fundamentally repair pancreatic islet function. IKK inhibitors can be used to prepare drugs for the treatment of type 1 diabetes, providing a new approach for the clinical treatment of type 1 diabetes and possessing extremely high clinical translational value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of IKK inhibitors in the preparation of drugs that restore pancreatic islet function. Background Technology

[0002] Impaired pancreatic function is the core pathological feature of type 1 diabetes, mainly manifested as defective differentiation of pancreatic β cells and insufficient insulin secretion, accompanied by abnormal immunogenicity and disordered inflammatory response, ultimately leading to an imbalance in glycemic homeostasis, which seriously affects the patient's physical health and quality of life.

[0003] Our research group discovered that abnormal activation of the NF-κB signaling pathway is one of the key molecular mechanisms leading to pancreatic islet function damage. Continuous activation of this pathway inhibits the expression of pancreatic β-cell function-related genes, induces intracellular inflammatory responses, and disrupts the normal differentiation and secretory functions of pancreatic β-cells. At the same time, it leads to high expression of MHC-I molecules, enhances the immunogenicity of islet cells, and further aggravates pancreatic islet function damage.

[0004] Loss of function of the CLEC16A gene disrupts cellular homeostasis, thereby abnormally activating the NF-κB signaling pathway and ultimately causing a series of pancreatic dysfunctions such as pancreatic β-cell differentiation defects and insufficient insulin secretion.

[0005] Currently, clinical treatment for type 1 diabetes (T1D) mainly relies on exogenous insulin injections or islet transplantation. However, insulin injections require manual control of timing and dosage, unlike the real-time response of normal pancreatic islets to blood glucose changes. Islet transplantation faces limitations such as donor shortages and post-transplant immune rejection. Clinical drug treatment primarily involves insulin replacement therapy, which can only temporarily maintain blood glucose levels and cannot fundamentally repair damaged islet function or prevent further progression of islet dysfunction. Furthermore, existing treatments largely focus on alleviating symptoms of abnormal blood glucose levels, lacking specific drugs for restoring islet function, especially those that can regulate the NF-κB signaling pathway and target the repair of pancreatic β-cell differentiation and secretory function.

[0006] Based on the above situation, it is necessary to develop a drug that can target and regulate the NF-κB signaling pathway and effectively restore pancreatic islet function, in order to solve the technical problem in the current treatment of type 1 diabetes that it is impossible to fundamentally repair the defects in pancreatic β-cell differentiation, insufficient insulin secretion, and pancreatic islet function damage, and to provide new ideas and solutions for the treatment of type 1 diabetes. Summary of the Invention

[0007] The purpose of this invention is to provide the application of IKK inhibitors in the preparation of drugs that restore pancreatic islet function. This invention uses human pluripotent stem cells with CLEC16A gene deletion to induce differentiation into a type 1 diabetic cell model, and uses this model to screen for drugs that can restore pancreatic islet function, namely IKK inhibitors.

[0008] The technical solution adopted in this invention is:

[0009] Application of IKK inhibitors in the preparation of drugs to restore pancreatic function.

[0010] Furthermore, the IKK inhibitor is BMS-345541 or Amlexanox, preferably BMS-345541.

[0011] The structural formula of BMS-345541 is shown below:

[0012] .

[0013] The structural formula of Amlexanox is shown below:

[0014] .

[0015] Furthermore, the restoration of pancreatic islet function includes improving pancreatic β-cell differentiation defects, increasing the number of pancreatic β-cells, and enhancing insulin secretion capacity.

[0016] Furthermore, the IKK inhibitor inhibits pancreatic islet dysfunction caused by loss of function of the CLEC16A gene.

[0017] Specifically, the IKK inhibitor restores pancreatic function by regulating the activity of the NF-κB signaling pathway.

[0018] The IKK inhibitor can upregulate the expression of key functional genes of pancreatic β cells, including the INS gene and the NKX6.1 gene.

[0019] This invention also provides the use of the IKK inhibitor in the preparation of drugs that improve the immunogenicity abnormalities of pancreatic islet cells. The IKK inhibitor can reduce the expression level of MHC-I molecules in pancreatic islet cells and downregulate the expression level of genes involved in antigen processing in pancreatic islet cells, thereby improving the immunogenicity abnormalities of pancreatic islet cells.

[0020] Furthermore, the present invention also provides the use of IKK inhibitors in the preparation of medicaments for treating type 1 diabetes.

[0021] This invention also provides the use of IKK inhibitors in the preparation of formulations that promote the differentiation of human pluripotent stem cells into pancreatic islet cells. Further, the human pluripotent stem cells are CLEC16A-deficient human pluripotent stem cells.

[0022] Furthermore, this invention provides the use of an IKK inhibitor in the preparation of a formulation that promotes the differentiation of human expandable islet precursor cells (ePP cells) into islet cells. Further, the human expandable islet precursor cells are human expandable islet precursor cells with loss of CLEC16A function.

[0023] This invention also provides a method for screening candidate compounds that can restore pancreatic islet function, the method comprising:

[0024] (i) Human pluripotent stem cells with lost CLEC16A function were induced to differentiate into expandable pancreatic islet progenitor cells with lost CLEC16A function.

[0025] (ii) The test compound was added to the islet progenitor cells of people with loss of CLEC16A function as the test group, and the islet progenitor cells of people with loss of CLEC16A function without the test compound were used as the control group.

[0026] (iii) The expandable pancreatic islet precursor cells (ePP cells) in the test group and the control group were further differentiated into islet cells. The number of INS-GFP fluorescent positive cells (representing the number of β cells) in the test group and the control group were compared to determine whether the test compound was a candidate compound that could restore pancreatic islet function.

[0027] Specifically, if the number of INS-GFP fluorescent positive cells N1 in the test group is significantly higher than the number of INS-GFP fluorescent positive cells N0 in the control group, it indicates that the test compound is a candidate compound that can restore pancreatic islet function.

[0028] The present invention also provides a drug for restoring pancreatic function, including the IKK inhibitor.

[0029] The present invention also provides a medicament for treating type 1 diabetes, comprising the IKK inhibitor.

[0030] The drug may also include a pharmaceutically acceptable carrier selected from one or more of diluents, excipients, binders, disintegrants, and lubricants.

[0031] The beneficial effects of this invention are as follows:

[0032] 1. This invention is the first to screen and discover that IKK inhibitors can effectively improve the problem of pancreatic β-cell differentiation defects, significantly increase the number of pancreatic β-cells, improve the insulin secretion capacity of pancreatic β-cells, and specifically upregulate the expression of key functional genes of pancreatic β-cells such as INS gene and NKX6.1 gene, repair pancreatic islet function damage, and solve the technical problem that existing treatments for type 1 diabetes can only replace insulin and relieve blood sugar symptoms, but cannot fundamentally repair pancreatic islet function.

[0033] 2. The IKK inhibitor of the present invention has a significant repair effect on pancreatic islet function damage caused by loss of CLEC16A gene function, and can specifically solve the problem of abnormal pancreatic β cell function under this etiology, providing a unique treatment idea and drug preparation scheme for type 1 diabetes caused by abnormal CLEC16A gene function.

[0034] 3. The IKK inhibitor of the present invention can not only restore pancreatic islet function, but also effectively downregulate the expression level of MHC-I molecules in islet cells, improve the immunogenicity abnormality of islet cells, reduce immune damage to islet cells, and simultaneously repair islet function and regulate islet immune status, prevent further progression of islet function damage, and improve the long-term efficacy of treatment.

[0035] Unlike traditional drugs that primarily rely on insulin replacement therapy for type 1 diabetes, IKK inhibitors offer a novel approach to the clinical treatment of type 1 diabetes by repairing pancreatic islet function damage, demonstrating significant clinical translational value. Attached Figure Description

[0036] Figure 1 Figure showing the construction and functional characterization results of the C16-KO cell line.

[0037] Figure A is a schematic diagram of Cpf1 crRNA targeting the CLEC16A gene site, showing the exon structure (orange box), PCR amplicons (light gray box), and restriction enzyme sites used for PCR analysis. The crRNA targeting sequence is bolded; the Tsp45I restriction site is highlighted in red. Knockout of the two crRNAs yielded CLEC16A gene knockout C16-KO1 and C16-KO2 cells, respectively. C16-KO1 will be referred to as C16-KO below.

[0038] Figure B shows the T7EI detection of CLEC16A crRNAs in WT and C16-KO hPSCs. N = 3 biological replicates.

[0039] Figure C shows representative immunoblotting data of CLEC16A protein in WT and C16-KO ePP islets. ACTIN was used as a loading control. N = 3 biological replicates.

[0040] Figure D shows representative immunofluorescence staining of OCT4, NANOG, and nuclei in WT and C16-KO hPSCs. N = 3 biological replicates. Scale bar, 100 μm.

[0041] Figure E shows the RT-qPCR analysis of OCT4, SOX2, and NANOG expression in WT and C16-KO hPSCs. N = 3 biological replicates.

[0042] Figure F shows representative flow cytometry plots and percentages of OCT4+ / NANOG+ cells in WT and C16-KO hPSCs. N = 3 biological replicates.

[0043] Figure G shows representative flow cytometry plots and percentages of SOX17+ / FOXA2+ cells in DE phase WT and C16-KO. N = 3 biological replicates.

[0044] Figure H shows representative immunofluorescence staining of SOX17, FOXA2, and nuclei in DE-phase WT and C16-KO cells. N = 3 biological replicates. Scale bar, 100 μm.

[0045] Figure I shows the RT-qPCR analysis of SOX17, FOXA2, and CXCR4 expression in DE-phase WT and C16-KO cells. N = 3 biological replicates.

[0046] All data are expressed as mean ± standard deviation. Statistical significance was calculated using a two-tailed Student's t-test, with ns p > 0.05.

[0047] Figure 2 This study demonstrates the role and impact of CLEC16A deletion in the formation of pancreatic islet precursor cells (ePP) and islet cells (ePP-islets) in WT and C16-KO CLEC16A knockout human pluripotent stem cell lines (hPSCs).

[0048] Figure A is a Venn diagram of genes related to the endosomal pathway and genes related to type 1 diabetes (T1D) and type 2 diabetes (T2D).

[0049] Figure B is a schematic diagram of the generation of pancreatic islet precursor cells (ePPs) from WT and C16-KO human pluripotent stem cells (hPSCs).

[0050] Figure C shows bright-field images of WT and C16-KO pancreatic islet precursor cells. Scale bar, 500 μm.

[0051] Figure D shows the growth rates of WT and C16-KO pancreatic islet precursor cells. N = 3 biological replicates.

[0052] Figure E shows representative immunofluorescence staining of PDX1 and Ki67. N = 3 biological replicates. Scale bar, 100 μm.

[0053] Figure F shows INS-GFP. + Representative immunofluorescence staining for pancreatic islet markers. N = 3 biological replicates. Scale bar, 100 μm.

[0054] Figure G shows the RT-qPCR of pancreatic islet markers. N = 3 biological replicates.

[0055] The H-plot represents a representative flow cytometry atlas and the percentages of PDX1+ / C-peptide+, NKX6.1+ / C-peptide+, GCG- / C-peptide+, and SST- / C-peptide+ cells. N = 3 biological replicates.

[0056] Figure I shows a representative transmission electron microscope image (left) and a statistical analysis of the number of insulin particles per square micrometer (right). Scale bar, 1 μm. N = 3 biological replicates.

[0057] Figure J shows the total insulin content. N = 4 biological replicates.

[0058] The K-plot represents the glucose-stimulated insulin secretion (GSIS) assay. N = 7 biologically independent samples.

[0059] Figure L is a volcano plot of differentially expressed genes (DEGs) in C16-KO and WT pancreatic islet precursor cells. Red indicates upregulated genes (n = 1715, FC > 1.3, p < 0.05); blue indicates downregulated genes (n = 1219, FC < 0.77, p < 0.05).

[0060] The M-figure is a heatmap showing the downregulated and upregulated genes in C16-KO and WT ePP-islet cells.

[0061] Figure N shows the functional enrichment analysis of upregulated (left) and downregulated (right) genes in C16-KO and WT ePP-islet cells. Black circles represent major GO term clusters in differentially expressed genes (DEGs).

[0062] Figure O shows the KEGG enrichment analysis in C16-KO and WT ePP-islets.

[0063] Figure P is a schematic diagram of the MHC-I antigen processing and presentation pathway.

[0064] The Q plot shows RT-qPCR of MHC-I related genes. N = 3 biological replicates.

[0065] Figure R shows representative immunofluorescence staining of MHC-I and INS-GFP+ cells and cell nuclei. N = 3 biological replicates. Scale bar, 100 μm.

[0066] All data are expressed as mean ± standard deviation. Statistical significance was determined by a two-tailed Student's t-test, with * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0067] Figure 3 The study showed that CLEC16A deficiency affects the proliferation of ePPs and the differentiation of pancreatic β cells.

[0068] Figure A shows PDX1, NKX6.1, and nuclear immunofluorescence staining of WT and C16-KO ePPs. N = 3 biological replicates. Scale bar, 100 μm.

[0069] Figure B shows representative flow cytometry plots and percentages of PDX1+ / NKX6.1+ cells in WT and C16-KO ePPs. N = 3 biological replicates.

[0070] Figure C shows the RT-qPCR analysis of the expression of ePP marker genes PDX1, NKX6.1, SOX9, and HNF6 in WT and C16-KO ePPs. N = 3 biological replicates.

[0071] Figure D is a volcano plot of differentially expressed genes between C16-KO ePPs and WT ePPs. R: Pearson correlation coefficient.

[0072] Figure E shows representative flow cytometry plots and percentages of PDX1+ / Ki67+ cells in WT and C16-KO ePPs. N = 3 biological replicates.

[0073] Figure F shows representative INS-GFP+ fluorescence and bright-field images of WT and C16-KO ePP-islets. Each image represents three independent replicates. Scale bar: 200 μm.

[0074] Figure G shows the RT-qPCR analysis of the expression of ePP-islet markers NKX6.1, NKX2.2, INS, PCSK1, and GCG in WT and C16-KO2 ePP-islets. N = 3 biological replicates.

[0075] Figure H shows representative INS-GFP+ fluorescence and bright-field images of WT and C16-KO2 ePP-islets. The images represent three independent replicates. Scale bar: 200 μm.

[0076] Figure I shows the total insulin content of WT and C16-KO2 ePP-islets. N = 4 biological replicates. All data are presented as mean ± standard deviation. Statistical significance was calculated using a two-tailed Student's t-test, ns p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0077] Figure J illustrates the differentiation of WT and C16-KO ePPs into ePP-islets.

[0078] The K-plot is a UMAP visualization of cell types in WT and C16-KO ePP-islets.

[0079] Figure L shows a UMAP visualization of marker gene expression in WT and C16-KO ePP-islets. The red-to-gray gradient represents the normalized expression of each gene.

[0080] The M-figure visualizes the UMAP of WT and C16-KO cells in different cell clusters.

[0081] The N-plot is a stacked histogram showing the cell proportions of C16-KO and WT ePP-islets.

[0082] Figure O shows the distribution density of β fate cells in the pseudo-chronological order.

[0083] Figure P shows a violin plot of INS expression in CLEC16A-KO and WT β fate cells.

[0084] The Q plot shows the pseudo-time sequence of INS, MAFB, NKX6.1, LMX1A, SLC18A, and TPH1. The black line represents the mean expression curve for each gene.

[0085] Figure R is a bar chart showing the GO terms of upregulated (left) and downregulated (right) genes in C16-KO and WT β fate cells.

[0086] Figure 4 The study showed that CLEC16A knockout affects autophagy, but has little effect on mitochondrial autophagy.

[0087] Figure A shows representative immunoblotting data and relative expression levels of LC3 protein in WT, WT+BafA1, C16-KO, and C16-KO+BafA1 ePP-pancreatic islets. ACTIN was used as a loading control. N = 3 biological replicates.

[0088] Figure B shows representative immunoblotting data and relative expression levels of p62 protein in WT and C16-KO ePP islets. ACTIN was used as a loading control. N = 3 biological replicates.

[0089] Figure C shows the ratio of INS-GFP+ / TMRM+ cells in WT and C16-KO ePP-islets. N = 3 biological replicates.

[0090] Figure D shows representative transmission electron microscopy images of mitochondria in WT and C16-KO ePP islets. N = 3 biological replicates. Scale bar, 1 μm (left); 2 μm (right).

[0091] Figure E shows the detection of mitochondrial DNA in WT and C16-KO ePP-pancreatic islets. N = 6 biological replicates.

[0092] Figure F shows the CD63 and nuclear immunofluorescence staining of R6-stage WT and C16-KO2 ePP-islets. N = 3 biological replicates. Scale bar, 10 μm.

[0093] Figure G shows LAMP2 and nuclear immunofluorescence staining of R6-stage WT and C16-KO2 ePP-islets. N = 3 biological replicates. Scale bar, 10 μm.

[0094] All data are expressed as mean ± standard deviation. Statistical significance was calculated using a two-tailed Student's t-test, with ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0095] Figure 5 The study showed that CLEC16A knockout disrupts endosomal homeostasis and activates the NF-κB signaling pathway, while BMS-345541 can restore differentiation defects and abnormally high expression of NF-κB and MHC-I.

[0096] Figure A shows representative immunofluorescence staining of CD63, insulin, and cell nuclei in the R6 phase. N = 3 biological replicates. Scale bar, 10 μm.

[0097] Figure B shows the quantification of insulin and CD63 colocalization in each cell field of view. N = 3 biological replicates.

[0098] Figure C shows the Western blot of CD63 protein (left). Quantification of the CD63 / ACTIN ratio (right). N = 3 biological replicates.

[0099] Figure D shows a representative immunofluorescence staining of LAMP2. N = 3 biological replicates. Scale bar, 10 μm.

[0100] Figure E shows a representative transmission electron microscope image of the entire cellular field of view. Red arrows point to abnormally enlarged or abnormally sized lysosomes during C16-KO ePP differentiation. N = 3 biological replicates. Scale bar, 2 micrometers.

[0101] Figure F shows a representative transmission electron microscope image (left). Quantification of the number of multivesicular bodies (MVBs) per square micrometer (right). Yellow arrows point to insulin particles, and red arrows point to multivesicular bodies. N = 3 biological replicates. Scale bar, 0.5 μm.

[0102] Figure G shows a representative transmission electron microscopy image of stage R7 (left). Yellow arrows indicate insulin granules, and red arrows indicate abnormal endolysosomes. Scale bar, 0.5 μm. Representative images of “phagocytosis” (endolysosomes containing insulin granules) and “fusion” (multivesicular bodies and lysosomes) are shown alongside. Scale bar, 0.2 μm. Quantification of the number of endolysosomes per square micrometer (right). N = 3 biological replicates.

[0103] Figure H shows representative protein blots of p65 and p52. N = 3 biological replicates.

[0104] Figure 1 shows the predicted binding sites of p65 / p52 on the INSULIN and NKX6.1 promoters (top). CUT&Tag qPCR was used to verify the binding of p65 / p52 on the INSULIN and NKX6.1 promoters (bottom). N = 3 biological replicates.

[0105] Figure J is a schematic diagram of chemical screening during the C16-KO endocrine differentiation process.

[0106] The K-plot shows the results of the first round of chemical screening. Red dots represent small molecules with a recovery effect of more than 1.5 times.

[0107] Figure L shows the chemical structure of BMS-345541.

[0108] Image M shows representative INS-GFP+ fluorescence and bright-field images. N = 3 biological replicates. Scale bar: 200 micrometers.

[0109] The N figure shows RT-qPCR for INS expression. N = 3 biological replicates.

[0110] Figure O shows the RT-qPCR of pancreatic islet markers. N = 3 biological replicates.

[0111] P-plots represent representative flow cytometry plots and statistical analysis. N = 3 biological replicates.

[0112] The Q plot shows RT-qPCR of MHC-I related genes. N = 3 biological replicates.

[0113] Figure R shows representative protein blots of p65 and p52. N = 3 biological replicates.

[0114] All data are expressed as mean ± standard deviation. Statistical significance was determined by a two-tailed Student's t-test, with * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0115] Figure 6 The results showed that BMS-345541 and Amlexanox can restore differentiation defects caused by CLEC16A deletion.

[0116] Figure A shows the flowchart of the chemical screening process. After repeated verification, BMS-345541 was found to be the target compound.

[0117] Figure B shows representative INS-GFP+ fluorescence and bright-field images of WT, C16-KO2, and C16-KO2 ePP-islets treated with BMS-345541. The images represent three independent replicates. Scale bar: 200 μm.

[0118] Figure C shows representative INS-GFP+ fluorescence and bright-field images of C16-KO ePP-islets treated with different concentrations of BMS-345541. N = 3 biological replicates.

[0119] Figure D shows the RT-qPCR analysis of INS, NKX6.1, NKX2.2, PCSK1, and KCNJ11 expression in WT, C16-KO2, and C16-KO2 ePP-islets treated with BMS-345541. N = 3 biological replicates.

[0120] Figure E shows the chemical structure of Amlexanox.

[0121] Figure F shows representative INS-GFP+ fluorescence and bright-field images of WT, C16-KO, and C16-KO ePP-islets treated with Amlexanox (1 μM). Images represent three independent replicates. Scale bar: 200 μm.

[0122] Figure G shows the RT-qPCR analysis of INS, NKX6.1, and KCNJ11 expression in WT, C16-KO, and Amlexanox-treated C16-KO ePP-islets. N = 3 biological replicates.

[0123] All data are expressed as mean ± standard deviation. Statistical significance was calculated using a two-tailed Student's t-test, with ns *p* > 0.05, **p* < 0.05, **p* < 0.01, ***p* < 0.001, ****p* < 0.0001. Detailed Implementation

[0124] The technical solution of the present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0125] Example 1

[0126] 1. Cell lines

[0127] Human embryonic kidney 293T cells were cultured in DMEM medium containing 10% FBS and 1× penicillin / streptomycin. HEK293T cells were purchased from the American Type Culture Collection (CRL-3216). Undifferentiated human pluripotent stem cells (hPSCs) were cultured in DMEM / F12 medium supplemented with 20% KnockOut serum substitute, 1× penicillin / streptomycin, 1× non-essential amino acids, 0.055 mM 2-mercaptoethanol, and 10 ng / mL bFGF. hPSCs were co-cultured with CF1 feeder cells at 37°C and 5% CO2. hPSCs were passaged every 3–6 days using Accutase at a ratio of 1:3 to 1:6. 0.5 μM thiazovivin was added 24 hours before cell passage or resuscitation. Human pluripotent stem cells MEL1 INS GFP / W The hESC cell line was kindly provided by Dr. EGStanley and Dr. Andrew Elefanty. Mycoplasma contamination is regularly monitored.

[0128] 2. Plasmid construction and lentivirus preparation

[0129] Single-stranded DNA was synthesized by Sangon Biotech, and shRNA was ligated into the pLKO.1 vector. All vectors were validated by Sanger sequencing. For packaging lentivirus, the plasmid was transfected into HEK293T cells using PEI, and 6 hours after transfection, the medium was replaced with DMEM containing 10% fetal bovine serum and 1× penicillin / streptomycin. Lentiviral cells were collected and filtered at 48 and 72 hours post-transfection. For lentivirus infection, the lentivirus was incubated with ePP cells at approximately 60-70% density for 4 hours.

[0130] 3. Construction of CLEC16A knockout hPSC cell line

[0131] The CLEC16A knockout cell line was generated using a highly effective crRNA targeting the second exon of the CLEC16A locus (cr1:ACCAAAAACACCACAGTCACAGAA). All plasmids (the expression vector pcDNA3.1-hLbCpf1 (Addgene, plasmid #31938) containing the LbCpf1 protein and the expression vector pCpfcr-cr1 containing crRNA) were electroporated into hPSCs. After culture, single hPSC cell clones were picked, amplified by PCR, and verified by sequencing to identify positive single clones with CLEC16A gene insertion / deletion mutations (loss of function). These positive single clones were expanded and preserved using standard cell cryopreservation methods to obtain CLEC16A-deficient hPSC cells (denoted as C16-KO hPSCs) for subsequent directed differentiation experiments. Genotyping of the constructed cell lines was performed using the following primers:

[0132] CLEC16A-KO-F: CACCACAGTCACAGAACAGAAC

[0133] CLEC16A-KO-R:TCTAGGCAAGATCAAATTAGCG.

[0134] 4. Pancreatic differentiation

[0135] hPSCs (control group) or C16-KO hPSCs were digested with Accutase at 5 × 10⁻⁶ ppm per well. 5 hPSCs were seeded at a density of 100 cells / well in 12-well plates and began to differentiate after two days of culture. hPSCs were washed with DPBS before each change of differentiation medium.

[0136] The differentiation culture medium is as follows:

[0137] Day 1: RPMI, 1× penicillin / streptomycin, 100 ng / mL activin A and 3 μM CHIR99021.

[0138] Day 2: RPMI, 0.2% FBS, 1× penicillin / streptomycin, 100 ng / mL activin A.

[0139] Day 3: RPMI, 2% FBS, 1× penicillin / streptomycin, 100 ng / mL activin A.

[0140] Days 4-6: RPMI, 0.5×B27, 0.5×N2, 0.05%BSA, 1×penicillin / streptomycin, 50 ng / mL KGF.

[0141] Days 7-8: DMEM, 1×B27, 0.05%BSA, 1×Penicillin / Streptomycin, 0.25 mM Vitamin C, 50 ng / mL KGF, 0.1 μM LDN-193189, 0.1 μM GDC-0449, 2 μM Retinoic Acid.

[0142] Days 9-14: DMEM, 1×B27, 0.05%BSA, 1×penicillin / streptomycin, 0.25 mM vitamin C, 0.1 μML DN-193189, 50 ng / mL EGF.

[0143] ePP cells were established and cultured in PP amplification medium containing DMEM, 1×B27, 10 μM 616452, 50 ng / mL EGF, 10 ng / mL bFGF and 1 μM I-BET151.

[0144] The expanded ePP cells differentiated into ePP-islet cells using R6 and R7 media. R6 medium: DMEM containing 1×B27, 0.05% BSA, 10 μM zinc sulfate, 10 μg / mL heparin, 10 μM 616452, 1 μM T3, 0.2 μM DN-193189, 0.2 μM Compound E, 0.5 mM vitamin C, and 10 μM phlebotomycin. R7 medium: DMEM, 1×B27, 0.05% BSA, 1× penicillin / streptomycin, 10 μM zinc sulfate, 10 μg / mL heparin, 10 μM 616452, 1 μM T3, 1 mM N-acetylcysteine, 1 μM trolox, and 0.25 mM vitamin C.

[0145] 5. Immunostaining

[0146] Cells were fixed with 4% paraformaldehyde at room temperature for 10 minutes, washed three times with PBST buffer for 10-15 minutes each time. Then, cells were blocked in blocking buffer at room temperature for 1 hour, followed by overnight incubation with primary antibody at 4°C. Next, cells were incubated with a 1:2000 dilution of secondary antibody at room temperature in the dark for 1 hour. Finally, cell nuclei were stained with Hoechst at a 1:5000 dilution.

[0147] 6. Protein immunoblotting

[0148] Cells were lysed on ice for 15 minutes using lysis buffer supplemented with 1% PMSF to extract total protein. Cell extracts were centrifuged at 12000×g for 15 minutes, and the supernatant was collected. Cell lysates were separated on a 10% acrylamide gradient SDS-PAGE gel and transferred to an NC membrane. The membrane was then blocked in Tris-buffered saline containing 0.1% Tween 20 with 5% skim milk at room temperature for 1 hour, followed by incubation with primary and secondary antibodies. Detection was performed by Western blotting using a high-sensitivity ECL chemiluminescence assay kit.

[0149] 7. Flow Cytometry (FACS)

[0150] Cells were digested into single cells with Accutase, centrifuged at 2250 rpm for 5 minutes, and washed with DPBS. Next, cells were fixed with 4% PFA at 4°C for 30 minutes, washed three times with PBST, and centrifuged at 1500 rpm for 5 minutes each time. Cells were then blocked with blocking buffer and incubated overnight with primary antibody at 4°C. The next day, after washing three times with PBST, cells were incubated with secondary antibody at room temperature for 3 hours. FACS data were acquired using a Beckman CytoFlex flow cytometer and analyzed using CytExpert software.

[0151] 8. Real-time quantitative PCR (RT-qPCR)

[0152] Total RNA was extracted and purified using the FastPure Cell / Tissue Total RNA Isolation Kit and reverse transcribed into cDNA using PrimeScript RT Master Mix. RT-qPCR was performed on a CFX Connect Real-Time system using the TB Green Premix Ex Taq II Kit. Primer sequences are shown in Table 1.

[0153] 9. Insulin content analysis

[0154] Islets differentiated from ePP cells (ePP-islets) were collected, counted using Countess II FL, and lysed using lysis buffer. Supernatant samples containing total insulin were analyzed using a human insulin immunoassay kit. Insulin levels were normalized by cell count.

[0155] 10. Glucose-stimulated insulin secretion assay (GSIS)

[0156] For the GSIS assay, ePP-islets were washed twice with 1 mL KRBH buffer. Cell clusters were then pre-incubated for 1 hour in 3 mL KRBH containing 2 mM glucose to remove residual insulin. All tube caps were kept open for air exchange during incubation. After washing the cell clusters twice with KRBH buffer, they were incubated for 1 hour in 1 mL low-glucose KRBH. Following incubation, 200 μL of supernatant was collected for ELISA analysis. The cell clusters were then washed twice with KRBH, followed by incubation for 1 hour in high-glucose KRBH containing 16.8 mM glucose, with another 200 μL of supernatant collected afterward. Finally, the cell clusters were dispersed into single cells using Accutase for cell counting. The supernatant samples were analyzed using a human insulin immunoassay kit.

[0157] 11. Transmission electron microscopy analysis

[0158] ePP-islets were fixed overnight at 4°C with glutaraldehyde. After washing three times with PBS, the ePP-islets were fixed again with osmium tetroxide for 1.5 hours. Next, the ePP-islets were washed with PBS and dehydrated via a gradient of ethanol. The samples were then dehydrated in propylene oxide for 20 minutes. After infiltration with a gradient of resins, the samples were embedded in fresh, pure resin and polymerized at 65°C for 48 hours. Subsequent sectioning and staining were performed using the Microscopy Core Platform of the Institute of Life Sciences. Data on insulin particles, MVBs, and lysosomes were then collected using transmission electron microscopy.

[0159] 12. Screening of small chemical molecules

[0160] ePP cells cultured in amplification medium were seeded into 48-well plates and differentiated into ePP-islets in R6 medium treated with different small molecules for 7 days. The medium was changed every 3 days. INS-GFP fluorescence was observed under a microscope on day 7 and analyzed using ImageJ.

[0161] 13. Bulk RNA sequencing analysis

[0162] Total RNA was isolated using the Quick-RNA MiniPrep Kit. cDNA library construction and high-throughput sequencing were performed by Novogene, using an Illumina HiSeq 2500 for paired-end 150-bp read sequencing. Raw RNA-seq data was pruned using fastp to remove adapter sequences and low-quality reads. Clean reads were aligned to the hg38 genome using HISAT2. Transcript assembly was performed using stringtie, and transcript expression for each gene was quantified to TPM. Differential expression analysis was performed using the R package DESeq2. Heatmaps were generated using the pheatmap package.

[0163] 14. Single-cell RNA sequencing analysis

[0164] Raw scRNA-seq data were preprocessed using the 10x Genomics Cell Ranger RNA v7.1.0 workflow. The final output was a cell-gene count matrix used for all downstream analyses. The cell-gene count matrix was read using the Seurat package, and a Seurat object was created for each sample. The Seurat objects for all samples were merged into a new Seurat object. We then used the following criteria to obtain clean data: nFeature_RNA between 2000 and 15000; nCount_RNA between 500 and 75000; and mitochondrial gene proportion < 30%. Following the standard Seurat workflow, we performed dimensionality reduction and clustering analyses. Cell types in each cluster were annotated based on the expression of known marker genes. The annotated data were then used for downstream integration and differentially expressed gene identification.

[0165] 15. Enrichment Analysis

[0166] HOMER was used for motif enrichment analysis of genes involved in the endosomal transport pathway. GSEA and GO analyses were performed using the R package clusterProfiler.

[0167] 16. Targeted cleavage and transposase technology (CUT & Tag)

[0168] CUT&Tag experiments were performed using the NovoNGS CUT&Tag High-Sensitivity Kit according to the manufacturer's recommendations. DNA was amplified using N5 and N7 primers and purified using NovoNGS DNA Clean Beads for high-throughput sequencing.

[0169] 17. CUT & Tag qPCR

[0170] CUT&Tag experiments were performed using the NovoNGS CUT&Tag High-Sensitivity Kit according to the manufacturer's recommendations. A fraction of the DNA purified from the CUT&Tag experiments was diluted 5-fold for RT-qPCR. The p65 and p52 binding sites of the INSULIN and NKX6.1 promoter regions were predicted using JASPAR, and primers were designed using NCBI Primer-BLAST. Primer sequences are shown in Table 2.

[0171] 18. Quantitative and statistical analysis

[0172] All experiments were performed at least three biological replicates, demonstrating successful reproducibility. All graphs were generated using GraphPad Prism8 V.8.3.0.538 (64-bit). All data are presented as mean, with error bars representing standard deviations. P-values ​​were obtained using a two-tailed unpaired t-test. P-values ​​were expressed as follows: ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. The sample size n represents the total number of independent biological or technical replicates (the specific meaning is explained in the figure captions). For immunoblotting and immunohistochemistry, representative images are shown. Each of these experiments was performed at least three times independently.

[0173] 19. Table 1 shows the primer sequences for RT-qPCR.

[0174] Gene Sequence GAPDH-F TGCACCACCAACTGCTTAGC GAPDH-R GGCATGGACTGTGGTCATGAG FOXA2-F GGGAGCGGTGAAGATGGA FOXA2-R TCATGTTGCTCACGGAGGAGTA HNF6-F ATGTCCAGCGTCGAACTCTAC HNF6-R TGCTTTGGTACAAGTGCTTGAT ACTB-F CACTCTTCCAGCCTTCCTTC ACTB-R GTACAGGTCTTTGCGGATGT SOX9-F AGCGAACGCACATCAAGAC SOX9-R CTGTAGGCGATCTGTTGGGG PDX1-F TACTGGATTGGCGTTGTTTGTGGC PDX1-R AGGGAGCCTTCCAATGTGTATGGT NKX6.1-F GGGAGGGAGGGGCTACAATA NKX6.1-R ATGTTTCAGACCCAGAGCGG SOX17-F ATTTCCTCGGTGGTGTCC SOX17-R CCAAACTGTTCAAGTGGCAGA OCT4-F GAGAAGGAGAAGCTGGAGCA OCT4-R AATAGAACCCCCAGGGTGAG NANOG-F GATTTGTGGGCCTGAAGAAA NANOG-R CAGATCCATGGAGGAAGGAA SOX2-F CATGGACAGTTACGCGCACAT SOX2-R AGTTGTACTGCAGGGCGCTCA NKX2.2-F ATGTAAACGTTCTGACAACT NKX2.2-R TTCCATATTTGAGAAATGTTTGC GCG-F AAGCATTTACTTTGTGGCTGGATT GCG-R TGATCTGGATTTCTCCTCTGTGTCT SST-F GATGCTGTCCTGCCGCCTCC SST-R TGCCATAGCCGGGTTTGA INS-F GCAGCCTTTGTGAACCAACAC INS-R CCCCGCACACTAGGTAGAGA PCSK1-F TGATCCCACAAACGAGAACA PCSK1-R TCTGATTATTTGCTTGCATGG KCNJ11-F CCTGATCCTCATCGTGCAGAAC KCNJ11-R TCACCGCATGCTTGCTGAAG ARX-F GTGCAAGGCTCCCCTAAGAG ARX-R CGTTCTCGCGGTACGACTT HHEX-F ACGCCCTTTTACATCGAGGAC HHEX-R CGTGTAGTCGTTCACCGTC HLA-AF AGATACACCTGCCATGTGCAGC HLA-AR GATCACAGCTCCAAGGAGAACC HLA-BF CTGCTGTGATGTGTAGGAGGAAG HLA-BR GCTGTGAGAGACACACAGAGC HLA-CF GGAGACACAGAAGTACAAGGCGC HLA-CR ACATCCTCTGGAGGGTGTGAGA B2M-F CCACTGAAAAAGATGAGTATGCCT B2M-R CCAATCCAAATGCGGCATCTTCA TAP1-F GCAGTCAACTCCTGGACCACTA TAP1-R CAAGGTTCCCACTGCTTACAGC TAP2-F ATGCCCTTCACAATAGCAGCGG TAP2-R CCAAAACTGCGAACGGTCTGCA TAPBP-F GAGCCTGTTCTCATCACCATGG TAPBP-R GTAGGCAAAGCTCAAGTCCAGC PSMB8-F GGTCCTACATTAGTGCCTTACGG PSMB8-R CGCAGATAGTACAGCCTGCATT PSMB9-F GCACCAACCGGGGACTTAC PSMB9-R CACTCGGGAATCAGAACCCAT PSMB10-F TCCTTCGAGAACTGCCAAAGA PSMB10-R ATCGTTAGTGGCTCGCGTATC ERAP1-F CCCCTCAAATGGTCCCTTGC ERAP1-R GAGATGCTTCAGTGCTCTGAC

[0175] Table 2 shows the primer sequences for CUT-Tag-qPCR.

[0176] INS-p65-F1 GACCAAGGAGATCTTCCCAC INS-p65-R1 AGATGGCTGGGGGCTGA INS-p65-F2 AGGGTGGGACATAGGGATG INS-p65-R2 TCCCAGAAGCAGGAGGATGA INS-p52-F1 TGTCTCTGAAGGGCTGTGAG INS-p52-R1 AGAGCCAGGCGCTGGCA NKX6.1-p65-F1 GACCACCTTCCAATGGTG NKX6.1-p65-R1 TTCCCGACAGGGTTGAACTG NKX6.1-p65-F2 GGCTTAAGGAGCAACA NKX6.1-p65-R2 TGGCTCCTTCTTTTGAAGGG NKX6.1-p52-F1 TCAGCCAATCAGAGGGTG NKX6.1-p52-R1 TAACCACCGTGTCCAATAGC NKX6.1-p52-F2 GGCTTGACTCCTTAGCAC NKX6.1-p52-R2 GGACTTTAGAATCTGACCTGGG

[0177] Example 2 Experimental Results

[0178] 1. This invention constructs CLEC16A KO (C16-KO) hPSCs ( Figure 1 AC and Figure 2 AC) found that CLEC16A knockout did not affect the differentiation of hPSCs into PP. Figure 1 DI and Figure 3 However, C16-KO ePPs exhibited slowed proliferation and reduced expression of the proliferation marker Ki67 (AC). Figure 2 DE and Figure 3 DE). Notably, CLEC16A knockout severely impairs the production of pancreatic β cells (DE). Figure 3F). Immunostaining, flow cytometry (FACS), and quantitative real-time qPCR (RT-qPCR) further validated the differentiation defect of C16-KO ePP-islets. Figure 2 FH and Figure 3 GH). Simultaneously, a sharp decrease in insulin particles was observed in C16-KO ePP islets ( Figure 2 I) and a decrease in total insulin levels ( Figure 2 J and Figure 3 I). The glucose-stimulated insulin secretion assay (GSIS) further demonstrated impaired function of C16-KO ePP-islets. Figure 2 Unlike previous studies in mice, where Clec16a deficiency did not affect islet formation, the experimental results of this invention show that CLEC16A deficiency does affect islet formation. These results demonstrate the human-specific function of CLEC16A.

[0179] 2. Further single-cell RNA sequencing (scRNA-seq) analysis was performed on WT and C16-KO ePP-islets. Figure 3 J). Based on marker gene expression, cells can be divided into three clusters (J). Figure 3 KL). Notably, C16-KO cells in the ePP-pre-β cluster exhibited a different transcriptional profile and differentiation trajectory compared to WT cells. Figure 3 MO). Expression of the gene encoding insulin (INS) was significantly reduced in C16-KO ePP-pre-β and ePP-β cells. Figure 3 Furthermore, pseudo-time trajectory analysis showed that WT ePP-pre-β cells could further differentiate into ePP-β cells, but C16-KO cells were arrested at an earlier differentiation stage, indicating impaired differentiation capacity. Figure 3 Q). In C16-KO cells, the expression of key β-cell markers was downregulated throughout the entire trajectory (Q). Figure 3 Q). GO analysis revealed upregulation of signaling pathways related to antigen processing and NF-κB, while downregulated genes were associated with cellular glucose homeostasis and insulin secretion. Figure 3 In summary, these results demonstrate that CLEC16A knockout not only inhibits ePP-islet production but also disrupts key β-cell function.

[0180] 3. Previous GWAS studies have linked CLEC16A to T1D; however, the Clec16a-KO mouse model failed to mimic the excessive immune state of β cells in T1D, and the underlying molecular mechanisms remain largely unknown. We performed bulk RNA-seq on WT and C16-KO ePP-islets to compare their gene expression profiles (…). Figure 2L). Significant downregulation of genes and pathways related to islet function was observed in C16-KOePP-islets; however, significant upregulation of I-κB kinase / NF-κB signaling and MHC class I complexes was observed. Figure 2 MN). KEGG analysis further confirmed that upregulated genes in C16-KO ePP-islets are involved in pathways such as T1D and antigen processing and presentation, while downregulated genes are related to insulin secretion (MN). Figure 2 To validate these findings, we examined the expression levels of key genes associated with antigen processing, MHC class I, and immunoproteasome components (O). Figure 2 Indeed, all of these genes were significantly upregulated in C16-KO ePP-islets. Figure 2 Q). Immunostaining further confirmed elevated MHC-I expression ( Figure 2 In summary, CLEC16A loss not only disrupts pancreatic differentiation but also induces MHC-I expression in ePP-islets, potentially mimicking an autoimmune-like state and promoting T1D progression at the molecular level.

[0181] 4. This invention also investigated how CLEC16A deficiency affects pancreatic differentiation and islet function. CLEC16A has been reported to regulate autophagy and mitophagy; we examined autophagic flux and mitophagy in C16-KO ePP islets. Western blot results showed an increased LC3II / LC3I ratio and elevated p62 levels in C16-KO ePP islets, indicating impaired autophagic flux. Figure 4 AB). Treatment with Bafilomycin A1 further confirmed the accumulation of autophagosomes and decreased autophagy efficiency in C16-KOePP islets. Figure 4 A). Despite a decrease in INS-GFP and TMRM double-positive cells, transmission electron microscopy and mtDNA analysis showed that mitochondrial morphology, size, and number remained essentially normal. Figure 4 These findings suggest that CLEC16A deficiency impairs autophagy in ePP-islets but does not significantly affect mitophagy.

[0182] Given that CLEC16A is a key endosome membrane protein involved in transport and receptor-mediated endocytosis, we turned our attention to the role of the endosome system in WT and C16-KO ePP-islets. Our analysis revealed a significant accumulation of CD63—a recognized marker of multivesicular bodies—and increased colocalization of insulin with CD63, both of which indicate endosome dysfunction in C16-KO cells. Figure 5 AB and Figure 4F). Western blot analysis further supported this phenomenon, confirming increased CD63 expression in C16-KO ePP islets (F). Figure 5 C). Furthermore, the lysosomal marker LAMP2 was significantly upregulated in C16-KO cells ( Figure 5 D and Figure 4 (G) indicates severely impaired endosome maturation. Notably, C16-KO islets exhibit endosomes with both early and late endosome characteristics, and these mixed endosomes gradually accumulate throughout differentiation (Fig. 5E-G). These findings suggest that CLEC16A deficiency disrupts normal endosome transport and maturation, revealing the crucial role of CLEC16A in maintaining endosome homeostasis during islet differentiation.

[0183] Next, we investigated how endosomal dysfunction affects the expression of pancreatic marker genes. Based on our observation of activation of the IKK / NF-κB signaling pathway, we experimentally verified increased nuclear localization of the NF-κB subunits p65 and p52. Figure 5 H). Furthermore, targeted cleavage and transposase (CUT&Tag)-qPCR analysis showed that p65 and p52 directly bind to the promoters of key β-cell marker genes (such as INS and NKX6.1), leading to decreased expression of these genes. Figure 5 I).

[0184] In summary, these results indicate that CLEC16A deficiency not only disrupts endosomal transport and maturation but also induces endosomal dysfunction, thereby activating the IKK / NF-κB signaling pathway. This, in turn, leads to the downregulation of key β-cell markers, providing a potential mechanism for impaired pancreatic differentiation caused by CLEC16A deficiency.

[0185] 5. Chemical Small Molecule Screening. To find drug reversal agents targeting C16-KO, we employed an unbiased chemical screening strategy using the ePP-islet system (Figure 5J). We identified BMS-345541, an IKK inhibitor, as an effective molecule that significantly restored the ability of C16-KO ePPs to differentiate into ePP-islets. Figure 5 KL and Figure 6 A). Treatment with BMS-345541 increased the number of INS-GFP+ cells. Figure 5 MN and Figure 6 BC), and significantly upregulated key β-cell markers ( Figure 5 O and Figure 6 D). FACS further demonstrated that BMS-345541 effectively increased the proportion of INS-GFP+ cells (D). Figure 5Mechanistically, BMS-345541 significantly downregulated genes involved in antigen processing, potentially reducing the immune attack effect. Figure 5 Q). In contrast to the NF-κB signaling activation observed during CLEC16A knockout, BMS-345541 inhibited the nuclear localization of p52 and p65 in C16-KO cells (Q). Figure 5 In addition, we tested another IKK inhibitor, Amlexanox, which produced a similar recovery effect in C16-KO cells (R). Figure 6 (EG). In summary, IKK inhibitors have been identified as effective drugs targeting CLEC16A deficiency, restoring pancreatic islet function, improving pancreatic β-cell differentiation defects, increasing the number of pancreatic β-cells, and enhancing insulin secretion capacity. IKK inhibitors can also improve pancreatic islet cell immunogenicity abnormalities, and hold promise for use in the development of drugs for the treatment of type 1 diabetes.

Claims

1. Application of IKK inhibitors in the preparation of drugs to restore pancreatic islet function.

2. The application as described in claim 1, characterized in that... The IKK inhibitor is either BMS-345541 or Amlexanox.

3. The application as described in claim 1, characterized in that... The restoration of pancreatic islet function includes improving pancreatic β-cell differentiation defects, increasing the number of pancreatic β-cells, and improving insulin secretion capacity.

4. Application of IKK inhibitors in the preparation of drugs that improve abnormal immunogenicity of pancreatic islet cells.

5. Application of IKK inhibitors in the preparation of drugs for treating type 1 diabetes.

6. Application of IKK inhibitors in the preparation of formulations that promote the differentiation of human pluripotent stem cells into pancreatic islet cells.

7. Application of IKK inhibitors in the preparation of formulations that promote the differentiation of human expandable pancreatic islet precursor cells into islet cells.

8. A drug for restoring pancreatic function, comprising the IKK inhibitor.

9. A medicine for treating type 1 diabetes, comprising the IKK inhibitor.

Images