Method for preparing wine, fermentation broth of hansenula polymorpha xy-hops 01 and fermented rice bran
By treating rice bran with Hansenula spores XY-Hops 01 fermentation broth, the problem of high phytic acid content in rice bran was solved, realizing the high added value utilization of rice bran and enhancing its application value in food.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
- Filing Date
- 2026-05-12
- Publication Date
- 2026-06-09
AI Technical Summary
Rice bran has a high phytic acid content, which gives it a strong bran flavor during food processing, affecting its edibility and processing. At the same time, its low added value limits the development of its industry.
Rice bran was fermented using Hansenula polysaccharide XY-Hops 01 fermentation culture. By controlling fermentation conditions such as temperature and time, the phytic acid content in the rice bran was significantly reduced, while the content of oryzanol and free phenols was increased, thus improving the flavor quality.
Fermented rice bran exhibits significantly reduced phytic acid content, significantly increased levels of oryzanol and free phenols, enhanced anti-enteritis activity, improved flavor and quality, and great market potential.
Smart Images
Figure CN122168430A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of health food and its production technology, specifically to a method for preparing Hansenula polysaccharide XY-Hops 01 for wine, fermentation liquid, and fermented rice bran. Background Technology
[0002] Rice bran is rich in various bioactive components, such as oryzanol, phytosterols, polysaccharides, B vitamins, and minerals such as phosphorus, magnesium, potassium, iron, and zinc. Currently, rice bran is mainly used as animal feed. Processing it into food would not only be a highly efficient use of resources but also generate significant economic benefits. However, rice bran has a strong bran flavor, which seriously affects its edibility and processing. In addition, rice bran contains a large amount of the anti-nutritional factor phytic acid, which needs to be removed or converted.
[0003] In addition, low added value is another bottleneck restricting the development of the rice bran industry. Enhancing the health benefits of the product is one of the effective ways to increase its added value. Summary of the Invention
[0004] The purpose of this invention is to overcome the above-mentioned technical deficiencies and provide a method for preparing Hansenula polysaccharide XY-Hops01 for winemaking, fermentation liquid and fermented rice bran, thereby solving the technical problem of how to reduce the phytic acid content of rice bran in the prior art.
[0005] To achieve the above-mentioned technical objectives, the present invention provides a wine yeast XY-Hops01, which is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC NO 68040.
[0006] In any implementation, its ITS sequence is as shown in SEQ ID NO: 1.
[0007] In addition, the present invention also proposes a fermentation broth obtained by culturing the above-mentioned wine yeast XY-Hops 01 in a liquid culture medium.
[0008] In any embodiment, the liquid culture medium comprises 5-10 g / L potato extract powder and 15-30 g / L glucose.
[0009] In any embodiment, the culture temperature is 20-30°C, and the culture time is 36-72 h.
[0010] Furthermore, the present invention also proposes the application of the above-mentioned wine-producing Hansenula polysaccharide XY-Hops 01 or the above-mentioned fermentation liquid in the preparation of fermented rice bran.
[0011] In addition, the present invention also proposes a method for preparing fermented rice bran, comprising: adding the above-mentioned fermentation liquid to rice bran, and then keeping it warm for fermentation to obtain the fermented rice bran.
[0012] In any embodiment, the amount of fermentation liquid added to the rice bran is 1-5% (v / w).
[0013] In any embodiment, the temperature for the heat preservation fermentation is 15~30℃.
[0014] In any embodiment, the fermentation time is 24-72 h.
[0015] Compared with existing technologies, the beneficial effects of this invention include: In its research on anti-enteritis foods and probiotics, the applicant, based on a fruit fly enteritis model, screened a strain of *Hanseniaspora uvarum* XY-Hops 01 (deposited on April 3, 2026, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO 68040) from naturally fermented hops that can enhance the anti-fruit fly enteritis activity of rice bran. Analysis shows that fermentation with *Hanseniaspora uvarum* XY-Hops 01 significantly reduces phytic acid content, significantly increases oryzanol content, significantly increases free phenol content, essentially eliminates the rice bran flavor, and significantly improves flavor quality; furthermore, the fermented rice bran exhibits excellent anti-enteritis activity.
[0016] The preparation method of this invention is simple, and *Hansenula polymorpha*, a common microorganism in traditional fermented foods, is safe. The fermented rice bran produced by this method exhibits excellent anti-enteritis activity and is of high value. Compared with raw rice bran, the fermented rice bran of this invention shows an increase of >20% in free phenol content, >100% in γ-oryzanol content, a decrease of >85% in phytic acid content, and an increase of >500% in the inhibition rate of Drosophila enteritis. The content of typical anti-inflammatory small molecules such as kaempferol, ethyl ferulic acid, 4'-methoxybaicalein, sinapic acid, cysteine, pamoate B, and 3-phenyllactic acid is increased by more than 10 times. The preparation method of this invention has strong market development potential. Attached Figure Description
[0017] Figure 1 These are photographs of fruit flies used in the embodiments and comparative examples of this invention. The left image shows fruit flies without enteritis, and the right image shows fruit flies with enteritis.
[0018] Figure 2 These are photographs of the fermented rice bran prepared in the embodiments and comparative examples of the present invention. Detailed Implementation
[0019] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60~120 and 80~110 are listed for a specific parameter, it is also expected that ranges of 60~110 and 80~120 are also included. Furthermore, if minimum range values of 1 and 2 are listed, and if maximum range values of 3, 4, and 5 are listed, then the following ranges are all expected: 1~3, 1~4, 1~5, 2~3, 2~4, and 2~5. In this application, unless otherwise stated, the numerical range "a~b" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0~5" indicates that all real numbers between "0~5" have been listed in this article; "0~5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.
[0020] Unless otherwise specified, the terms "comprising" and "including" as used in this application can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other components not listed may also be included, or that only the listed components may be included.
[0021] Unless otherwise specified, the term "or" is inclusive in this application. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, the condition "A or B" is satisfied by any of the following conditions: A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).
[0022] This specific embodiment provides a wine yeast *Hanseniaspora uvarum* XY-Hops 01, deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO 68040. Its ITS sequence is shown in SEQ ID NO: 1.
[0023] This specific embodiment also proposes a fermentation broth, which is obtained by culturing the above-mentioned Hansenula polysaccharide XY-Hops 01 in a liquid culture medium; the liquid culture medium includes 5-10 g / L potato extract powder and 15-30 g / L glucose; the culture temperature is 20-30℃ and the culture time is 36-72 h.
[0024] This specific embodiment also proposes the application of the above-mentioned wine-producing Hansenula polysaccharide XY-Hops 01 or the above-mentioned fermentation liquid in the preparation of fermented rice bran.
[0025] This specific embodiment also proposes a method for preparing fermented rice bran, comprising: adding the above-mentioned fermentation liquid to rice bran, and then keeping it warm for fermentation to obtain the fermented rice bran; the amount of fermentation liquid added to the rice bran is 1~5% (v / w), the temperature of the warm fermentation is 15~30℃, and the warm fermentation time is 24~72 h.
[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0027] In this invention, the terms "some embodiments," "this embodiment," and examples are used to describe a subset of all possible embodiments. However, it is understood that "some embodiments" can be the same subset or different subsets of all possible embodiments and can be combined with each other without conflict.
[0028] If the application documents contain similar descriptions such as "first / second", the following explanation shall be added: In the following description, the terms "first / second / third" are used only to distinguish similar objects and do not represent a specific ordering of objects. It is understood that "first / second / third" may be interchanged in a specific order or sequence where permitted, so that the embodiments described herein can be implemented in an order other than that illustrated or described herein.
[0029] In this embodiment, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, object A and / or object B can represent three situations: object A exists alone, object A and object B exist simultaneously, and object B exists alone.
[0030] The following describes embodiments of this application. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.
[0031] The methods for determining various indicators of fermented rice bran and raw rice bran samples in each embodiment are as follows:
[0032] 1. Determination of free phenol content in rice bran and fermented rice bran.
[0033] Free phenol extraction: Weigh 2.5 g of sample, add 30 mL of 70% ethanol, sonicate at 40℃ for 30 min, centrifuge at 8000 r / min for 10 min, and take the supernatant to make up to 25 mL.
[0034] The content of phenolic substances was determined using the Folin-Ciocalteu method. Take 1 mL of polyphenol extract and 1 mL of Folin-Ciocalteu reagent diluted 5 times, add 2 mL of 15% sodium carbonate solution, and bring the volume to 10 mL. Incubate in the dark for 2 h, using 1 mL of distilled water as a blank, and measure the absorbance at 760 nm. Gallic acid was used as a standard, and quantification was performed using the external standard method.
[0035] 2. Determination of γ-oryzanol content in rice bran and fermented rice bran.
[0036] The γ-oryzanol content was determined according to LS / T 6121.1—2017 "Determination of oryzanol Content in Vegetable Oils by Spectrophotometry". The specific procedure was as follows: 0.10 g of rice bran sample was accurately weighed, dissolved in n-heptane, and brought to a final volume of 50 mL. After mixing, the sample was transferred to a centrifuge tube and magnetically stirred at 200 r / min for 1 h at room temperature. Subsequently, the sample was centrifuged at 6000 r / min for 5 min. The supernatant was filtered through a 0.22 µm organic phase microporous membrane to obtain the oryzanol extract. The absorbance was measured at 315 nm. Quantification was performed using the external standard method.
[0037] 3. Phytic acid content determination: Phytic acid content was determined using the Solarbio BC5840 phytic acid content detection kit.
[0038] 4. Determination of the inhibition rate of enteritis in fruit flies.
[0039] The inhibitory rate of rice bran and fermented rice bran on enteritis was determined using the Drosophila melanogaster model. The experimental protocol was based on that of Lin Xin (Lin Xin, Li Yang, Zhan Miao, et al. Metabolite composition and anti-inflammatory activity of Camellia oleifera seed ethanol extract [J]. Food Science, 2023, 44(2): 304-311). Twenty adult Drosophila melanogaster with vestigial wings were selected and placed in empty culture tubes for 2 h. Drosophila culture tubes lined with filter paper were prepared. The model group was fed with 0.1 mL of 5% DSS (sodium dextran sulfate) solution, 0.1 mL of 2.5% edible brilliant blue dye, and 0.1 mL of 5% sucrose solution for 16 h. (DSS causes enteritis in Drosophila melanogaster, especially damaging the intestinal barrier. Brilliant blue leaks into the entire body of the fly. Drosophila without enteritis only show blue in the digestive tract, while those with enteritis have their entire abdomen turned blue, hence the name "blue elves".) Figure 1The sample treatment group, in addition to the additives in the model group, also received 0.1 g of rice bran or fermented rice bran. After feeding for 16 h, the number of "Blue Elf" fruit flies was measured, and the enteritis inhibition rate was calculated. The drug control group used 0.1 mL of sulfasalazine (0.2 mg / mL) instead of rice bran or fermented rice bran. The blank group used 0.1 mL of distilled water instead of rice bran or fermented rice bran. The inhibition rates of rice bran and fermented rice bran on fruit fly enteritis were calculated using the following formula:
[0040] ×100
[0041] I represents the Drosophila enteritis inhibition rate, expressed as %; A1 represents the proportion of blue flies in the sample group, and A2 represents the proportion of blue flies in the blank group. Six parallel determinations were performed.
[0042] 5. UPLC-MS analysis of small molecules in rice bran and fermented rice bran
[0043] The rice bran sample was freeze-dried, and 25 mg of the solid sample was weighed into an EP tube at low temperature. 1000 μL of extraction buffer (methanol:water = 3:1, v / v, containing internal standard) was added. After vortexing for 30 s, homogenization was performed at 40 Hz for 4 min, followed by sonication in an ice-water bath for 5 min. The homogenization and sonication were repeated 3 times. After incubation at 4°C overnight, the sample was centrifuged at 12000 rpm for 15 min at 4°C. The supernatant was filtered through a 0.22 μm filter membrane and collected into a 2 mL sample vial for analysis using ultra-high performance liquid chromatography-mass spectrometry.
[0044] A Vanquish ultra-high performance liquid chromatograph was configured with a Waters ACQUITY UPLC BEH Amide column (2.1 mm × 50 mm, 1.7 μm). The mobile phase consisted of phase A (0.01% acetic acid aqueous solution) and phase B (50% acetonitrile / isopropanol). The flow rate was 0.3 mL / min. The column oven temperature was 25°C, the sample tray temperature was 4°C, and the injection volume was set to 2 μL. A Stellar quadrupole linear ion trap mass spectrometer equipped with heated electrospray ionization (H-ESI) was used for mass spectrometry analysis in parallel reaction monitoring (PRM) mode. Standard mass spectral library comparisons were used to qualitatively identify anti-inflammatory small molecules such as kaempferol, ethyl ferulic acid, 4'-methoxybaicalein, sinapic acid, cysteine, pamoate B, and 3-phenyllactic acid. The relative content of each anti-inflammatory small molecule was characterized by the peak area of the UPLC-MS ion chromatogram.
[0045] The raw material, rice bran (fresh rice bran), contained 153 mg / 100 g of free phenols, 350 mg / 100 g of γ-oryzanol, 57.86 mg / g of phytic acid, and had an inhibition rate of 10.94% against enteritis in fruit flies (61.54% in the sulfasalazine group).
[0046] Product illustrations for each embodiment and comparative example are shown below. Figure 2 .
[0047] Example 1
[0048] This embodiment provides the screening, isolation, and identification of Hansenula polysaccharide in wine.
[0049] 1. Screening and isolation process of strains
[0050] Weigh 5.00 g of hops and add them aseptically to a conical flask containing 45.0 mL of sterile physiological saline. Shake the flask for 10 min to ensure uniform distribution of microorganisms in the sample. Let it stand for 2 days, then extract the supernatant and add sterile water in a gradient of 10. -4 10 -5 10 -6 Dilute the sample and spread 0.2 mL onto PDA medium, with three plates for each gradient as parallel controls. Incubate at 28°C inverted for 2 days. After colonies have grown, select strains of different morphologies and repeatedly streak them to obtain single colonies to purify the strains. Inoculate the purified strains onto test tube slant and store at 4°C for later use.
[0051] PDA liquid medium: 6 g / L potato extract powder, 20 g / L glucose, pH 5.6±0.2, add water to 1 L, sterilize at 121°C for 15 min.
[0052] Colonies from the culture slant were inoculated into PDA liquid medium and cultured at 28℃ and 120 r / min for 48 h to obtain bacterial suspension. The suspension was then centrifuged at 8000 r / min, 4℃ for 15 min, and the precipitate was collected as fresh bacterial cells. The OD value of the fresh bacterial cells was measured at 600 nm using a UV-Vis spectrophotometer. 1 mL of cells with OD600=1 were then washed twice with PDA and resuspended in 100 μL of 5% sucrose solution. The cells were fed to *Drosophila melanogaster* ("Blue Elf") to determine the inhibition rate of enteritis. A strain with good inhibitory activity against enteritis was obtained and named XY-Hops 01.
[0053] 2. Strain identification
[0054] The strains with high anti-inflammatory activity were given to Shanghai Sangon Biotech Co., Ltd. to extract genomic DNA for sequencing.
[0055] ITS was amplified and sequenced using the universal fungal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (3'-TCCGTAGGTGAACCTGCGG-5').
[0056] The ITS sequence obtained by XY-Hops 01 is shown in SEQ ID NO: 1, as follows:
[0057] ACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGGTACTTTCAGTGCCCGAGTTGTAATTTGTAGAATTTGTCTTTGATTAGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTTTG GCGAGGATACCTTTTCTCTGTAAGACTTTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAA AAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTTTGCATGCACTCGCCTCTCGTGGGCTTGGGCCTCTCAAAAATTTCACTGGGCCAACATCAATTCTG GCAGCAGGATAAATCATTAAGAATGTAGCTACTTCGGTAGTGTTATAGCTTTTTGGAATACTGTTAGCCGGGATTGAGGACTGCGCTTCGGCAAGGATGTTGGCATAATGGTTAAATGCCGCCCGTCTTGAAACAACGGACA
[0058] The sequencing results were submitted to the GenBank database in NCBI. Similarity analysis was performed using Blast and known sequences. Based on the sequence analysis results, strain XY-Hops 01 was identified as Hanseniasporauvarum.
[0059] The wine contains Hansenula polymorpha XY-Hops 01, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on April 3, 2026, with accession number GDMCC 68040.
[0060] Example 2
[0061] This embodiment provides a fermentation broth, which is obtained by culturing the wine yeast XY-Hops01 screened in Example 1 in a liquid culture medium; the liquid culture medium includes 10 g / L potato extract powder and 16 g / L glucose, and is sterilized at 121℃ for 15 min, and cultured at 28℃ for 48 h.
[0062] This embodiment also proposes a method for preparing fermented rice bran, including the following steps:
[0063] 1. Wash fresh rice bran and then sterilize it at 121℃ for 15 minutes.
[0064] 2. The fermentation broth of this example was inoculated into sterilized rice bran at an inoculation amount of 2% (v / w), and fermented at 25°C for 48 h. Then it was dried at 55°C to obtain fermented rice bran.
[0065] The fermented rice bran obtained in this example had a free phenol content of 187 mg / 100g, a γ-oryzanol content of 702 mg / 100g, a phytic acid content of 8.37 mg / g, and a fruit fly enteritis inhibition rate of 72.83% (compared to 61.54% in the sulfasalazine group).
[0066] Example 3
[0067] This embodiment provides a fermentation broth, which is obtained by culturing the wine yeast XY-Hops01 screened in Example 1 in a liquid culture medium; the liquid culture medium includes 10 g / L potato extract powder and 18 g / L glucose, and is sterilized at 121℃ for 15 min, and cultured at 25℃ for 60 h.
[0068] This embodiment also proposes a method for preparing fermented rice bran, including the following steps:
[0069] 1. Wash fresh rice bran and then sterilize it at 121℃ for 15 minutes.
[0070] 2. The fermentation broth of this example was inoculated into sterilized rice bran at an inoculation amount of 3% (v / w), and fermented at 20°C for 72 h. After that, it was dried at 60°C to obtain fermented rice bran.
[0071] The fermented rice bran obtained in this example had a free phenol content of 191 mg / 100g, a γ-oryzanol content of 712 mg / 100g, a phytic acid content of 8.15 mg / g, and a fruit fly enteritis inhibition rate of 73.55% (compared to 61.54% in the sulfasalazine group).
[0072] Example 4
[0073] This embodiment provides a fermentation broth obtained by culturing the wine yeast XY-Hops01 screened in Example 1 in a liquid culture medium; the liquid culture medium includes 8 g / L potato extract powder and 20 g / L glucose, and is sterilized at 121℃ for 15 min, and cultured at 30℃ for 40 h.
[0074] This embodiment also proposes a method for preparing fermented rice bran, including the following steps:
[0075] 1. Wash fresh rice bran and then sterilize it at 121℃ for 15 minutes.
[0076] 2. The fermentation broth of this example was inoculated into sterilized rice bran at an inoculation amount of 5% (v / w), and fermented at 30°C for 24 h. Then it was dried at 50°C to obtain fermented rice bran.
[0077] The fermented rice bran obtained in this example had a free phenol content of 180 mg / 100g, a γ-oryzanol content of 690 mg / 100g, a phytic acid content of 9.08 mg / g, and an inhibition rate of 70.17% against enteritis in fruit flies (compared to 61.54% in the sulfasalazine group).
[0078] Comparative Example 1
[0079] This comparative example presents a brewer's yeast culture, obtained by culturing Saccharomyces cerevisiae in a liquid culture medium. The liquid culture medium consists of 6 g / L potato extract powder and 20 g / L glucose, and is sterilized at 121℃ for 15 min. The culture conditions are 28℃ for 48 h.
[0080] This comparative example also proposes a method for preparing fermented rice bran, including the following steps:
[0081] 1. Wash fresh rice bran and then sterilize it at 121℃ for 15 minutes.
[0082] 2. The brewer's yeast liquid from this comparative example was inoculated into sterilized rice bran at an inoculation amount of 2% (v / w), and fermented at 25°C for 48 h. After that, it was dried at 55°C to obtain fermented rice bran.
[0083] The free phenol content of rice bran obtained by Saccharomyces cerevisiae in this comparative example was 164 mg / 100g, the γ-oryzanol content was 415 mg / 100g, the phytic acid content was 40.89 mg / g, and the inhibition rate of Drosophila enteritis was 26.58% (61.54% in the sulfasalazine group).
[0084] In addition, the relative contents of typical anti-inflammatory polyphenolic compounds in rice bran treated in the examples and comparative examples were measured (based on the peak area of UPLC-MS ion chromatograms), and the relevant data are shown in Tables 1, 2 and 3.
[0085] Table 1. Content of key components and enteritis inhibition rate in rice bran after raw materials, examples, and comparative treatments.
[0086]
[0087] Table 2. Relative contents of typical anti-inflammatory polyphenolic compounds in rice bran after raw material and example / comparative treatment (based on UPLC-MS ion chromatogram peak area).
[0088]
[0089] Table 3. Relative contents of typical anti-inflammatory polyphenolic compounds in rice bran after raw material and example / comparative treatment (based on peak area of UPLC-MS ion chromatogram).
[0090]
[0091] As can be seen from Tables 1-3, the fermented rice bran prepared in Examples 2-4 showed an increase of >20% in free phenol content, >100% in γ-oryzanol content, >85% in phytic acid content, and >500% in the inhibition rate of fruit fly enteritis. The content of typical anti-inflammatory small molecules such as kaempferol, ethyl ferulic acid, 4'-methoxybaicalein, sinapic acid, cysteine, pamoate B, and 3-phenyllactic acid increased by more than 10 times, and was significantly better than the fermented rice bran prepared by Saccharomyces cerevisiae in Comparative Example 1.
[0092] The specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A wine containing Hansenula polymorpha XY-Hops 01, characterized in that, It is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC NO 68040.
2. The wine yeast XY-Hops 01 according to claim 1, characterized in that, Its ITS sequence is shown in SEQ ID NO:
1.
3. A fermentation broth, characterized in that, It was obtained by culturing the wine-producing Hansenula polymorpha XY-Hops 01 according to any one of claims 1-2 in a liquid culture medium.
4. The fermentation broth according to claim 3, characterized in that, The liquid culture medium includes 5-10 g / L potato extract powder and 15-30 g / L glucose.
5. The fermentation broth according to claim 3, characterized in that, The culture temperature is 20-30℃, and the culture time is 36-72 h.
6. The use of the wine yeast XY-Hops 01 according to any one of claims 1-2 or the fermentation liquid according to any one of claims 3-5 in the preparation of fermented rice bran.
7. A method for preparing fermented rice bran, characterized in that, include: The fermented rice bran is obtained by adding the fermentation liquid of any one of claims 3-5 to rice bran and then keeping it warm for fermentation.
8. The method for preparing fermented rice bran according to claim 7, characterized in that, The amount of fermentation bacteria added to the rice bran is 1-5% (v / w).
9. The method for preparing fermented rice bran according to claim 7, characterized in that, The temperature for the heat preservation fermentation is 15~30℃.
10. The method for preparing fermented rice bran according to claim 9, characterized in that, The fermentation time is 24-72 hours.