An exovesicle encapsulating mRNA and its application in the field of skin anti-aging

This method enables one-step production of mRNA encoding type 3 collagen encapsulated in outer vesicles via a cell-based approach. By utilizing a light-controlled RNA encapsulation system, it solves the problems of transdermal absorption difficulties, short duration of effect, and high cost in existing type 3 collagen anti-aging products. It achieves in-situ synthesis and efficient delivery of full-length type 3 collagen, which can be applied to skin anti-aging and post-medical aesthetic repair.

CN122168535APending Publication Date: 2026-06-09BIOCREATECH (SHENZHEN) BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-03
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing type III collagen anti-aging products suffer from problems such as difficulty in transdermal absorption, short duration of effect, high cost, and insufficient bioactivity. Traditional preparation methods are cumbersome and costly.

Method used

A one-step cell-based method was used to produce mRNA encoding type 3 collagen encapsulated in outer vesicles. A light-controlled RNA encapsulation system was used to achieve specific encapsulation and precise release of the mRNA. By relying on the outer vesicles as a low-immunogenic carrier, delivery efficiency was improved and production costs were reduced.

Benefits of technology

It has achieved in-situ synthesis of full-length type 3 collagen, which improves bioactivity and delivery efficiency, simplifies the production process, reduces costs, and can be widely used in skin anti-aging and post-medical aesthetic repair.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the field of biomedical engineering technology and discloses an external vesicle encapsulating mRNA and its application in the field of skin anti-aging. This invention produces external vesicles encapsulating type 3 collagen mRNA using a one-step cell-based method. These external vesicles, using cell-derived external vesicles as delivery carriers, are combined with a light-controlled RNA encapsulation system to achieve specific encapsulation and release of mRNA under blue light regulation. After sequence optimization, the target mRNA exhibits significantly improved stability and translation efficiency, and upon entering skin target cells, it can synthesize full-length and bioactive type 3 collagen in situ. The product of this invention has good biocompatibility and low immunogenicity, and can endogenously activate the body's collagen synthesis capacity, avoiding the shortcomings of exogenous supplementation. It can be widely used in medical aesthetics anti-aging, skin repair, and other scenarios, combining the advantages of low cost and high delivery efficiency, and has broad market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical engineering technology, specifically relating to a method for preparing drug-loaded exovesicles and their applications, particularly to an exovesicle encapsulating mRNA and its application in the field of skin anti-aging. Background Technology

[0002] Type III collagen plays a central role in the anti-aging field, being key to maintaining youthful skin. Often referred to as "baby skin collagen," it accounts for over 20% of young skin. Its anti-aging effects are mainly manifested in three aspects: First, it restructures the skin, replenishing lost collagen and repairing loose collagen fiber networks, thus significantly improving skin elasticity and firmness, and reducing the formation of fine lines and wrinkles. Second, it activates regeneration mechanisms, stimulating fibroblast proliferation by binding to cell surface receptors, promoting the synthesis of autologous type I and type III collagen, and effectively reversing collagen metabolism imbalances. Third, it strengthens the skin barrier function, filling gaps between the epidermis and dermis, reducing transepidermal water loss, and inhibiting inflammatory responses and the activity of collagen-degrading enzymes, thereby improving sensitive skin problems and photoaging damage. In post-medical aesthetic repair settings, it can also accelerate wound healing, reduce pigmentation and scar formation, achieving a synergistic effect of repair and anti-aging.

[0003] Currently available anti-aging products containing type III collagen have many prominent problems. Topical products have difficulty penetrating the skin, while injectable type III collagen only lasts for 1-3 months and is expensive (Wang Y, et al. The Clinical Efficacy of Recombinant Type III Collagen Combined with Monopolar Radiofrequency Device on Anti-Aging of Facial Skin. American Journal of Biomedical Science & Research, 2025, 10(4): 1-7). Technically, most recombinant products are collagen fragments rather than full-length proteins, lacking key functional domains and making it difficult to form a complete triple helix structure. This results in insufficient biological activity, only able to play a basic filling role, and unable to achieve regenerative regulation. Traditional in vitro transcription methods require multiple steps such as template preparation, enzymatic transcription, mRNA purification, and vector conjugation, which are not only cumbersome to operate but also have high material and labor costs.

[0004] Therefore, it is of great significance to develop a drug-loaded exovesicle that can synthesize full-length type 3 collagen in cells, enhance its bioactivity, improve delivery efficiency, and reduce production costs. Summary of the Invention

[0005] To address the problems of existing technologies, this invention produces mRNA encoding type 3 collagen encapsulated in external vesicles in a one-step cellular process. After entering the cells, the mRNA is used to synthesize full-length type 3 collagen in situ using skin cells, avoiding the problem of insufficient activity of recombinant fragments. At the same time, relying on low immunogenicity carriers such as external vesicles improves delivery efficiency and reduces production costs.

[0006] On one hand, the present invention provides an external vesicle encapsulating mRNA, wherein the external vesicle encapsulates mRNA encoding a target protein, and the 3' uncoding region of the mRNA is embedded with a RAT aptamer, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Specifically, the target protein is selected from at least one of type 1 collagen, type 3 collagen, type 5 collagen, type 10 collagen, type 17 collagen, or nanoluciferase. Preferably, the target protein is type 3 collagen, and the amino acid sequence of type 3 collagen is shown in SEQ ID NO.2. Preferably, the target protein is nanoluciferase, and the amino acid sequence of nanoluciferase is shown in SEQ ID NO.8.

[0008] On one hand, the present invention provides a fusion protein for preparing the external vesicle, the fusion protein being a light-controlled RNA encapsulation protein, the light-controlled RNA encapsulation protein comprising a membrane-binding domain, a light-controlled RNA binding domain, and a flexible linker peptide. Preferably, the membrane-binding domain is an external vesicle membrane-binding domain or a cell membrane-binding domain. The amino acid sequence of the external vesicle membrane-binding protein CD63 is shown in SEQ ID NO.4, the amino acid sequence of the cell membrane binding domain transmembrane peptide is shown in SEQ ID NO.5, the amino acid sequence of the light-controlled RNA binding domain is shown in SEQ ID NO.6, and the amino acid sequence of the flexible linker peptide is shown in SEQ ID NO.7.

[0009] On one hand, the present invention provides a combination of recombinant expression plasmids for preparing the outer vesicles, including a recombinant plasmid expressing the fusion protein and a recombinant plasmid expressing mRNA encoding the target protein. Preferably, the backbone vector of the recombinant expression plasmid is a pcDNA3.1 (+) vector.

[0010] On one hand, the present invention provides a method for preparing the external vesicles, comprising the following steps: constructing a recombinant plasmid expressing a light-controlled RNA encapsulation protein and a target mRNA, co-transfecting host cells, culturing under blue light, and then isolating and purifying the external vesicles.

[0011] Specifically, the conditions for blue light induction are: wavelength 400-500nm, power 0.3-0.7w, and continuous irradiation until the collection of outer vesicles ends. Preferably, the wavelength is 450-500nm and the power is 0.5-0.6w.

[0012] Specifically, the host cells are HEK293F or HEK293T, and after transfection, they are fed culture to maintain a glucose concentration above 4 g / L.

[0013] Specifically, the purification steps are as follows: the fermentation broth is centrifuged at 100-300g for 3-8 min, centrifuged at 18000-2000g for 15-25 min, and ultracentrifuged at 100000g-120000g for 60-90 min, and the precipitate is resuspended to obtain an exovesicle suspension.

[0014] On the one hand, the present invention provides the application of the said external vesicles or the said recombinant expression plasmid combination in the preparation of skin anti-aging products, or in the preparation of medical aesthetic repair products, or in the preparation of type 3 collagen.

[0015] On the other hand, the present invention provides a skin anti-aging freeze-dried powder, which is prepared from the aforementioned exovesicles by a freeze-drying process.

[0016] Compared with existing technologies, this invention has the following advantages: First, it adopts a one-step cell-based preparation process, eliminating the multi-step process of traditional in vitro transcription, simplifying the supply chain, and significantly reducing the cost of large-scale production. Second, this method uses cell-derived extracellular vesicles as mRNA delivery carriers, exhibiting excellent biocompatibility and low immunogenicity, supporting long-term repeated use, and offering higher safety. Third, after optimization by a dedicated sequence optimization platform, the expression level of the target mRNA is increased by approximately 4.5 times, and it can drive the in situ synthesis of full-length type 3 collagen, solving the problem of insufficient activity of recombinant collagen fragments. Fourth, relying on a light-controlled RNA encapsulation system, specific encapsulation and precise release of mRNA can be achieved, improving delivery efficiency; the encapsulation effect mediated by transmembrane peptides is superior to the traditional CD63-mediated method. Fifth, by endogenously activating the body's own collagen synthesis mechanism, it avoids the problems of poor absorption and high rejection risk associated with exogenous supplementation, synergistically enhancing effects in medical aesthetics anti-aging, skin repair, and post-medical aesthetics repair scenarios, with a wide range of applications, outstanding market value, and broad market application prospects. Attached Figure Description

[0017] Figure 1 This is the experimental flowchart.

[0018] Figure 2This diagram demonstrates the codon optimization of mRNA encoding type 3 collagen using the BaiKui Rui mRNA sequence optimization system. In the diagram, A shows the principle of mRNA optimization, B shows the structure of the optimized mRNA sequence, and C shows the change in mRNA expression level after optimization.

[0019] Figure 3 This is a schematic diagram of a light-controlled mRNA encapsulation protein design. Under blue light, the RNA-binding domain forms a dimer and gains the ability to specifically bind to the RAT aptamer; without blue light, the RNA-binding domain exists as a monomer and does not possess the ability to bind RNA.

[0020] Figure 4 This document describes the production, concentration detection, electron microscopy characterization, and efficacy verification of mRNA-external vesicles: A is an incubator equipped with a blue light device; B is the concentration and particle size detection results of mRNA-external vesicles using NTA; C is the TEM electron microscopy characterization results of the external vesicles; and D is the functional characterization results (fluorescence detection after transfection into 293T cells).

[0021] Figure 5 This is a flowchart and diagram of the prepared mRNA-exovesicle lyophilized powder. A shows the process flow diagram of temperature and duration during the lyophilization process; B shows the finished lyophilized powder.

[0022] Figure 6 The results are from Western blot analysis of type 3 collagen expression after mRNA-extravesicle transfection into HEK293T cells. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0026] Example 1: Design of target mRNA and light-controlled RNA encapsulation protein

[0027] This embodiment is used to construct a fusion protein and target mRNA that can achieve RNA-specific binding and light-controlled encapsulation in outer vesicles. The flowchart is as follows. Figure 1 As shown.

[0028] Design of the light-controlled RNA encapsulation protein: The light-controlled RNA encapsulation protein consists of three parts: 1. A domain that can bind to the outer vesicle membrane (CD63, whose amino acid sequence is shown in SEQ NO. 4) or the cell membrane (membrane-penetrating peptide, whose amino acid sequence is shown in SEQ NO. 5); 2. A light-controlled RNA-binding domain that specifically binds to RAT (whose amino acid sequence is shown in SEQ ID NO. 6); 3. A flexible protein linker connecting the two parts (whose amino acid sequence is shown in SEQ ID NO. 7). This fusion protein can bind to the cell membrane or the outer vesicle membrane and encapsulate the bound mRNA into the outer vesicle. Simultaneously, in the presence of blue light, the photocontrolled RNA-binding domain can form a dimer and specifically bind to RNA containing the RAT aptamer (whose nucleotide sequence is shown in SEQ ID NO. 1), thereby achieving photocontrolled RNA encapsulation (Liu, Renmei, Jing Yao, Siyu Zhou, Jing Yang, Yaqiang Zhang, Xiaoyan Yang, Leshi Li et al. "Spatiotemporal control of RNAmetabolism and CRISPR-Cas functions using engineered photoswitchable RNA-binding proteins." Nature Protocols 19, no. 2 (2024): 374-405.). In the absence of blue light, the RNA-binding domain exists as a monomer, which can release the bound mRNA, resulting in higher translation efficiency of the free mRNA within the cell.

[0029] Target mRNA design:

[0030] (1) mRNA sequence optimization (CDS region): The CDS sequence of the protein-coding region directly affects the yield of the final functional protein by regulating the translation efficiency, stability, folding and degradation of the nascent peptide chain of mRNA. BaiKui Rui (Shenzhen) Biotechnology Co., Ltd. has independently developed an mRNA sequence optimization platform (Software Copyright Registration No. 15162522) to optimize the mRNA sequence, which can significantly improve its stability and translation efficiency. The specific process of optimizing the mRNA sequence encoding type 3 collagen using the BaiKui Rui mRNA sequence optimization platform is as follows: Figure 2 As shown in Figure A. The result is as follows. Figure 2 As shown in Figures B and C: the optimized mRNA has a more stable structure and significantly improved translation efficiency. The overall expression level of the optimized mRNA is increased by about 4.5 times (the mRNA expression level was characterized by qPCR, and the specific steps are detailed in (Nolan, Tania, Rebecca E. Hands, and Stephen A. Bustin. "Quantification of mRNA using real-time RT-PCR." Nature protocols 1, no. 3 (2006): 1559-1582.)).

[0031] 2) Using mRNA encoding type 3 collagen (or nanoluciferase) as the target mRNA template, which contains a complete 5'UTR, CDS, 3'UTR, and PolyA tail; inserting a RAT aptamer (coding sequence as shown in SEQ ID NO.1, specifically GGGATTGTTACTGCTACGGCAGGCAAAACCC) into the 3' untranslated region of the target mRNA, enabling the target mRNA to specifically bind to the aforementioned light-controlled RNA encapsulation protein. The final amino acid sequence encoded by the target mRNA is shown in SEQ ID NO.2 or SEQ ID NO.8. Figure 3 As shown, the 3' uncoding region of the mRNA specifically encapsulated in the outer vesicle contains a RAT aptamer sequence. Under blue light, the light-controlled RNA encapsulation protein, after expression, forms a dimer and specifically binds to the target mRNA containing the RAT aptamer, ultimately encapsulating the target mRNA specifically within the outer vesicle. In the absence of blue light, the light-controlled RNA encapsulation protein depolymerizes into monomers, releasing the mRNA into the outer vesicle.

[0032] Example 2: Construction of recombinant expression plasmid

[0033] This embodiment is used to construct a recombinant plasmid expressing a light-controlled RNA encapsulation protein and a target mRNA. The specific steps are as follows:

[0034] 1. Construction of light-controlled RNA encapsulation protein expression plasmid

[0035] A gene fragment encoding the light-controlled RNA encapsulation protein shown in SEQ ID NO. 9 or SEQ ID NO. 10 was synthesized by a gene synthesis company. The gene fragment and the pcDNA3.1 (+) vector were double-digested with restriction endonucleases NheI and XhoI. The digestion products were recovered by agarose gel electrophoresis, and the light-controlled RNA encapsulation protein gene fragment was ligated to the vector using T4 DNA ligase to construct the recombinant plasmid pcDNA3.1-Lic-RBP. The plasmid was transformed into E. coli DH5α competent cells, and the plasmid sequence was confirmed to be correct after antibiotic selection, PCR identification, and sequencing verification.

[0036] 2. Construction of target mRNA expression plasmid

[0037] An optimized DNA sequence encoding type III collagen (SEQ ID NO.2) and a nanoluciferase DNA sequence (SEQ ID NO.3, whose encoded amino acid sequence is shown in SEQ ID No.8) were synthesized by a gene synthesis company. The DNA fragment and the pcDNA3.1 (+) vector were double-digested with restriction endonucleases NheI and BamHI. The digestion products were recovered and ligated with T4 DNA ligase to construct recombinant plasmids pcDNA3.1-Nanoluc and pcDNA3.1-Type III collagen. The plasmids were transformed into E. coli DH5α competent cells. The plasmid sequences were confirmed to be correct by antibiotic selection, PCR identification and sequencing verification.

[0038] Example 3: Validation of the light-controlled RNA encapsulation system

[0039] This embodiment obtains Nanoluc mRNA-external vesicles through cell co-expression and purification, and characterizes their structure. The specific steps are as follows:

[0040] 1. Cell resuscitation

[0041] Thaw the frozen cells rapidly (<2 min) in a 37℃ water bath; transfer all the cell solution from the cryovial to a 125 ml shake flask containing 30 ml of pre-warmed HEK293F Hi-exp medium; and incubate in a shaker at 37℃, 5% CO2, 130 rpm (amplitude 26 mm), and 80% humidity.

[0042] 2. Cell passage

[0043] Preheat the culture medium at 37°C for 20-30 minutes; collect cells with a density ≥3×10⁶. 6Cells with a cell density of ≥95% and in the mid-logarithmic growth phase were selected and cultured at a concentration of 0.5 × 10⁻⁶ cells / ml. 6 The cells / ml seeding density was transferred to preheated culture medium and cultured in a cell culture shaker at 37°C, 80% humidity, 130 rpm (26 mm amplitude), and 5% CO2.

[0044] 3. Preparation of plasmid and transfection reagent complex

[0045] Plasmid dilution preparation: Add an appropriate amount of plasmid to an appropriate amount of 293F Hi-exp medium and mix gently. The volume of the plasmid dilution should be 3% of the total volume. At the same time, add an appropriate amount of transfection reagent to an appropriate amount of 293F Hi-exp medium and mix gently. The volume of the transfection reagent dilution should be 3% of the total volume. Add the transfection reagent dilution to the plasmid dilution, mix gently, and incubate at room temperature for 10-15 min to allow the plasmid-transfection reagent complex to react fully.

[0046] 4. Transfection and transient expression

[0047] Slowly add the incubated plasmid-transfection reagent complex to the cultured cells to be transfected (1.5-3.0 × 10⁻⁶). 6 Add cells / ml (cells, cell viability ≥95%) while gently shaking the shaker flask. Incubate in a cell culture shaker at 37℃, 80% humidity, 130 rpm (amplitude 26 mm), and 5% CO2.

[0048] 5. Fed culture

[0049] Sixteen hours after transfection, add 5% (v / v) 293F Hi-exp feed medium to the shake flask, gently shaking the flask during the addition process. Return the shake flask to a 37°C incubator for continued incubation, while continuously supplementing with blue light (LED lamp, wavelength 460nm, 0.5W) until the end of the culture period, collecting the outer vesicles (blue light incubator such as...). Figure 4 (As shown in Figure A). During the transient expression process (generally 5 days after transfection), maintain a glucose concentration above 4 g / L. Harvest cells when cell viability is below 60%.

[0050] 6. Purification and separation of exovesicles

[0051] Collect the fermentation broth, centrifuge at 200g for 5 minutes at 4°C to remove cells. Centrifuge at 2000g for 20 minutes at 4°C to remove dead cells and cell debris. Ultracentrifuge at 110000g for 75 minutes at 4°C, discard the supernatant, and resuspend the precipitate at the bottom of the centrifuge flask in an appropriate amount of 1×PBS as the exovesicle suspension for later use.

[0052] 7. The isolated mRNA-exoves were characterized by NTA, and their particle size was measured. The mRNA-exoves were then characterized by TEM electron microscopy, the method of which can be found in the literature (Jung, Min Kyo, and JY Mun. "Sample Preparation and Imaging of Exosomes by Transmission Electron Microscopy." Journal of Visualized Experiments Jove 131 (2018).).

[0053] 8. Add the mRNA-exovesicle suspension to the target cell culture dish at a ratio of 1000:1 between the mRNA-exovesicle lyophilized powder and HEK293T cell density. Gently shake the culture dish to distribute the mRNA-exovesicle lyophilized powder evenly. Then incubate at 37°C, 5% CO2, and 80% humidity for 72 hours.

[0054] 9. mRNA expression detection

[0055] Sample processing: After culture, collect the supernatant in the culture dish and gently wash the adherent cells with 1×PBS buffer, then combine the cells with the supernatant;

[0056] Fluorescence detection: The fluorescence signal intensity of the nano-luciferase in the above samples was detected using an enzyme-linked immunosorbent assay (ELISA) reader.

[0057] The concentration and particle size of the mRNA-external vesicles indicate that the size of the external vesicles ranges from 150 to 500 nm. Figure 4 As shown in Figure B). TEM electron microscopy characterization of the outer vesicles reveals typical cavity structures of the outer vesicles in the sample, indicating successful mRNA-outer vesicle production. Figure 4 (As shown in C). Functional characterization results show that the light-controlled encapsulation protein successfully encapsulated the mRNA expressing nanoluciferase into the outer vesicle, and the light-controlled RNA encapsulation protein based on the membrane-penetrating peptide had a better encapsulation effect on mRNA than the light-controlled RNA encapsulation protein based on CD63. Figure 4 (As shown in D).

[0058] Example 4: Preparation of type 3 collagen mRNA-exovesicle lyophilized powder sample

[0059] The preparation process of type 3 collagen mRNA-external vesicles was as described in Example 3, using dextran 40 as the lyophilization formulation. The subsequent lyophilization temperature and holding time were as follows. Figure 5As shown in Figure A: (hold at -50℃ for 5 hours, raise the temperature to -45℃ (1 hour) and hold for 1 hour, raise the temperature to -40℃ (1 hour) and hold for 1 hour, raise the temperature to -30℃ (1 hour) and hold for 1 hour, raise the temperature to -20℃ (1 hour) and hold for 1 hour, raise the temperature to -10℃ (1 hour) and hold for 1 hour, raise the temperature to 10℃ (2 hours), raise the temperature to 30℃ (1 hour), raise the temperature to 40℃ (1 hour) and hold for 3 hours).

[0060] Depend on Figure 5 As can be seen from B, the finished freeze-dried powder is loose and porous, uniform, without collapse, adhesion, discoloration, and good solubility, which can be used to determine the requirements of the freeze-drying process.

[0061] Experimental Example 5: Efficacy Detection of Type 3 Collagen mRNA-Exovesicle Lyophilized Powder

[0062] The type 3 collagen mRNA-exovesyl lyophilized powder prepared in Case 4 was reconstituted with sterile PBS solution. The mRNA-exovesyl suspension was then slowly added to the target cell culture dish at a ratio of 1000:1 (mRNA-exovesyl lyophilized powder to HEK293T cell density). The dish was gently agitated to ensure even distribution of the mRNA-exovesyl lyophilized powder. The dish was then incubated at 37°C, 5% CO2, and 80% humidity for 72 hours. After incubation, the supernatant was collected for Western blotting (WB) (Harris, Valerie M. "Protein Detection by Simple Western Blotting"). TM Analysis (methods in molecular biology) detected the expression of type 3 collagen.

[0063] Figure 6 The results showed that type 3 collagen mRNA-exovesicles were successfully transfected into HEK293T cells and expressed type 3 collagen efficiently. In summary, these results indicate that a one-step cell-based method can produce mRNA-exovesicles encapsulating mRNA, which can efficiently deliver the mRNA encoding full-length type 3 collagen to cells for normal expression. Furthermore, this one-step cell-based production method is highly efficient and cost-effective, making it valuable for applications in the anti-aging field.

[0064] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An exovesicle encapsulating mRNA, characterized in that, The outer vesicle encapsulates an mRNA encoding the target protein, and the 3' untranslated region of the mRNA is embedded with a RAT aptamer, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The extravesicles encapsulating mRNA according to claim 1, characterized in that, The target protein is selected from at least one of type 1 collagen, type 3 collagen, type 5 collagen, type 10 collagen, type 17 collagen, or nanoluciferase. Preferably, the target protein is type 3 collagen, and the amino acid sequence of type 3 collagen is shown in SEQ ID NO.

2. Preferably, the target protein is nanoluciferase, and the amino acid sequence of nanoluciferase is shown in SEQ ID NO.

8.

3. A fusion protein for preparing the encapsulated mRNA vesicles of claim 1, characterized in that, The fusion protein is a light-controlled RNA encapsulation protein, which includes a membrane-binding domain, a light-controlled RNA binding domain, and a flexible linker peptide. Preferably, the membrane-binding domain is an external vesicle membrane-binding domain or a cell membrane-binding domain. The amino acid sequence of the external vesicle membrane-binding protein CD63 is shown in SEQ ID NO.4, the amino acid sequence of the cell membrane binding domain transmembrane peptide is shown in SEQ ID NO.5, the amino acid sequence of the light-controlled RNA binding domain is shown in SEQ ID NO.6, and the amino acid sequence of the flexible linker peptide is shown in SEQ ID NO.

7.

4. A combination of recombinant expression plasmids for preparing the external vesicles encapsulating mRNA as described in claim 1, characterized in that, The recombinant plasmid expressing the fusion protein of claim 3 and the recombinant plasmid expressing the mRNA encoding the target protein are included. Preferably, the backbone vector of the recombinant expression plasmid is a pcDNA3.1 (+) vector.

5. A method for preparing exovesicles encapsulating mRNA as described in any one of claims 1-2, characterized in that, Includes the following steps: A recombinant plasmid expressing light-controlled RNA encapsulation protein and target mRNA was constructed, co-transfected into host cells, and after blue light induction culture, the outer vesicles were isolated and purified.

6. The method according to claim 5, characterized in that, The conditions for blue light induction are: wavelength 400-500nm, power 0.3-0.7w, and continuous irradiation until the collection of outer vesicles ends. Preferably, the wavelength is 450-500nm and the power is 0.5-0.6w.

7. The method according to claim 5, characterized in that, The host cells were HEK293F or HEK293T, and after transfection, they were fed culture to maintain a glucose concentration above 4 g / L.

8. The method according to claim 5, characterized in that, The purification steps are as follows: the fermentation broth is centrifuged at 100-300g for 3-8 min, centrifuged at 18000-2000g for 15-25 min, and ultracentrifuged at 100000g-120000g for 60-90 min, and the precipitate is resuspended to obtain an exovesicle suspension.

9. The use of the encapsulated mRNA vesicles according to any one of claims 1-2 or the recombinant expression plasmid combination according to claim 4 in the preparation of skin anti-aging products, the preparation of post-medical aesthetic repair products, or the preparation of type 3 collagen.

10. A skin anti-aging freeze-dried powder, characterized in that, It is prepared by freeze-drying the outer vesicles of encapsulated mRNA as described in any one of claims 1-2.