Salt-tolerant and flavor-enhancing strain of staphylococcus carnosus wq-4 and its application

By developing the salt-tolerant and flavor-enhancing biogenic amine-degrading strain Staphylococcus aureus WQ-4, the problem of biogenic amine control in high-salt fermented foods has been solved, achieving effective degradation of biogenic amines and enhancing flavor, thus meeting the production needs of fermented foods such as soy sauce.

CN122168481APending Publication Date: 2026-06-09CHANGSHA UNIVERSITY OF SCIENCE AND TECHNOLOGY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHANGSHA UNIVERSITY OF SCIENCE AND TECHNOLOGY
Filing Date
2026-04-27
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing technologies lack microbial strains that can effectively degrade biogenic amines in high-salt environments and enhance flavor, especially in fermented foods such as soy sauce, where traditional control methods pose safety risks or damage to quality.

Method used

A salt-tolerant, flavor-enhancing, biogenic amine-degrading strain, Staphylococcus carnosus WQ-4, was provided. It exhibits high salt, heat, acid, and bile salt tolerance, and can effectively degrade common biogenic amines in fermented foods, such as histamine and tyramine, thereby increasing the quantity and variety of flavor compounds.

Benefits of technology

Staphylococcus aureus WQ-4 significantly degrades biogenic amines in fermented foods such as soy sauce, with degradation rates of 55.12% and 81.47%, respectively. It also increases the quantity and variety of flavor compounds, adapts to high-salt, heat-resistant, and acid-resistant environments, and is safe for food.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168481A_ABST
    Figure CN122168481A_ABST
Patent Text Reader

Abstract

The application discloses a salt-tolerant flavor-enhancing biological amine degradation strain Staphylococcus carnosus WQ-4 and application thereof, and belongs to the technical field of biological fermentation. The Staphylococcus carnosus WQ-4 has been preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20251802. The strain has good salt tolerance and biological amine degradation capacity, has obvious degradation effect on histamine and tyramine which are common biological amines in fermented food, the degradation rates are 55.12% and 81.47% respectively, and has good stability, safety and flavor-enhancing effect in a soy sauce fermentation environment, and can be used for soy sauce brewing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bio-fermentation technology, and more specifically to a salt-tolerant, flavor-enhancing, bio-amine-degrading strain of Staphylococcus aureus WQ-4 and its applications. Background Technology

[0002] Biogenic amines, nitrogenous compounds produced by amino acid decarboxylase-positive bacteria in fermented foods, pose a significant threat to human health if accumulated in excess. For example, histamine can trigger allergic reactions by activating H1 / H2 receptors, and tyramine can inhibit monoamine oxidase, leading to abnormal blood pressure. International standards impose strict limits on their content (e.g., the EU stipulates histamine ≤100 mg / kg). Traditional control methods, such as chemical inhibitors or high-temperature treatments, pose safety risks or quality damage. Therefore, green technologies utilizing microbial degradation of biogenic amines have become a research focus.

[0003] Staphylococcus aureus ( Staphylococcus carnosus As a dominant symbiotic bacterium in fermented foods, it exhibits unique potential for biogenic amine degradation. Its core mechanism relies on the secretion of monoamine oxidase (MAO), diamine oxidase (DAO), and polyamine oxidase (PAO) to convert biogenic amines into aldehydes, ammonia, and hydrogen peroxide through oxidation reactions.

[0004] For the specific needs of high-salt fermented foods (such as soy sauce, fish sauce, and shrimp paste, with salt concentrations of 15%–25%), the development of salt-tolerant microorganisms has become a key area for technological breakthroughs. Salt-tolerant strains adapt to hyperosmotic environments through multiple mechanisms. However, there are currently few reports on biogenic amine-degrading strains with salt-tolerant flavor-enhancing properties for high-salt foods.

[0005] Therefore, how to provide a biodegrading strain with high salt tolerance and flavor-enhancing properties is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a salt-tolerant, flavor-enhancing, bio-amine-degrading strain of Staphylococcus aureus WQ-4 and its applications.

[0007] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0008] A salt-tolerant, flavor-enhancing, biodegrading amine strain, named WQ-4, is classified as follows: Staphylococcus carnosus It was deposited on August 8, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20251802, and the deposit address is Wuhan University, Wuhan, China.

[0009] A microbial inoculant comprising the strains described above.

[0010] The above-mentioned strains are used in the preparation of salt-tolerant preparations, wherein the concentration of NaCl in the salt-tolerant preparation does not exceed 18%.

[0011] The above-mentioned strains are used in the preparation of heat-resistant preparations, wherein the heat resistance temperature does not exceed 55°C.

[0012] The above-mentioned strains are used in the preparation of acid-resistant preparations, wherein the pH range of acid resistance is 5.0 to 7.0.

[0013] The application of the above-mentioned strains in the preparation of bile salt-tolerant preparations.

[0014] The application of the above-mentioned strains in the degradation of biogenic amines.

[0015] Furthermore, the biogenic amine is histamine or tyramine.

[0016] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: The *Staphylococcus aureus* WQ-4 provided by this invention is a harmless bacterium in the fermentation process of soy sauce mash. It has a significant degradation effect on histamine and tyramine, two common biogenic amines found in fermented foods, with degradation rates of 55.12% and 81.47%, respectively. It can be used to control the content of biogenic amines in the production of soy sauce and other fermented foods. Furthermore, the amount of flavor compounds in the fermented soy sauce mash produced by *Staphylococcus aureus* WQ-4 is 106.19% higher than that of the control, and the content is 555.94% higher, with a greater diversity of flavor compounds. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 The image shows the morphological identification results of strain WQ-4 in Example 1 of this invention, where the left image shows the colony morphology and the right image shows the Gram staining results. Figure 2 The results of the hemolytic activity test in Example 1 of this invention; Figure 3 This is the phylogenetic tree of strain WQ-4 in Example 1 of the present invention; Figure 4 This is an annotation of the whole genome of strain WQ-4 in Example 1 of the present invention using the NT database; Figure 5 This describes the metabolic pathway of Staphylococcus aureus WQ-4 in Example 8 of the present invention. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Prepare the biogenic amine solid culture medium: 2.0 g potassium dihydrogen phosphate, 2.0 g diammonium citrate, 80.0 g sodium chloride, 0.4 g magnesium sulfate, 0.03 g manganese sulfate, 0.04 g ferrous sulfate, 0.01 g thiamine (vitamin B1), 2.0 g glucose, 100 mg histamine dihydrochloride, 100 mg tyramine hydrochloride, 20.0 g agar, and bring the volume to 1 L with deionized water. Adjust the pH to 5.5.

[0021] Prepare the modified MRS medium: 10.0 g peptone, 10.0 g beef extract, 20.0 g glucose, 5.0 g yeast extract, 40 g sodium chloride, 2.0 g diammonium hydrogen citrate, 2.0 g dipotassium hydrogen phosphate, 5.0 g sodium acetate, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 1 mL Tween-80, and deionized water to a final volume of 1 L. Adjust the pH to 7.0-7.2.

[0022] Prepare modified MRS medium containing biogenic amines: 10.0 g peptone, 10.0 g beef extract, 20.0 g glucose, 5.0 g yeast extract, 40 g sodium chloride, 2.0 g diammonium citrate, 2.0 g dipotassium hydrogen phosphate, 5.0 g sodium acetate, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, 100 mg histamine dihydrochloride, 100 mg tyramine hydrochloride, 1 mL Tween-80, and bring the volume to 1 L with deionized water. Adjust the pH to 7.0-7.2.

[0023] Determination of biogenic amine content: The determination is performed using liquid chromatography. For specific procedures, please refer to GB5009.208—2016.

[0024] Activation method of the strain: Inoculate the strain into the culture medium at an inoculation rate of 30 mL / L and incubate at 30℃ for 16 h.

[0025] Example 1 Screening, identification and preservation of biogenic amine-degrading strains (1) Initial screening of bioamine-degrading strains 10 mL of fermented soy sauce mash from a soy sauce factory in Changsha, Hunan Province, at different fermentation stages was measured and added to an Erlenmeyer flask containing 90 mL of sterile physiological saline to prepare a dilution of 10. -1The fermented soybean paste suspension was incubated at 30℃ and 120 r / min for 30 min. 1 mL of the fermented soybean paste suspension was added to 9 mL of sterile physiological saline, and the mixture was prepared in a 10-fold gradient to obtain 10... -2 Up to 10 -5 Gradient concentrations. For each gradient, 200 μL of suspension was spread onto a biogenic amine solid medium and incubated at 30°C. Once the colonies showed good growth, the initial screening strains were obtained.

[0026] (2) Secondary screening of bioamine-degrading strains Single colonies isolated from biogenic amine solid medium were activated in modified MRS medium, with the initial OD value adjusted to 1. Inoculation was performed at a rate of 30 mL / L in modified biogenic amine-containing MRS medium, and the culture was incubated at 30°C with shaking at 120 rpm for 72 h. The supernatant was obtained by centrifugation at 4000×g for 5 min, filtered through a 0.22 μm aqueous filter, and 1 mL was transferred to a 10 mL centrifuge tube. 250 μL of internal standard 1,7-diaminoheptane solution (100 mg / L), 1 mL of saturated sodium bicarbonate solution, 100 μL of sodium hydroxide solution (1 mol / L), and 1 mL of derivatizing reagent—10 mg / mL dansyl chloride solution—were added sequentially. The mixture was vortexed and incubated in a 60°C water bath for 15 min. After derivatization, 100 μL of sodium glutamate solution (50 mg / mL) was added, and the mixture was shaken and incubated at 60°C for 15 min. After cooling to room temperature, add 1 mL of ultrapure water to each centrifuge tube, vortex for 1 min, remove acetone (approximately 1 mL) by nitrogen blowing under a 40°C water bath, add 0.5 g of sodium chloride and vortex until completely dissolved, then add 3 mL of diethyl ether for extraction of biogenic amines, vortex for 2 min, allow to stand for separation, carefully aspirate the supernatant into a 10 mL centrifuge tube, extract the lower layer again, combine the two ether extracts, and dry under nitrogen blowing under a 40°C water bath. Dissolve the residue in the tube with 1 mL of acetonitrile, filter through a 0.22 μm organic filter membrane, and then analyze the biogenic amine content using liquid chromatography. Compare with the blank group to determine the degradation rate of biogenic amines. The strain with the higher biogenic amine degradation rate is the secondary screening strain. The strain with the highest degradation rate is named WQ-4. As shown in Table 1, the degradation rates of histamine and tyramine by strain WQ-4 are 55.12% and 81.47%, respectively.

[0027] Table 1 Comparison of the degradation abilities of different strains of histamine and tyramine

[0028] (3) Identification of strain WQ-4 (31) Morphological identification On MRS plates, colonies appear as white or milky white colonies with a smooth, opaque surface, a slightly raised center, and rounded edges, giving the entire colony a dot-like appearance. Figure 1 Left). Gram staining result was positive ( Figure 1 right).

[0029] (32) Physiological and biochemical identification and safety characteristics ① Physiological and biochemical tests were performed on strain WQ-4 according to the "Manual of Systematic Identification of Common Bacteria" and "Bergey's Manual of Bacterial Identification" for preliminary identification. Acid production from sugar fermentation was marked as "+" for positive results and "-" for negative results. Escherichia coli was used as a positive control strain for the methyl red and indole tests.

[0030] ② The hemolytic activity of strain WQ-4, derived from fermented soybean paste, was tested using 5% sheep blood agar solid medium; Staphylococcus aureus ( Staphylococcus aureus As a positive control for β-hemolysis, *Escherichia coli* (E. coli) Escherichia coli As a positive control for α-hemolysis, *Saccharomyces cerevisiae* (Saccharomyces cerevisiae) Saccharomyces cerevisiae () as a positive control for γ-hemolysis.

[0031] ③ Conduct a safety assessment in conjunction with the indole test.

[0032] The results are shown in Table 2. Figure 2 As shown.

[0033] Table 2 Physiological and biochemical tests and assessment of harmful metabolites

[0034] As shown in Table 2, strain WQ-4 tested negative in the indole test, indicating that this strain lacks the ability to produce tryptophanase and therefore cannot break down tryptophan to generate indole. In the hemolytic activity test, *Escherichia coli* (… Escherichia coli As a positive control for α-hemolysis, Staphylococcus aureus ( Staphylococcus aureu s) as a positive control for β-hemolysis, Saccharomyces cerevisiae ( Saccharomyces cerevisiae As a positive control for γ-hemolysis, safety was assessed using an indole test. The results of the hemolysis test are shown below. Figure 2 According to Table 2, strain WQ-4 did not show a grass-green or transparent zone, which indicates γ-hemolysis, meaning it does not have hemolytic properties and is a food-safe strain.

[0035] (33) Molecular biological identification Genomic DNA was extracted from strain WQ-4 and amplified by 16S rDNA PCR using primers (27F: 5'AGAGTTTGATCCTGGCTCAG3', SEQ ID No. 1; 1492R: 5'TACGGCTACCTTGTTACGACTT3', SEQ ID No. 2).

[0036] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55.5℃ annealing for 30 s, 72℃ extension for 90 s, for a total of 30 cycles; and a final extension at 72℃ for 10 min.

[0037] The obtained PCR products were purified and sequenced. The sequencing results are as follows:

[0038] The obtained sequences were BLAST aligned to the NCBI database. Phylogenetic analysis based on the 16S rDNA sequencing alignment results showed that it is most closely related to Staphylococcus aureus. Figure 3 ).

[0039] Therefore, combining the annotation of the whole genome NT database ( Figure 4 Based on the results of 16S rDNA identification, strain WQ-4 was identified as... Staphylococcus carnosus .

[0040] (4) Preservation Staphylococcus fleshyus WQ-4, its classification name is Staphylococcus carnosus It was deposited on August 8, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251802, and the deposit address is Wuhan University, Wuhan, China.

[0041] Example 2 Amine-reducing capacity of the simulation system Single colonies of Staphylococcus aureus WQ-4 were activated in modified MRS medium, with the initial OD value adjusted to 1. The culture was then inoculated at a rate of 30 mL / L into modified MRS medium containing eight biogenic amines and cultured at 30°C with shaking at 120 rpm for 72 h. The supernatant was obtained by centrifugation at 4000×g for 5 min, filtered through a 0.22 μm aqueous filter, and 1 mL was transferred to a 10 mL centrifuge tube. Derivatization was performed using the same method as in Example 1 to determine the degradation rate of the strain against eight common biogenic amines found in fermented foods.

[0042] Table 3. Degradation capacity of Staphylococcus aureus WQ-4 for 8 biogenic amines

[0043] The results are shown in Table 3. Staphylococcus aureus WQ-4 can effectively reduce the content of eight major harmful biogenic amines. Its degradation rates for tryptamine, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine are 36.2980%, 34.5437%, 22.9774%, 28.0802%, 17.0435%, 8.1116%, 27.7422%, and 16.7758%, respectively. The above results show that Staphylococcus aureus WQ-4 has a good biogenic amine degradation effect.

[0044] Example 3 Preparation of soy sauce mash using Staphylococcus aureus WQ-4 Take 500 mL of fermented soy sauce mash with a salt content of 160 g / L and pH 4.88 after 90 days of fermentation. Activate Staphylococcus aureus WQ-4 in modified MRS medium, adjust the initial OD value to 1, and inoculate it into the fermented soy sauce mash at an inoculation rate of 25 mL / 500 mL, so that the bacterial concentration in the soy sauce mash is 10. 7 The concentration of CFU / g was used as a control, with fermented mash without Staphylococcus aureus WQ-4 inoculation as a reference. The mash was statically fermented at 37°C for 30 days. The biogenic amine content in the fermented mash samples after 30 days of fermentation was determined using the method described in Example 1, and the biogenic amine degradation rate was calculated using the following formula: Degradation rate = [(C1-C2) / C1] × 100%, where, C1: Concentration of biogenic amines in uninoculated bacterial samples; C2: Biogenic amine concentration in the Staphylococcus aureus WQ-4 sample inoculated with Staphylococcus aureus.

[0045] Table 4. Degradation capacity of Staphylococcus aureus WQ-4 against histamine and tyramine.

[0046] Table 5. Degradation capacity of Staphylococcus aureus WQ-4 against histamine and tyramine.

[0047] As shown in Tables 4 and 5, inoculating Staphylococcus aureus WQ-4 during the fermentation of soy sauce mash can effectively reduce the content of histamine and tyramine, with the highest degradation rates reaching 31.37% and 24.37%, respectively. These results show that Staphylococcus aureus WQ-4 has a good bioamine degradation effect.

[0048] Example 4 Salt tolerance of Staphylococcus aureus WQ-4 (1) Staphylococcus aureus WQ-4 derived from fermented soybean paste was activated using modified MRS medium, and the initial OD was adjusted. 600 The value was set to 0.1 in the modified MRS medium.

[0049] (2) Add 4 g, 6 g, 8 g, 10 g, 12 g, 14 g, 16 g and 18 g of NaCl to 100 g of culture medium respectively, so that the final NaCl concentrations are 4%, 6%, 8%, 10%, 12%, 14%, 16% and 18% respectively.

[0050] (3) Then, the mixture was incubated at 30℃ with shaking at 120 rpm for 36 h.

[0051] (4) Measure their OD respectively 600 Value, OD of Staphylococcus aureus WQ-4 600 The values ​​are shown in Table 6.

[0052] Table 6. OD of Staphylococcus aureus WQ-4 at different concentrations of NaCl 600 value

[0053] Soy sauce fermentation is typically a high-salt, low-temperature fermentation process, with salt concentrations reaching up to 16%. Adding salt increases osmotic pressure, preventing the growth of spoilage bacteria and improving the flavor and quality of the soy sauce. Therefore, the salt tolerance of bacterial strains is an important indicator for their application in soy sauce fermentation. As shown in Table 6, the cell concentration of *Staphylococcus carinatum* WQ-4 decreased with increasing salt concentration, indicating that changes in osmotic pressure in a high-salt environment may inhibit bacterial metabolism. Even at a salt concentration of 18%, the OD value of *Staphylococcus carinatum* WQ-4 remained around 0.4, demonstrating excellent salt tolerance and indicating that *Staphylococcus carinatum* WQ-4 has good application prospects in high-salt fermentation environments.

[0054] Example 5 The heat resistance of Staphylococcus aureus WQ-4 (1) Staphylococcus aureus WQ-4 derived from fermented soybean paste was activated using modified MRS medium, and the initial OD was adjusted. 600 The value was set to 0.1 in the modified MRS medium.

[0055] (2) The cells were cultured at different temperatures of 28℃, 30℃, 32℃, 34℃, 37℃, 40℃, 43℃, 45℃, 48℃, 50℃ and 55℃ with shaking at 120 rpm for 36 h.

[0056] (3) Measure their OD respectively 600 Value, OD of Staphylococcus aureus WQ-4 600 The values ​​are shown in Table 7.

[0057] Table 7 OD values ​​of Staphylococcus aureus WQ-4 at different temperatures

[0058] Clarifying the temperature tolerance of the strains helps them better adapt to the variable environment of soy sauce fermentation and expands their practical application range in soy sauce mash fermentation. The results are shown in Table 7. Staphylococcus aureus WQ-4 exhibited the best growth at 30℃, significantly better than at other temperatures, and its OD value was also high within the temperature range of 28–48℃. 600 The values ​​are all above 1.2, and their OD values ​​are also higher at a high temperature of 55℃. 600 The value can still be maintained above 0.35, showing excellent growth ability, indicating that Staphylococcus aureus WQ-4 has excellent heat resistance.

[0059] Example 6 Acid resistance of Staphylococcus aureus WQ-4 (1) Staphylococcus aureus WQ-4 derived from fermented soybean paste was activated using modified MRS medium, and the initial OD was adjusted. 600 The value was set to 0.1 in the modified MRS medium.

[0060] (2) The plants were cultured at different pH values ​​of 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5 and 7.0 with shaking at 120 rpm for 36 h.

[0061] (3) Measure their OD respectively 600 Value, OD of Staphylococcus aureus WQ-4 600 The values ​​are shown in Table 8.

[0062] Table 8 OD of Staphylococcus aureus WQ-4 at different pH values 600 value

[0063] The fermentation process of soy sauce is characterized by a slightly acidic pH, making the pH tolerance of biogenic amine-degrading bacteria crucial for successful fermentation. The results, shown in Table 8, indicate that under strongly acidic conditions (pH ≤ 4.5), the growth of *Staphylococcus caryopsis* WQ-4 was severely inhibited, with cell concentrations almost zero, demonstrating its poor tolerance to strongly acidic environments. However, under slightly acidic conditions (pH 5.0–7.0), *Staphylococcus caryopsis* WQ-4 exhibited stronger tolerance; at pH 5.5, the OD of *Staphylococcus caryopsis* WQ-4 was significantly lower. 600 The value can reach above 1.2, indicating that Staphylococcus aureus WQ-4 can adapt well to the weakly acidic environment of soy sauce fermentation.

[0064] Example 7 Bile salt tolerance of Staphylococcus aureus WQ-4 MRS broth medium containing 0.3% bile salts was prepared, and the viable count was determined by colony dilution plating and counting, and the survival rate was calculated (Table 9).

[0065] Survival rate = (N2 / N1) × 100%, where, N1: Colony count in bacterial culture without added bile salts; N2: The number of bacterial colonies in the bacterial solution with added bile salts.

[0066] Table 9. Survival rate of Staphylococcus aureus WQ-4 in bile salt medium.

[0067] Bile salts can disrupt microbial cell membranes, possibly related to their cell membrane structure or bile salt efflux mechanisms. By preparing a culture medium containing 0.3% bile salts, the number of viable bacteria was measured and the survival rate was calculated. The results are shown in Table 9. Staphylococcus aureus WQ-4 showed a survival rate of 62.5984% in bile salts, demonstrating strong bile salt tolerance and suggesting its potential for development as a probiotic for the gut.

[0068] Example 8 Histamine and tyramine metabolic pathways of Staphylococcus aureus WQ-4 Staphylococcus aureus WQ-4 was cultured to the logarithmic growth phase. After centrifugation at 4℃ and 8000 r / min for 5 minutes, the cell pellet was collected, and total DNA was extracted from the screened strain using a bacterial assay kit. Genome sequencing was performed de novo using the HiSeq X next-generation high-throughput sequencing platform, completed by Hunan Shengkel Biotechnology Co., Ltd. Based on the KEGG annotation results from the whole-genome sequencing, Staphylococcus aureus WQ-4 was found to possess metabolic pathways for histamine, tyramine, and other biogenic amines. Figure 5 ).

[0069] Depend on Figure 5 It is known that histidine is decarboxylated by histidine decarboxylase (HDC) to form histamine, which is then metabolized by aldehyde dehydrogenase (ALDH) secreted by Staphylococcus aureus WQ-4 to imidazole acetic acid and enters the tricarboxylic acid cycle; tyrosine is decarboxylated by tyrosine dehydrogenase (TDH) to form tyrosine, which is then metabolized by succinate semialdehyde dehydrogenase (SSADH) secreted by Staphylococcus aureus WQ-4 to form succinyl-CoA and enters the tricarboxylic acid cycle.

[0070] Example 9 Amine-reducing enzymes of Staphylococcus aureus WQ-4 Analysis of the functional gene annotation results from whole-genome sequencing revealed that Staphylococcus aureus WQ-4 possesses multiple copper oxidase (MCO), catalase (HPⅡ), catalase (Catalase), putative aldehyde dehydrogenase (AldA), benzaldehyde-dependent dehydrogenase, and putative aldehyde dehydrogenase, all of which are enzymes associated with biogenic amine degradation.

[0071] The sequence of the polycopper oxidase MCO is as follows: TTGCCTATAATAATCCAAGATAAAACATTTGTATCTAAAAAATTAAATTATTCAAAAACGAAAGACGAAGATGGCACTCAAGGTGATACTGTTCTTGTGAACGGAATAGTAAACCCCAAACTGACAGCAAAAGAAGAGAAAATACGTTTGAGACTTTTAAATGGTTCTAATGCTCGAGATTTAAATCTTAAGCTAAGTAATAATCAAAGTTTTGAGTATATTGCTTCAGAAGGCGGTCAATTAAAAAACGCTAAAAAATTAAAAGAAATTAATTTAGCTCCTTCAGAAAGAAAAGAAATAGTAATAGATTTATCTAAAATGAAAGGCGAGAAAATCAGTCTGGTTGATAATGATAAAACTGTAATTTTACCGATTAGTAACAAAGAGAAAAGTTCTAACAAAAGTAATACACCAAAAGTAGGTAAGAAAATAAAATTAGAAGGTATGAATGATAATGTTACCATTAATGGTAATAAATTCGATCCTAACAGAATAGATTTTACACAAAAGTTAAACCAGAAAGAAGTATGGGAAATTGAAAACGTCAAAGATAAAATGGGTGGTATGAAACATCCTTTCCACATCCATGGAACGCAATTTAAAGTTTTATCTGTGGATGGGGAGAAACCTCCAAAAGATATGAGGGGTAAAAAGGATGTTATATCTTTGGAACCTGGACAAAAAGCTAAAATAGAGGTTGTATTTAAAAATACTGGAACATACATGTTTCACTGTCATATACTTGAGCATGAAGAGAATGGAATGATGGGTCAAGTAAAAGTAACAAACTAA, SEQ ID No.4。

[0072] The sequence of catalase HPⅡ is as follows:

[0073] The sequence of catalase is as follows:

[0074] Assume the sequence of aldehyde dehydrogenase AldA is as follows:

[0075] The sequence of the benzaldehyde-dependent dehydrogenase is as follows:

[0076] Assume the sequence of aldehyde dehydrogenase is as follows:

[0077] Example 10 The effect of Staphylococcus aureus WQ-4 on soy sauce flavor Method for determining flavor compounds in soy sauce: Accurately weigh approximately 2g of soy sauce mash into a 15ml solid-phase microextraction (SPE) bottle, add 5μL of 0.816 g / L 2-methyl-4-heptanone internal standard, tighten the cap, and incubate at 40℃ for 5 min using the incubation program provided by GC-MS. Then, insert the extraction head through the cap of the SPE bottle into the air portion of the bottle and push out the fiber head. Perform headspace adsorption at 250 r / min for 10 min, then pull back the fiber head and inject 1 mL of gas into the GC-MS.

[0078] Chromatographic conditions: DB-5MS UI capillary column, column length 30mm, inner diameter 0.250mm, liquid film thickness 0.25μm; column temperature: injection port temperature maintained at 250℃; temperature program set as follows: initial gas chromatographic column temperature 30℃, hold for 4min, increase to 250℃ at 5℃ / min, hold for 3min.

[0079] Mass spectrometry conditions: Ionization mode: EI+; Acquisition method: Q1 Scan; Emission current (μA): 200; Drive voltage (V): 0.2; Electron energy (eV): 70; Mirror 1 (V): 4, Mirror 2 (V): 35; Ion energy (eV): 1.8; Ion energy ramp (mV·amu-1): 0.0; Interface temperature (°C): 250; Ion source temperature (°C): 230; Low quality resolution: 18.0; High quality resolution: 12.6; Detector voltage (V): 350; Scan quality range: 30~500 m / z.

[0080] (1) Take the fermented mash with a high content of biogenic amines that has been fermented for 90 days, and adjust the concentration of Staphylococcus aureus WQ-4 to 10. 8 CFU / mL was added to high-salt diluted soy sauce mash at a volume fraction of 5%. Soy sauce mash without added bacteria served as the control group, while soy sauce mash with added WQ-4 served as the experimental group. (2) Ferment at 30℃ for 30 days, stirring once every 2.5 days; (3) After fermentation, the volatile flavor compounds of the fermented mash were analyzed. The flavor compounds of the blank group and WQ-4 are shown in Table 10 and Table 11.

[0081] Table 10. Analysis of volatile flavor compounds in fermented soybean paste inoculated with different strains

[0082] Table 11 Analysis of volatile flavor compounds in fermented soybean paste inoculated with different strains (mg / kg dry basis)

[0083] In Tables 10 and 11, Staphylococcus aureus WQ-4 contains 250 flavor compounds, which is 24 more than the 226 flavor compounds in the control group. The content is 294.9087 mg / kg, which is 555.94% higher than the control group. It can be seen that the flavor compounds of the fermented sauce mash with added Staphylococcus aureus WQ-4 are more diverse.

[0084] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0085] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A salt-tolerant, flavor-enhancing, bio-amine-degrading strain, characterized in that, Named WQ-4, its classification is named Staphylococcus carnosus It was deposited on August 8, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251802, and the deposit address is Wuhan University, Wuhan, China.

2. A microbial inoculant, characterized in that, Includes the strain described in claim 1.

3. The application of the strain according to claim 1 in the preparation of salt-tolerant formulations, characterized in that, The salt-tolerant NaCl concentration does not exceed 18%.

4. The use of the strain according to claim 1 in the preparation of heat-resistant formulations, characterized in that, The heat resistance temperature shall not exceed 55°C.

5. The use of the strain according to claim 1 in the preparation of acid-resistant preparations, characterized in that, The pH range for acid resistance is 5.0 to 7.

0.

6. The use of the strain according to claim 1 in the preparation of bile salt resistant preparations.

7. The use of the strain according to claim 1 in the degradation of biogenic amines.

8. The application as described in claim 7, characterized in that, The biogenic amines are histamine and tyramine.