Klebsiella pneumoniae antigen-encoding mRNA molecule and use in an mRNA vaccine
By screening and optimizing the mRNA sequence of Klebsiella pneumoniae antigen and constructing an mRNA vaccine using a lipid nanoparticle delivery system, the Th17/Tc17 immune axis is activated, solving the problems of insufficient antigen screening and immune activation in existing technologies, and achieving efficient multiple immune responses and broad-spectrum protection.
Patent Information
- Application Number
- CN202610595353.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies make it difficult to screen for Klebsiella pneumoniae antigens that balance conservation, immunogenicity, and broad-spectrum protective potential. Furthermore, traditional vaccines are less likely to activate IL-17-related immune responses, resulting in limited effectiveness of Klebsiella pneumoniae vaccines in inducing protective immune responses.
By screening multiple Klebsiella pneumoniae antigen sites, optimizing the mRNA sequences encoding these antigens, and using lipid nanoparticles as a delivery system to construct an mRNA vaccine, the Th17/Tc17 immune axis is activated, inducing multiple immune responses and establishing a durable T-cell memory bank.
It significantly enhanced tissue defense and cellular bactericidal mechanisms against Klebsiella pneumoniae, reduced the risk of bacterial colonization and bacteremia, and demonstrated broad-spectrum protective effects.
Smart Images

Figure CN122168635A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biology, specifically relating to a Klebsiella pneumoniae mRNA molecule and its application in mRNA vaccines. Background Technology
[0002] Klebsiella pneumoniae is a major pathogen causing hospital-acquired pneumonia, bacteremia, and multidrug-resistant infections. With the continued spread of carbapenem-resistant Klebsiella pneumoniae, traditional antibiotic treatment faces significant challenges, making the development of safe and effective preventative vaccines urgent. However, Klebsiella pneumoniae vaccine development is extremely difficult, and no successful vaccine has yet been marketed. Therefore, the World Health Organization (WHO) has listed Klebsiella pneumoniae as one of the key pathogens requiring urgent vaccine development.
[0003] Compared to traditional vaccine technologies, in vitro transcribed mRNA (hereinafter referred to as mRNA) has advantages such as flexible design, short development cycle, and high production efficiency, and has good application prospects in the development of Klebsiella pneumoniae vaccines. Although mRNA vaccine technology has made some breakthroughs in the field of virus prevention and control, existing technologies still face the following technical bottlenecks in the development of vaccines against Klebsiella pneumoniae, resulting in the lack of mature research and application plans for Klebsiella pneumoniae mRNA vaccines to date.
[0004] First, the screening and combination of effective antigens in bacterial vaccines remains a key challenge limiting the development of Klebsiella pneumoniae mRNA vaccines. Compared to viruses, bacterial genomes are much larger and more complex, with significant differences between different strains and serotypes. Screening for antigen targets that balance conservation, immunogenicity, and broad-spectrum protective potential is like finding a needle in a haystack. Furthermore, bacterial codon usage preferences differ significantly from those of mammalian cells. Without proper optimization, the translation efficiency of mRNA within host cells is often low, leading to insufficient expression of the target antigen and difficulty in inducing an ideal immune response.
[0005] Secondly, current technologies still fall short in inducing effective protective immunity against Klebsiella pneumoniae. Klebsiella pneumoniae infection is a complex process; host defense relies not only on humoral immunity but also on the coordinated participation of multiple immune mechanisms, including cellular and mucosal immunity, to achieve a protective effect. Existing vaccine regimens often struggle to simultaneously induce multiple immune responses that are sufficiently strong, long-lasting, and provide good protection. Therefore, their protective efficacy is extremely limited when facing exposure to high bacterial loads or infection with drug-resistant strains.
[0006] Finally, there is insufficient activation of key immune pathways required for Klebsiella pneumoniae infection. The body's clearance of Klebsiella pneumoniae largely depends on protective immune mechanisms, such as the IL-17-related immune response, which are closely related to neutrophil recruitment, bactericidal activity at inflammatory sites, and infection control. Traditional vaccines (such as inactivated vaccines) often fail to effectively activate these key pathways, resulting in the body's inability to rapidly establish adequate antibacterial defenses in the early stages of infection, thus affecting the vaccine's protective efficacy and durability.
[0007] Therefore, developing a Klebsiella pneumoniae mRNA vaccine that can achieve efficient expression through precise antigen screening and sequence optimization, and further induce an effective protective immune response, has significant research and development value and application prospects, and is also a key technical problem that urgently needs to be solved in this field. Summary of the Invention
[0008] To address the aforementioned technical bottlenecks, this invention first screened and identified several promising Klebsiella pneumoniae antigenic sites. Through in-depth optimization and screening of the mRNA sequences encoding these Klebsiella pneumoniae-related antigens, multiple mRNA molecules encoding Klebsiella pneumoniae antigens were successfully constructed. Secondly, this invention constructed a Klebsiella pneumoniae mRNA vaccine using lipid nanoparticles as a delivery system. The mRNA vaccine exhibits excellent immunogenicity and protective efficacy. After immunization, it can efficiently induce a multi-faceted immune response involving mucosal immunity, humoral immunity, and cellular immunity, particularly significantly activating the Th17 / Tc17 helper T cell / cytotoxic T cell (Th17 / Tc17) immune axis, thereby greatly enhancing the body's tissue defense and cellular bactericidal mechanisms against Klebsiella pneumoniae. Simultaneously, this vaccine can establish a durable T cell memory bank in the body, supporting long-term protection, significantly reducing the risk of bacterial colonization and bacteremia, inhibiting the excessive pro-inflammatory cascade response triggered by infection, and showing excellent broad-spectrum protective effects against multiple strains of Klebsiella pneumoniae. Specifically, it includes the following: In a first aspect, the present invention provides a Klebsiella pneumoniae mRNA, the mRNA comprising: a 5' end modified structure, a 5' end untranslated region, a signal peptide sequence, a coding region sequence of Klebsiella pneumoniae antigen, a 3' end untranslated region, and polyadenylate; Among them, any of the components of the 5' untranslated region, the signal peptide sequence, and the 3' untranslated region can be replaced by other regulatory elements with equivalent functions; The Klebsiella pneumoniae antigen is selected from: (a) Any antigen having at least 90% identity with any of the amino acid sequences shown in SEQ ID NO. 1-8, or any combination of two or more antigens; or, (b) An active fragment having the immunogenicity of the Klebsiella pneumoniae antigen described in (a); or, (c) An active fragment having the Klebsiella pneumoniae antigen described in (a) by substitution, deletion or insertion of one or more amino acid residues, and having the immunogenicity of the Klebsiella pneumoniae antigen.
[0009] Preferably, the Klebsiella pneumoniae antigen is selected from antigens with amino acid sequences as shown in any of SEQ ID NO. 9-12.
[0010] Preferably, the coding region sequence of the Klebsiella pneumoniae antigen is any nucleotide sequence encoding the Klebsiella pneumoniae antigen described in the first aspect above.
[0011] Preferably, the coding region sequence of the Klebsiella pneumoniae antigen is as follows: (a) The nucleotide sequence shown in any of SEQ ID NO. 13-16; or, (b) Due to codon degeneracy, the nucleotide sequence differs from that shown in (a), but encodes a nucleotide sequence of the Klebsiella pneumoniae antigen shown in any of SEQ ID NO. 9-12; or, (c) A nucleotide sequence that can hybridize with the nucleotide sequence described in (a) or (b) under severe conditions and encodes a protein having the Klebsiella pneumoniae antigen immunogenicity shown in any of SEQ ID NO. 9-12.
[0012] (d) A nucleotide sequence described in any one of (a) to (c) above that contains one or more chemically modified nucleotides.
[0013] Preferably, the amino acid sequence of the signal peptide is shown in SEQ ID NO. 17.
[0014] Preferably, the 5'UTR sequence is as shown in SEQ ID NO. 22, and the 3'UTR sequence is as shown in SEQ ID NO. 23.
[0015] Preferably, the full-length nucleotide sequence of the mRNA is as shown in any one of SEQ ID NO.24-27.
[0016] In a second aspect, the present invention provides a recombinant DNA template for preparing the mRNA molecule described in the first aspect above, the recombinant DNA template comprising: a promoter sequence and a DNA coding region located downstream of the promoter; the DNA coding region is used for transcription to obtain the mRNA described in the first aspect above.
[0017] Preferably, the sequence of the promoter is shown in SEQ ID NO. 28.
[0018] Thirdly, the present invention provides the use of the mRNA described in the first aspect or the recombinant DNA template described in the second aspect in the preparation of a drug or vaccine for the prevention of Klebsiella pneumoniae infection.
[0019] Fourthly, the present invention provides an mRNA vaccine for preventing Klebsiella pneumoniae infection, the mRNA vaccine comprising one or more mRNAs as described in the first aspect above and lipid nanoparticles for encapsulating the mRNAs.
[0020] Preferably, the lipid component of the lipid nanoparticles is selected from one or more of the following groups: DLin-MC3-DMA, SM-102, ALC-0315, DSPC, DPPC, DOPE, DOPS, DGTS, cholesterol, β-sitosterol, DMG-PEG2000, DMG-PEG5000, DSPE-PEG2000-Mannose, DMPE-PEG2000, DSPE-PEG2000, and DSPE-PEG5000-Mannose.
[0021] Preferably, the lipid component of the lipid nanoparticles comprises DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 in a molar percentage range of 40-60 : 5-25 : 28.5-48.5 : 0.5-2.5.
[0022] Preferably, the molar ratio of DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 is 50:10:38.5:1.5.
[0023] Preferably, the dosage forms of the mRNA vaccine include solutions, lyophilized powder injections, sprays, nebulized formulations, and inhaled dry powder formulations.
[0024] Preferably, the vaccine is administered via one or more of the following methods: intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, microneedle patch, oral administration, inhalation, nebulized inhalation, spray administration, or nasal administration.
[0025] Fifthly, the present invention provides a method for preparing the mRNA vaccine described in the fourth aspect above, the method comprising: (a) Dissolve the mRNA described in the first aspect above in the aqueous phase of an acidic buffer solution with a concentration of 10-50 mM and a pH of 4.0-5.5; (b) The lipid component is dissolved in ethanol to obtain the organic phase; (c) The organic phase and the aqueous phase are mixed in a volume ratio of 1:2 to 1:5 using a microfluidic device; (d) Dilute or dialyze to a neutral buffer solution with a pH of 7.2-7.6.
[0026] Preferably, the method includes: (1) Aqueous phase preparation: The mRNA described in the first aspect above is dissolved in an aqueous buffer, wherein the aqueous buffer is a citrate buffer with a pH range of 4.0-5.5 and a buffer concentration of 10-50 mM, and the final concentration of the mRNA is 0.1-10 mg / mL; (2) Organic phase preparation: DLin-MC3-DMA, DSPC, cholesterol and DMG-PEG2000 were dissolved in an organic solvent at a molar ratio. The organic solvent was ethanol and the total lipid concentration was 5-50 mM. (3) Preparation of initial mixture: The aqueous phase and the organic phase are mixed at a volume ratio of 1:2-1:5 at 15-40℃ by rapid mixing or microfluidic device to form an LNP-mRNA suspension. The flow rate ratio of the organic phase to the aqueous phase during mixing is 1:3. (4) Preparation of LNP-mRNA: The initial mixture is diluted or dialyzed into a neutral buffer to neutralize residual organic solvents and stabilize particles. The neutral buffer is preferably PBS with a pH range of 7.2-7.6.
[0027] The beneficial effects of this invention are as follows: First, this invention firstly identified an antigen sequence that can be used to successfully prepare an mRNA vaccine by extensive screening of Klebsiella pneumoniae antigens; secondly, this invention designed and optimized an mRNA sequence that encodes an effective protective antigen of Klebsiella pneumoniae, and successfully constructed an mRNA molecule that can efficiently translate the Klebsiella pneumoniae antigen, which can be used to prepare a Klebsiella pneumoniae mRNA vaccine; thirdly, this invention constructed a Klebsiella pneumoniae mRNA vaccine using liposome nanoparticles as a delivery system. This mRNA vaccine has good immune response efficacy, can effectively induce the activation of the Th17 / Tc17 axis in the lungs and spleen, which is beneficial to the mucosal defense and cell bactericidal mechanism of Klebsiella pneumoniae. In particular, it can establish a resident T cell memory bank in the respiratory tract, supporting long-term protection, significantly reducing the risk of colonization and bacteremia, and inhibiting the pro-inflammatory cascade. It also shows broad-spectrum protection in multiple strains of Klebsiella pneumoniae. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of the immunization protocol and sample collection time points.
[0029] Figure 2 This is the result of detecting the level of antigen-specific IgG antibodies in serum samples.
[0030] Figure 3The results show the levels of antigen-specific sIgA antibodies in lavage fluid samples (BALF and NALF) from the respiratory mucosa.
[0031] Figure 4 This refers to the sterilization test results of BALF or NALF samples.
[0032] Figure 5 The results show the proportions of follicular helper T cells (Tfh) and germinal center B cells (GCB) subsets.
[0033] Figure 6 The number of lymphocytes secreting IL-17A in the lungs was measured using ELISPOT.
[0034] Figure 7 For the detection of CD4 by ICS flow cytometry + IL-17A + / IFN-γ and CD8 + IL-17A + / IFN-γ cell subset ratio results.
[0035] Figure 8 CD4 in mouse lung tissue + With CD8 + The proportion of tissue-resident memory T cells (TRM).
[0036] Figure 9 The results show the bacterial load (CFU) in the lungs and spleen of mice after challenge.
[0037] Figure 10 The results show the levels of inflammatory factors in lung and blood samples from mice after viral challenge.
[0038] Figure 11 The results show the survival rate of mice after challenge with the virus.
[0039] Figure 12 The results show the weight of mice after challenge with the virus.
[0040] Figure 13 The results show the clinical scoring of mice after challenge with the virus. Detailed Implementation
[0041] The following are various exemplary embodiments of the present invention, but they should not be considered as limitations on the present invention, but rather as a more detailed description of certain aspects, features and implementations of the present invention.
[0042] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0044] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0045] Example 1: Preparation of Klebsiella pneumoniae mRNA vaccine 1. Design and in vitro transcription preparation of Klebsiella pneumoniae mRNA molecular sequence 1.1 Design of target antigens for coding regions The target antigen amino acid sequences in the coding region are: Ag1 (SEQ ID NO. 9), Ag2 (SEQ ID NO. 10), Ag3 (SEQ ID NO. 11), and Ag4 (SEQ ID NO. 12), which are the immunodominant regions or full-length sequences of key pathogenic / conserved proteins of Klebsiella pneumoniae. Conserved amino acid substitutions, N-terminal secretory signal peptide substitutions (SEQ ID NO. 18), transmembrane removal / conjugation, purification tags such as His / FLAG, linker peptides (G / S)n, multi-epitope tandem, and cross-subtype consensus sequences are permitted. At the nucleic acid level, codon optimization (human / mouse or specific species), uncoding region (UTR) combinations, and engineered variations in poly(A) length are allowed.
[0046] Ag1 protein sequence: GlnH (KPN_00840)-FimA (KPN_02984)-KPN_00466 (https: / / www.uniprot.org / ); Ag2 protein sequence: OmpA (KPN_04210); FimA (KPN_00182); Ag3 protein sequence: PRK15292; Ag4 protein sequence: KPC-2; KP-Cal.
[0047] This invention discovers that the immunogenic antigen fragments in Ag1-Ag4 (shown in SEQ ID NO. 1-8) also have the same function, and that any combination of the antigen fragments shown in SEQ ID NO. 1-8 can achieve the same function. This invention uses only the Ag1-Ag4 antigen as an example to prepare a Klebsiella pneumoniae mRNA vaccine.
[0048] 1.2 mRNA sequence framework 5′ end: Cap structure; 5′UTR is a high translation efficiency element (e.g., derived from a eukaryotic high efficiency UTR, or an equivalent functional fragment), and the 5′ end sequence described in this application is shown in SEQ ID NO.22.
[0049] Coding regions: Ag1-open reading frame, Ag2-open reading frame, Ag3-open reading frame, or Ag4-open reading frame; optionally, a secretory signal peptide and a cleavable guide peptide. The Ag1-mRNA coding region sequence described in this application is shown in SEQ ID NO.13, the Ag2-mRNA coding region sequence is shown in SEQ ID NO.14, the Ag3-mRNA coding region sequence is shown in SEQ ID NO.15, and the Ag4-mRNA coding region sequence is shown in SEQ ID NO.16; or, due to codon degeneracy, a nucleotide sequence different from any of the SEQ ID NO.13-16 described above, but encoding the same amino acid sequence (i.e., an ORF synonymous variant). The amino acid sequence of the signal peptide is: MDAMKRGLCCVLLLCGAVFVSP (shown in SEQ ID NO.17), and the corresponding Ag1-mRNA, Ag2-mRNA, Ag3-mRNA, or Ag4-mRNA signal peptide coding sequences are shown in SEQ ID NO.18-21, respectively.
[0050] 3′ end: 3′UTR (such as a steady-state enhancement element) + poly(A) 100-150 nt, the sequence of the 3′ untranslated region described in this application is shown in SEQ ID NO.23.
[0051] Recombinant DNA template: includes a promoter sequence and a DNA coding region located downstream of the promoter, the DNA coding region being used for transcription to obtain the above-mentioned mRNA. The 5′ end includes a promoter, the sequence of which is: TAATACGACTCACTATAGGG (SEQ ID NO.28).
[0052] Nucleoside modification: N1-methylpseuuridine (m¹Ψ) replaces uracil nucleoside (U) to reduce innate immune response and enhance translation efficiency.
[0053] Purification: Remove template DNA by enzyme digestion, then precipitate with LiCl or HPLC for purification.
[0054] Specifically, the nucleotide sequences of the Ag1 / Ag2 / Ag3 / Ag4 mRNA described in this application are as shown in SEQ ID NO. 24-27, or are nucleotide sequences that, due to codon degeneracy, are different from any of the nucleotide sequences described in SEQ ID NO. 24-27, but encode the same amino acid sequence (i.e., ORF synonym variants).
[0055] 2. Preparation of mRNA vaccines Formulation type: Lipid nanoparticles (LNP).
[0056] LNP formulation (representative): Ionizable cationic lipid DLin MC3 DMA (MC3 for short), 1,2 Distearate sn glycerin 3 Phosphocholine (DSPC), cholesterol (Chol), and 1,2-diethylstilbestrol (DEC) Dimyristic acid sn glycerin Methoxylated polyethylene glycol 2000 (DMG) The molar ratio of PEG2000 is MC3:DSPC:Chol:DMG-PEG2000 = 50:10:38.5:1.5; ethanol / buffer solution is microfluidically mixed (FRR 1-3, TFR 6-12 mL / min); particle size is 70-100 nm, PDI ≤0.2, and encapsulation efficiency is ≥90%.
[0057] Specific preparation method: a) The mRNA is dissolved in an aqueous buffer, wherein the buffer is a citrate buffer with a pH range of 4.0-5.5 and a concentration of 10-50 mM, and the final concentration of the mRNA is 0.1-10 mg / mL; b) The ionizable lipid 4-(N,N-dimethylamino)butyric acid (6Z,9Z,28Z,31Z)-heptadecane-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 1,2 Distearate sn glycerin 3 Phosphocholine (DSPC), cholesterol and 1,2 Dimyristic acid sn glycerin Methoxy polyethylene glycol 2000 (DMG-PEG2000) is dissolved in an organic solvent at a molar ratio of 50:10:38.5:1.5 or within an equivalent range of 50±10:10±5:38.5±10:1.5±1, preferably ethanol, with a total lipid concentration of 5-50 mM. c) The aqueous phase and the organic phase are mixed at a volume ratio preferably 1:2 to 1:5 at room temperature by rapid mixing or a microfluidic device to form an LNP-mRNA suspension, wherein the flow rate ratio of organic phase to aqueous phase during mixing is preferably 1:3; d) Dilute or dialyze the initial mixture into a neutral buffer, preferably PBS, pH 7.2-7.6, to neutralize residual organic solvents and stabilize particles.
[0058] The average particle size, polymerization distribution index (PDI), zeta potential, and encapsulation efficiency of the obtained LNP-mRNA were characterized. The preferred average particle size was 60–120 nm, the preferred PDI was ≤0.2, and the preferred encapsulation efficiency was over 85%.
[0059] 3. mRNA vaccine administration Route of administration and dosage: Intranasal administration (in): The dose is approximately 1–10 μg mRNA per mouse (a representative dose is 3 μg), with a total volume of approximately 40–50 μL per mouse, administered via intranasal drip (approximately 20–25 μL per nostril). Mice may be briefly anesthetized by inhalation or intraperitoneal injection before administration to reduce stress and prevent aspiration; after administration, the animal should be kept upright or with its head slightly tilted back for several minutes to promote absorption.
[0060] Intramuscular injection (IM): The dose is approximately 1–10 μg mRNA per mouse (a representative dose is 3 μg), with a total volume of approximately 40–50 μL per mouse. The preferred administration site is the interfascial space of the femoral fascia or the gluteal muscles (hind limb muscles), using a single injection with an appropriate needle (e.g., 29–31G). Disinfect the injection site before administration; observe the animal after injection until it is awake and record any adverse reactions.
[0061] Immunization schedule: First immunization on day 0, booster on day 21 (Prime-Boost).
[0062] 4. Animal and challenge models Animals: 6–8-week-old female BALB / c mice housed in an SPF-grade animal facility.
[0063] Virus strain and dosage: (1) Klebsiella pneumoniae YBQ strain: serotype K20, strain preserved in our laboratory, isolated from the First Affiliated Southwest Hospital of Army Medical University; (2) Klebsiella pneumoniae YYD strain: serotype K1, isolated from the First Affiliated Southwest Hospital of Army Medical University; (3) Klebsiella pneumoniae strain A7818: serotype K2, isolated from Guangxi Medical University.
[0064] All the strains were stored in a glycerol culture library at -80℃ and were revived and cultured on tryptone soybean agar (TSA) medium before use.
[0065] Klebsiella pneumoniae YBQ, K1, and K2 via intratracheal or nasal challenge (representative bacterial load: 1×10⁻⁶) 6 -5×10 7 CFU / mouse; LD value pre-determined based on lethality curve).
[0066] Timing of the attack: Short-term protection: Day 42 (3 weeks after reinforcement).
[0067] Long-term memory: Attack on day 730, sampling and evaluation of recall response on day 737.
[0068] Specific solutions are as follows Figure 1 As shown.
[0069] Example 2: Humoral immunity and antibody bactericidal activity induced by Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccine 1. Immunization procedures and sample collection Ag1, Ag2, Ag3, and Ag4 mRNAs were encapsulated with LNPs to prepare corresponding mRNA vaccine formulations. Animals were randomly assigned to three groups: an in (nasal drop) immunization group, an im (intramuscular injection) immunization group, and a PBS control group. Initial and booster immunizations were administered according to a pre-defined immunization schedule (administered via the same route). Serum was collected on days 14, 21, 28, 42, 180, 365, and 730 post-immunization. Sublethal bacterial stimulation (recall) was performed on day 730, and serum was collected again on day 737. BALF (bronchial lavage fluid) and NALF (nasal lavage fluid) were collected at designated time points. After serum separation... Store at 80℃. BALF collection: Irrigate the lungs with sterile PBS, recover the lavage fluid, and centrifuge to collect the supernatant; NALF collection: Gently rinse the nasal cavity with sterile PBS and recover the lavage fluid, centrifuge to collect the supernatant, and store both at 80℃. Store at 80℃ for later use.
[0070] 2. Serum IgG endpoint titer determination (ELISA) The antigen-specific IgG endpoint titer was determined using an indirect ELISA. The specific steps are as follows: (1) Coating: Dilute the corresponding antigen (recombinant protein or purified antigen corresponding to Ag1 / Ag2 / Ag3 / Ag4) with carbonate buffer to the set concentration (e.g., 1-2 μg / mL), add 100 μL to each well of a 96-well high binding plate, and incubate overnight at 4°C.
[0071] (2) Blocking: Discard the coating solution, wash the plate with PBST, add blocking solution (e.g., 5% skim milk powder or 1% BSA), and block at room temperature for 1-2 h.
[0072] (3) Sample addition: Serum is serially diluted 10 times (initial dilution factor, for example, 1:100 or 1:200), 100 μL is added to each well, and incubated at room temperature for 1 h.
[0073] (4) Secondary antibody: After washing the plate with PBST, add HRP-labeled anti-mouse IgG secondary antibody (diluted according to the instructions) and incubate at room temperature for 1 h.
[0074] (5) Color development and reading: Add TMB substrate to develop color, stop the reaction with stop solution, and read the OD value at 450 nm.
[0075] (6) Endpoint titer calculation: Set a threshold for blank wells / negative controls (e.g., negative mean + 3SD), obtain the endpoint titer using four-parameter fitting (4PL), and express it in log10 form.
[0076] 3. The endpoint titer determination of mucosal secretory IgA (sIgA) (BALF and NALF, ELISA) is similar to that of serum ELISA, with the following differences: (1) Samples: BALF and NALF supernatants were serially diluted 2-fold or 5-fold; (2) Secondary antibody: HRP-labeled anti-mouse IgA or anti-secretory IgA secondary antibody was used; (3) Endpoint titer: The threshold method was also used and the endpoint titer was calculated by fitting with 4PL. The result is expressed as log 10.
[0077] 4. Serum / mucus fluid sterilization test (complement inactivation condition).
[0078] (1) Complement inactivation of samples: serum, BALF or NALF are inactivated by water bath at 56℃ for 30 min and then cooled for later use.
[0079] (2) Bacterial preparation: Klebsiella pneumoniae YBQ, YYD, and A7818 were cultured overnight and then recovered to the logarithmic growth phase the next day. They were washed with PBS and the bacterial concentration was adjusted to the set inoculum amount (e.g., 10). 5 -10 6 CFU / reaction).
[0080] (3) Co-incubation: Mix the inactivated sample with live bacteria at the predetermined dilution factor and incubate at 37°C with shaking for a set time (e.g., 1 h).
[0081] (4) Plate counting: After incubation, perform serial dilutions, spread on LB or corresponding plates, and incubate overnight at 37°C to count CFU.
[0082] (5) Sterilization rate calculation: Using PBS or negative samples as controls, the sterilization rate is calculated according to the following formula: Percentage of sterilization = (1 (CFU control CFU immunized sample) × 100%.
[0083] (6) Each sample group should be technically replicated in 2–3 wells and biologically replicated. Differences should be analyzed according to the preset statistical methods.
[0084] 5. Detection of germinal center response (flow cytometry to measure changes in the ratio of Tfh and GCB cell subsets) (1) Collection and preparation of single cells: Animals were sacrificed at a specified time point, spleens were taken to prepare single cell suspensions, and red blood cells were lysed and counted.
[0085] (2) Surface staining: Cells were surface stained with antibody combination and dead cells were excluded. Tfh was defined as CD4+CXCR5+PD-1+; GCB was defined as B220+GL7+Fas+.
[0086] (3) Data collection and analysis: Data were collected by flow cytometer and gating analysis was performed using software such as FlowJo. The proportion of Tfh to CD4+ and the proportion of GCB to B220+ were output and compared with the PBS control.
[0087] Results: Serum IgG test results are as follows Figure 2 As shown, the mucosal sIgA detection results are as follows: Figure 3 As shown, the results of the body fluid sterilization test are as follows: Figure 4 As shown, the results of the germinal center response are as follows: Figure 5 As shown. The Ag2 / Ag3 / Ag4 mRNA vaccine described in this application can establish a strong sIgA and humoral bactericidal barrier in the respiratory tract via mucosal immunization. Although sIgA and IgG were not detected in Ag1 mRNA, the vaccine showed a high level of cellular immunity and good protection against viral challenge.
[0088] Example 3: Th17 / Tc17 response induced by Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccine and its distribution in the lungs / spleen. 1. Preparation of single-cell suspensions from the lungs and spleen (1) Spleen single-cell preparation: Spleens of mice in each group were aseptically collected and placed in sterile PBS containing 2% FBS, and mechanically ground through a 200-mesh sieve. The cell suspension was collected, treated with red blood cell lysis buffer (RBC Lysis Buffer) for 3-5 minutes, washed, and resuspended in complete culture medium (RPMI 1640 + 10% FBS + 1% penicillin-dextrin antibody), and the cell concentration was adjusted to 5×10⁻⁶ cells / mL. 6 cells / mL.
[0089] (2) Lung tissue lymphocyte extraction: Perfusion: After anesthetizing mice, 10 mL of pre-cooled PBS was slowly perfused into the right ventricle of the heart until the lung tissue turned white to remove circulating lymphocytes from the pulmonary vessels.
[0090] Digestion: Take a lung lobe and cut it into pieces approximately 1 mm in size. 3 Small pieces were placed in a digestive solution containing type IV collagenase (1 mg / mL) and DNase I (50 μg / mL) and digested at 37°C with shaking for 45-60 minutes.
[0091] Filtration and purification: The digestion product was filtered through a 70 μm filter and the cells were collected by centrifugation. If necessary, lymphocytes were enriched by Percoll (40% / 70%) density gradient centrifugation, washed, and resuspended in complete culture medium.
[0092] 2. IL-17A ELISPOT assay (detection of secretory cell frequency) (1) Plate preparation and antigen stimulation: ELISPOT plates pre-coated with anti-mouse IL-17A capture antibody were used. 5 × 10⁵ antibodies were added to each well. 5 The above-prepared single-cell suspension.
[0093] (2) Stimulating factors: The experimental group was given the corresponding recombinant protein antigen (Ag1 / Ag2 / Ag3 / Ag4, final concentration 5-10 μg / mL) for specific stimulation; the negative control group was given culture medium.
[0094] (3) Incubation: Place the well plate in a 37℃, 5% CO2 incubator for 24-48 hours.
[0095] (4) Color development and analysis: Discard the cells, and add biotinylated detection antibody and streptavidin-horseradish peroxidase (HRP) sequentially. Add AEC chromogenic substrate and perform color development in the dark. After the spots are clear, terminate the reaction with deionized water.
[0096] (5) Counting: Spot forming units (SFUs) were counted using the ELISPOT fully automated analyzer. The results are expressed as: SFU / 5 × 10 5 cells.
[0097] 3. Cytokine staining (ICS) and flow cytometry detection (1) In vitro stimulation and blockade: Take 1×10 6 Single lung or spleen cells were stimulated overnight with the corresponding recombinant protein antigen, followed by incubation at 37°C for 4-6 hours with a protein transport inhibitor (Brefeldin A or Monensin) to allow the generated cytokines to accumulate intracellularly.
[0098] (2) Surface staining: Incubate with staining buffer containing Fc receptor blocker for 10 minutes. Then add fluorescently labeled anti-mouse CD3, CD4 and CD8 surface marker antibodies and incubate at 4°C in the dark for 30 minutes.
[0099] (3) Fixation and permeabilization: After washing the cells, add fixation / permeabilization fixation solution and incubate at room temperature in the dark for 20 minutes, then wash with permeabilization buffer.
[0100] (4) Intracellular staining: Add fluorescently labeled anti-mouse IL-17A antibody and incubate at 4°C in the dark for 30 minutes.
[0101] (5) Flow cytometry analysis: Data acquisition was performed using a flow cytometer.
[0102] Results: ELISPOT test results for IL-17A are as follows... Figure 6 As shown, ICS flow cytometry detects CD4 + IL-17A + / IFN-γ and CD8 + IL-17A + / IFN-γ frequency results are as follows Figure 7 As shown. The Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccine described in this application can induce Th17 / Tc17 axis and Th1 / Tc7 activation in the lungs and spleen via in and im delivery, which is beneficial to the mucosal defense and cell bactericidal mechanisms of Klebsiella pneumoniae.
[0103] Example 4: Lung tissue-resident memory T cells (T cells) RM ) detection The procedures for tissue sampling, digestion, cell preparation, and flow cytometry phenotyping are the same as those described in the "Th17 / Tc17 reaction and lung / spleen distribution" section (see Example 3, "Preparation of lung and spleen single-cell suspensions").
[0104] Staining: Incubate for 10 minutes with staining buffer containing Fc receptor blocker. Then add fluorescently labeled antibodies against mouse CD3, CD4, CD8, CD69, and CD103 surface markers.
[0105] Incubation: Incubate at room temperature or 4°C in the dark for 20-30 min, wash and resuspend in PBS or FACS buffer before testing.
[0106] Streaming acquisition: Acquire at least 1×10 5 -3×10 5 Lymphocyte events are recorded and saved as FCS files.
[0107] CD4 + T RM Defined as CD4 + CD69 + CD103 + CD4 + T RM Defined as CD8 + CD69 + CD103 + .
[0108] Result: CD4 in the lungs + With CD8 + T RM Cell ratio, for example Figure 8 As shown, the Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccines described in this application can all establish a resident T-cell memory bank in the lungs of immunized mice via in-cell delivery, supporting long-term protection.
[0109] Example 5: Bacterial clearance and inflammation control after viral challenge 1. Bacterial load (CFU) measurement (lung, spleen) Sampling time point: Animals were euthanized 48 hours after the challenge, and the lungs and spleen were removed.
[0110] Tissue homogenization: Remove the tissue and weigh it (record the tissue mass). Prepare a homogenate in ice-cold sterile PBS according to the tissue weight to volume ratio (e.g., 900 μL PBS per 100 mg of tissue). Homogenize to homogeneity using a homogenizer or tissue grinder at 4°C or on ice.
[0111] Serial dilution and coating: Perform tenfold serial dilutions of homogenate or blood (e.g., from undiluted to 10...). 1 Up to 10 6 (The amount of dilution is determined according to the expected bacterial count). Under aseptic conditions, take an appropriate amount of the diluted solution and spread it on a regular culture plate.
[0112] Culture and Counting: Incubate at 37℃ for 12 h until single colonies (CFU) are clearly visible on the counting plates. Select plates with a count range of 30-300 CFU for counting.
[0113] Results calculation and standardization: CFU per sample was calculated based on the dilution factor and standardized to CFU per gram of tissue. Tissue CFU / g = Sample volume (mL) CFU count × Dilution factor × Tissue mass (g) Total homogenate volume (mL).
[0114] Reproducibility and Quality Control: Perform at least two plate replicates for each sample. Set up negative (sterile PBS) and positive controls (known bacterial count) to validate the procedure.
[0115] Results: The bacterial load (CFU) test results after challenge were as follows: Figure 9 As shown, CFU levels in the lungs and spleen were significantly lower in the immunized group than in the PBS control group after challenge. In some immunized groups (e.g., Kp1 in and Kp2 in), CFU levels decreased to levels comparable to those in the untreated control (NT).
[0116] 2. ELISA method for measuring the levels of inflammatory factors (ILs) in lung tissue homogenates and serum samples. 6. IL 1β, TNF α) Sample preparation (lung tissue homogenate): Lung homogenate was prepared using the same method as CFU preparation, but with protease inhibitors added to the homogenate buffer. The homogenate was thoroughly incubated on ice and centrifuged (e.g., 10,000 × g, 10 min, 4 °C) to collect the supernatant. The supernatant can be directly detected or used for protein quantification and normalized to total protein content. Serum was separated by routine centrifugation and placed in a container... Store at 80℃ until testing.
[0117] ELISA reagents and plate preparation: IL was measured using a commercially available mouse ELISA kit. 6. IL 1β and TNF α. Prepare a standard curve (usually containing a series of standard concentrations) according to the kit instructions.
[0118] Sample dilution: Based on the kit's dynamic range, dilute lung homogenate supernatant or serum by an appropriate factor (e.g., 2-100 times) and perform technical replicates per well (at least two wells).
[0119] Experimental procedure: Add standards or samples to the pre-coated or uncoated ELISA plate, incubate, wash, add biotinylated secondary antibody / enzyme-labeled secondary antibody, substrate for color development, and terminate the reaction according to the kit sequence. Read the absorbance at 450 nm.
[0120] Results Calculation: Fit a standard curve (linear or four-parameter curve fitting is acceptable) to calculate the factor concentration in the sample. If normalization by tissue mass or total protein is required, the results can be expressed in units such as ng / g tissue or pg / mg protein. The normalization formula can be specified in the method description: for example... Normalized concentration (pg / mg protein) = total protein amount (mg) × measured concentration (pg / mL) × sample volume (mL).
[0121] Statistics and Replication: Each sample was technically replicated at least twice; biological replicates n≥5 / groups.
[0122] Results: The results of inflammatory factor detection after viral challenge were as follows: Figure 10 As shown, the levels of IL-6, IL-1β, and TNF-α (lung homogenate and serum) in the immunized group were significantly lower than those in the PBS control group, indicating that vaccine immunization can effectively limit the generation of cytokine storm.
[0123] The above results indicate that Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccines delivered via in and im significantly reduce the risk of colonization and bacteremia, and inhibit pro-inflammatory cascade responses.
[0124] Example 6 Evaluation of the protection against viral challenge of different serotypes (YBQ, YYD, A7818) of Klebsiella pneumoniae in a mouse model 1. Overall Monitoring Plan Monitoring period: Continuous monitoring for at least 7 days from the day of the challenge, which may be extended to 14 days or longer if the experiment requires.
[0125] Monitoring frequency: Record baseline data on day 0 (before challenge). It is recommended to monitor at least twice a day (once in the morning and once in the evening) for the first 3 days after challenge, and then at least once a day (at the same time) from day 7 onwards. Increase the monitoring frequency when severe clinical symptoms occur.
[0126] Record content: Each record includes survival / death status, weight, and clinical score.
[0127] 2. Weight Measurement and Processing Measurement method: Use an electronic balance with an accuracy of at least 0.1 g to weigh the animals simultaneously in the same weighing container. Record the absolute mass (g) corresponding to the individual animal number.
[0128] Endpoint and euthanasia criteria: If the mouse's body weight decreased by more than or equal to 20% compared to baseline (i.e., relative body weight change ≤ 10%) If the mortality rate is 20% or the following severe clinical scores (see item 3) reach the euthanasia threshold, euthanasia should be performed immediately and the reason recorded.
[0129] 3. Clinical scoring scale The assessment is based on factors such as weight, coat condition, activity level, posture / gait, breathing, and neurological symptoms, with each factor rated as slightly less severe. middle The system reclassifies and scores the patients, using a cumulative score to determine the severity of their condition. Example scores are as follows (each score and threshold can be directly used or slightly adjusted when writing the instructions): Weight loss: None (0 points), 5%–10% (1 point), 10%–15% (2 points), 15%–20% (3 points), ≥20% (euthanasia threshold).
[0130] Coat / body surface: normal (0), slightly frizzy (1), obviously frizzy / dirty (2), severely dry / dehydrated hair (3).
[0131] Activity / Responsiveness: Normal (0), Mildly reduced activity (1), Significantly reduced / Easily fatigued (2), No response / Bedridden (3).
[0132] Breathing: Normal (0), Breathing slightly rapid / shallow (1), Significant dyspnea / mouth breathing (2), Severe respiratory failure (euthanasia threshold).
[0133] Preset total score threshold: When the cumulative clinical score is ≥5 and / or any euthanasia threshold is reached (such as weight loss ≥20%, severe respiratory failure or coma), euthanasia shall be performed in accordance with animal ethics regulations.
[0134] Recording method: Each mouse was scored item by item during each observation, and the original scores were saved in the experimental record sheet for traceability and statistics.
[0135] 4. Survival rate records and statistical analysis Survival rate is defined as the proportion of animals surviving during the monitoring period to the total number of animals in the group; the exact time point (in days) for each mortality event is recorded.
[0136] Survival curve plotting: Kaplan-Meier survival curves are used to represent the changes in survival of each group over time.
[0137] Results: Survival rate test results are as follows Figure 11 As shown, within 7 days of challenge with the three strains, the survival rate of the immunized group was higher than that of the PBS group; in the YBQ, YYD and A7818 models, the Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccines delivered via the in route all showed high survival rates, indicating that the vaccines produced an immune protective effect.
[0138] 5. Results Weight test results as follows Figure 12 As shown, the clinical scoring test results are as follows: Figure 13As shown in the figure. Weight and clinical scores indicate that the immune group regained weight more quickly and had lower disease scores.
[0139] The above results indicate that the Ag1 / Ag2 / Ag3 / Ag4 mRNA vaccine described in this application exhibits broad-spectrum protection against multiple strains of Klebsiella pneumoniae.
[0140] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
[0141] mRNA sequence:
[0142]
[0143]
[0144]
[0145] The base sequence of the signal peptide is: AUGGAUGCCAUGAAGAGGGGGCUGUGCUGUGUGCUGCUCCUCUGUGGGGCUGUAUUUGUGUCCCCA (shown in SEQ ID NO.18).
[0146] The base sequence of the signal peptide is: AUGGACGCAAUGAAACGCGGGCUGUGCUGCGUGCUCCUUCUGUGUGGCGCCGUCUUCGUGUCUCCA (shown in SEQ ID NO.19).
[0147] The base sequence of the signal peptide is: AUGGAUGCCAUGAAGAGAGGCCUGUGCUGUGUGUUGCUUCUAUGUGGAGCUGUGUUUGUGAGUCCG (shown in SEQ ID NO.20).
[0148] The base sequence of the signal peptide is: AUGGAUGCCAUGAAGAGGGGGCUGUGCUGUGUGCUGCUCCUCUGUGGGGCUGUAUUUGUGUCCCCA (shown in SEQ ID NO.21).
[0149] 5' UTR: GUUUCUUGCUGCAGCAACGCGAGUGGGAGCACCAGGAUCUCGGGCUCGGAACGAGACUGCACGGAUUGUUUUAAGAAAGCCACC (shown in SEQ ID NO. 22).
[0150] 3' UTR: GAUCCUGGAGGAUUUCCUCCUCUUCGAGUCGCCGGUCGGUUCUCCGUAAAUCGUGGCA (shown in SEQ ID NO. 23).
[0151]
[0152]
[0153]
[0154]
Claims
1. A Klebsiella pneumoniae mRNA, characterized in that, The mRNA includes: a 5' end modified structure, a 5' end untranslated region, a signal peptide sequence, a coding region sequence for Klebsiella pneumoniae antigen, a 3' end untranslated region, and polyadenylate; Among them, any of the components of the 5' untranslated region, the signal peptide sequence, and the 3' untranslated region can be replaced by other regulatory elements with equivalent functions; The Klebsiella pneumoniae antigen is selected from: (a) Any antigen having at least 90% identity with any of the amino acid sequences shown in SEQ ID NO. 1-8, or any combination of two or more antigens; or, (b) An active fragment having the immunogenicity of the Klebsiella pneumoniae antigen described in (a); or, (c) An active fragment having the Klebsiella pneumoniae antigen described in (a) by substitution, deletion or insertion of one or more amino acid residues, and having the immunogenicity of the Klebsiella pneumoniae antigen.
2. The Klebsiella pneumoniae mRNA as described in claim 1, characterized in that, The Klebsiella pneumoniae antigen is selected from antigens whose amino acid sequences are shown in any of SEQ ID NO. 9-12.
3. The Klebsiella pneumoniae mRNA as described in claim 1, characterized in that, The coding region sequence of the Klebsiella pneumoniae antigen is any nucleotide sequence encoding the Klebsiella pneumoniae antigen as described in claim 1.
4. The Klebsiella pneumoniae mRNA as described in claim 3, characterized in that, The coding region sequence of the Klebsiella pneumoniae antigen is as follows: (a) The nucleotide sequence shown in any of SEQ ID NO. 13-16; or, (b) Due to codon degeneracy, the nucleotide sequence differs from that shown in (a), but encodes a nucleotide sequence of the Klebsiella pneumoniae antigen shown in any of SEQ ID NO. 9-12; or, (c) A nucleotide sequence that can hybridize with the nucleotide sequence described in (a) or (b) under severe conditions and encodes a protein having the immunogenicity of Klebsiella pneumoniae antigen as shown in any of SEQ ID NO. 9-12; (d) A nucleotide sequence described in any one of (a) to (c) above that contains one or more chemically modified nucleotides.
5. The mRNA as described in claim 4, characterized in that, The amino acid sequence of the signal peptide is shown in SEQ ID NO.
17.
6. The mRNA as described in claim 4, characterized in that, The 5'UTR sequence is shown in SEQ ID NO. 22, and the 3'UTR sequence is shown in SEQ ID NO.
23.
7. The mRNA as described in claim 6, characterized in that, The full-length nucleotide sequence of the mRNA is shown in any one of SEQ ID NO. 24-27.
8. A recombinant DNA template for preparing the mRNA molecule according to any one of claims 1-7, characterized in that, The recombinant DNA template includes: a promoter sequence and a DNA coding region located downstream of the promoter; the DNA coding region is used for transcription to obtain the mRNA according to any one of claims 1-7.
9. The use of the mRNA as described in any one of claims 1-7 or the recombinant DNA template as described in claim 8 in the preparation of a medicament or vaccine for the prevention of Klebsiella pneumoniae infection.
10. An mRNA vaccine for the prevention of Klebsiella pneumoniae infection, characterized in that, The mRNA vaccine comprises one or more mRNAs as described in any one of claims 1-7 and lipid nanoparticles for encapsulating the mRNA.