A method of enhancing gene editing of cells

By adding H3K9me3 demethyltransferase inhibitors and NHEJ inhibitors to cells, the problem of low gene modification efficiency of CRISPR-Cas9 in mammalian cells was solved, and a significant improvement in gene knock-in efficiency was achieved.

CN122189088APending Publication Date: 2026-06-12THINKINGBIOMED TECHNOLOGY (BEIJING) CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THINKINGBIOMED TECHNOLOGY (BEIJING) CO LTD
Filing Date
2024-12-11
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing gene editing technologies suffer from low gene modification efficiency in mammalian cells, especially the insufficient efficiency of precise gene modification mediated by CRISPR-Cas9, and viral transduction methods increase the risk and cost of tumor development.

Method used

H3K9me3 demethyltransferase inhibitors such as CP-2 and IOX1, along with inhibitors of the non-homologous end linkage repair pathway such as M3814, were used in combination to improve CRISPR-Cas9 gene knock-in efficiency by inhibiting the NHEJ pathway and promoting HDR repair.

Benefits of technology

It significantly improved gene knock-in efficiency, especially in stem cells and T cells. The combined use of inhibitors was far more effective than using them alone, achieving more efficient gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005182907390000201
    Figure BDA0005182907390000201
  • Figure BDA0005182907390000202
    Figure BDA0005182907390000202
  • Figure BDA0005182907390000203
    Figure BDA0005182907390000203
Patent Text Reader

Abstract

The present application provides a method for improving gene editing of cells. Specifically, the present application provides a method for improving gene knock-in efficiency of cells. More specifically, the present application provides a use of an active ingredient for preparing a reagent for improving gene knock-in efficiency, the active ingredient comprising: (a) a trimethylation (H3K9me3) demethylase inhibitor of lysine No. 9 of histone H3. The active ingredient of the present application can effectively improve the gene knock-in efficiency of conventional genome editing methods using RNA-guided endonucleases such as CRISPR-Cas9.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing, specifically, it relates to a method for enhancing gene editing of cells. Background Technology

[0002] Cell therapy has seen rapid development in stem cells and immune cells. However, the therapeutic effect of single cells is limited. Recent studies have shown that genetic engineering can broaden the application potential of cells to improve the safety and efficacy of cell therapy. Current treatment methods still have some limitations, including complex manufacturing processes, high production costs, long preparation times, and potential safety issues. For example, the use of viruses in CAR-T cell production is a concern because viral transduction increases the risk of insertional mutagenesis leading to tumor development. Furthermore, specific reactions to viral-derived DNA often hinder CAR expression, and viral manufacturing incurs high costs.

[0003] Studies have shown that gene editing technology can solve the problem of random viral integration. For example, CRISPR-Cas9 gene editing technology enables targeted gene insertion and expression. CRISPR consists of clusters of regularly spaced short palindromic repeats. CRISPR-Cas9 technology combines sgRNA with Cas9 nuclease (which cuts DNA double strands) to target specific sites and introduce double-stranded damage sites (DSBs). DSB sites can be repaired through complex DNA repair pathways, either error-prone or error-free, ultimately leading to DNA mutations or the insertion of desired genes at sites of interest. DSBs introduced by DNA nucleases are mainly repaired through end-joining mechanisms (NHEJ), which often leads to gene mutations. End-joining can occur through non-homologous end-joining (NHEJ) or microhomologous end-joining (MMEJ). End-joining repair can result in the addition or removal of nucleotides at the DSB ends, leading to insertion or deletion mutations. In contrast, homologous recombination-based repair (HDR) is a precise and error-free repair pathway. Unlike end-joining, HDR typically utilizes homologous sequences located on sister chromatids. The HDR mechanism can also use exogenous DNA donor templates to repair DSBs, thereby enabling the insertion of a large number of desired modifications at defined genomic sites for precise genome editing applications.

[0004] While CRISPR / Cas9 technology has become a rising star in the field of genome engineering due to its versatility and powerful usability, some issues limit its application. For example, the efficiency of precise gene modification mediated by CRISPR-Cas9 is relatively low in some mammalian cells. Recent studies have shown that inhibiting the NHEJ pathway or cell cycle synchronization can improve gene editing efficiency to some extent. Research indicates that small molecule inhibitors of DNA-PKcs that promote the NHEJ repair pathway, such as NU7441, NU7026, and M3814, increase HDR efficiency. Therefore, in order to improve gene knock-in efficiency, screening inhibitors and combining inhibitors to enhance CRISPR-Cas9 gene knock-in efficiency may be a promising approach. Currently, most research focuses on NHEJ pathway inhibitors and proteins related to homologous recombination repair. Therefore, developing new methods to improve CRISPR-Cas9 gene knock-in efficiency is of great significance to this field. Summary of the Invention

[0005] This invention provides a new method for improving the efficiency of gene knock-in.

[0006] In a first aspect of the invention, there is provided the use of an active ingredient for preparing a reagent to improve the efficiency of gene knock-in in cells, the active ingredient comprising: a functional regulator of H3K9me3.

[0007] In another preferred embodiment, the H3K9me3 functional regulator is used to enhance H3K9me3 modification; the enhancement of H3K9me3 modification includes enhancing trimethylation modification and inhibiting the activity of demethyltransferase.

[0008] In a preferred aspect of the invention, an use of an active ingredient is provided, said active ingredient being used to prepare a reagent for improving gene knock-in efficiency in cells, said active ingredient comprising:

[0009] (a) Inhibitor of histone H3 lysine trimethylation (H3K9me3) demethyltransferase.

[0010] In another preferred embodiment, the H3K9me3 demethyltransferase inhibitor is selected from the group consisting of CP-2 peptide, IOX1, or combinations thereof.

[0011] In another preferred embodiment, the active ingredient further comprises: (b) an inhibitor of the non-homologous end junction repair pathway (NHEJ inhibitor).

[0012] In another preferred embodiment, the NHEJ inhibitor is a small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway.

[0013] In another preferred embodiment, the NHEJ inhibitor is used to inhibit non-homologous end connections.

[0014] In another preferred embodiment, the small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway is selected from the group consisting of M3814, NU7441, NU7026, or combinations thereof.

[0015] In another preferred embodiment, the gene knock-in includes CRISPR-Cas9-based gene knock-in.

[0016] In another preferred embodiment, the gene knock-in includes gene knock-in based on the RNP system.

[0017] In a second aspect of the present invention, a method for improving gene knock-in efficiency in cells is provided, the method comprising:

[0018] (s1) After introducing the gene editing composition into cells, an active ingredient is added for co-culturing, thereby improving the efficiency of gene knock-in in the cells; the active ingredient includes:

[0019] (a) H3K9me3 demethyltransferase inhibitor.

[0020] In another preferred embodiment, when the active ingredient is added, the cells into which the gene-editing composition is transferred have not yet undergone gene knock-in, are undergoing gene knock-in, or have already completed gene knock-in.

[0021] In another preferred embodiment, the active ingredient has an action time of 12h-48h, for example 12h, 16h, 20h, 24h, 28h, 32h, 36h, 40h, 44h or 48h.

[0022] In another preferred embodiment, the method further includes the following steps:

[0023] (s2) After co-culturing the active ingredient with the cells into which the gene editing composition has been transferred for a period of time, the active ingredient is removed.

[0024] In another preferred embodiment, the cell is a mammalian cell, preferably a primate mammalian cell, such as a human cell.

[0025] In another preferred embodiment, the cells are stem cells and / or immune cells.

[0026] In another preferred embodiment, the stem cells are induced pluripotent stem cells, embryonic stem cells, or a combination thereof.

[0027] In another preferred embodiment, the immune cells are T cells, NK cells, or a combination thereof.

[0028] In another preferred embodiment, the T cells are primary T cells.

[0029] In another preferred embodiment, the primary T cells are αβ T cells (a population of T cells expressing CD4 and CD8 molecules and positive for CD3).

[0030] In another preferred embodiment, the gene editing composition is a genome editing endonuclease that cuts within a desired target sequence of the cell's genomic DNA and edits the target genomic DNA.

[0031] In another preferred embodiment, the gene editing composition comprises: an RNA-guided endonuclease, guide RNA, and a homologous recombination template.

[0032] In another preferred embodiment, the homologous recombination template is donor DNA containing the donor sequence.

[0033] In another preferred embodiment, the donor DNA is provided by a single-stranded DNA template donor ssODN, an AAV adeno-associated virus template donor, or a plasmid template donor.

[0034] In another preferred embodiment, the homologous recombination template is a homologous directional repair (HDR) template.

[0035] In another preferred embodiment, the RNA-guided endonuclease is Cas9.

[0036] In another preferred embodiment, the Cas9 is selected from the group consisting of Cas9, Cas9 homologues, modified Cas9, or combinations thereof.

[0037] In another preferred embodiment, the Cas9 is provided by Cas9 mRNA, Cas9 protein, or a plasmid expressing Cas9.

[0038] In another preferred embodiment, the Cas9 of the present invention contains two independent nuclease domains homologous to HNH and RuvC endonucleases, and can cleave the double strand of DNA under the guidance of sgRNA to generate double-strand breaks (DSBs).

[0039] In another preferred embodiment, the guide RNA comprises clusters of regularly spaced short palindromic repeats and tracrRNA.

[0040] In another preferred embodiment, the guide RNA is sgRNA.

[0041] In another preferred embodiment, the sgRNA is generated by means selected from the group consisting of: direct synthesis of sgRNA; in vitro annealing of commercially available crRNA and tracrRNA to form gRNA; sgRNA plasmid; or combinations thereof.

[0042] In this invention, the electroporation of the stem cells into sgRNA plasmids and the formation of sgRNA include the following steps: synthesizing two oligonucleotides of sgRNA, annealing them to form a double strand, linking them to the px459 vector, and verifying the results by Sanger sequencing.

[0043] In this invention, the electroporation of primary αβT cells involves incubating sgRNA with Cas9 protein in vitro to form a stable ribonucleoprotein (RNP) complex that can be electroporated. This is used for the electroporation of human T cells.

[0044] In another preferred embodiment, the homologous recombination template is donor DNA containing the donor sequence (i.e., homologous directed repair template, HDRT).

[0045] In another preferred embodiment, the donor sequence is flanked by a 5' homologous arm and a 3' homologous arm, wherein the 5' homologous arm is homologous to the 5' target sequence located upstream of the insertion site on the genome, and the 3' homologous arm is homologous to the 3' target sequence located downstream of the insertion site on the genome.

[0046] In another preferred embodiment, the donor DNA is inserted into the genome of the cell at the insertion site via homology-directed repair.

[0047] In another preferred embodiment, the insertion site can be located at any desired site, as long as the RNA-guided endonuclease is designed to have a cleaving function at that site.

[0048] In another preferred embodiment, the insertion site is B2M, TRAC, CD3, or a combination thereof.

[0049] In another preferred embodiment, the stem cell insertion site is preferably B2M.

[0050] In another preferred embodiment, the T cell insertion site is TRAC, CD3, or a combination thereof.

[0051] In another preferred embodiment, the donor DNA is a double-stranded DNA template donor (dsDNA) or a pUC57 plasmid template donor.

[0052] In another preferred embodiment, the HDRT of the stem cells is a pUC57 plasmid template.

[0053] In another preferred embodiment, the primary T cell HDRT is dsDNA.

[0054] In another preferred embodiment, the H3K9me3 demethyltransferase inhibitor is selected from the group consisting of CP-2 peptide, IOX1, or combinations thereof.

[0055] In another preferred embodiment, the active ingredient further includes: (b) an inhibitor of the non-homologous end junction repair pathway (NHEJ inhibitor).

[0056] In another preferred embodiment, the NHEJ inhibitor is a small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway.

[0057] In another preferred embodiment, the small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway is selected from the group consisting of M3814, NU7441, NU7026, or combinations thereof.

[0058] In another preferred embodiment, the active ingredients are CP-2 peptide and IOX1.

[0059] In another preferred embodiment, the active ingredients of the reagent are CP-2 polypeptide and M3814.

[0060] In another preferred embodiment, the active ingredients of the reagent are IOX1 and M3814.

[0061] In another preferred embodiment, the active ingredients of the reagent are: CP-2 peptide, IOX1 and M3814.

[0062] In another preferred embodiment, the effective concentration range of CP-2 is 1–50 μM.

[0063] In another preferred embodiment, the effective concentration range of IOX1 is 1–80 μM.

[0064] In another preferred embodiment, the effective concentration range of the M3814 is 0.01–5 μM.

[0065] In a third aspect of the invention, a reagent for improving gene knock-in efficiency in cells is provided, the reagent comprising the following active ingredients:

[0066] (a) Inhibitors of histone H3 lysine 9-methyltransferase (H3K9me3) demethylation; and

[0067] (b) Inhibitors of the non-homologous end junction repair pathway (NHEJ inhibitors).

[0068] In another preferred embodiment, the H3K9me3 demethyltransferase inhibitor is selected from the group consisting of CP-2 peptide, IOX1, or combinations thereof.

[0069] In another preferred embodiment, the NHEJ inhibitor is a small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway.

[0070] In another preferred embodiment, the small molecule inhibitor that promotes DNA-PKcs in the NHEJ repair pathway is selected from the group consisting of M3814, NU7441, NU7026, or combinations thereof.

[0071] In another preferred embodiment, the active ingredient of the reagent is selected from the group consisting of: CP-2 peptide and M3814; IOX1 and M3814; CP-2 peptide, IOX1 and M3814.

[0072] In another preferred embodiment, the active ingredients of the reagent are CP-2 polypeptide and M3814.

[0073] In another preferred embodiment, the active ingredients of the reagent are IOX1 and M3814.

[0074] In another preferred embodiment, the active ingredients of the reagent are: CP-2 peptide, IOX1 and M3814.

[0075] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0076] In another preferred embodiment, the method is an in vitro method.

[0077] In a fourth aspect of the invention, a reagent combination is provided, comprising:

[0078] (i) A first reagent, wherein the first reagent is a reagent for improving gene knock-in efficiency, the reagent for improving gene knock-in efficiency comprising:

[0079] (a) Inhibitors of histone H3 lysine 9-methyltransferase (H3K9me3) demethylation; and

[0080] (ii) A second reagent, which is a reagent for performing CRISPR gene editing.

[0081] In another preferred embodiment, the gene editing includes gene knock-in.

[0082] In another preferred embodiment, the reagent for improving gene knock-in efficiency further includes:

[0083] (b) Inhibitors of the non-homologous end junction repair pathway (NHEJ inhibitors).

[0084] In another preferred embodiment, the second reagent comprises one or more reagents selected from the group consisting of:

[0085] (c1) Cas9 nuclease, the coding sequence of Cas9 nuclease, or a vector expressing Cas9 nuclease, or a combination thereof;

[0086] (c2) sgRNA, and a vector for producing the sgRNA;

[0087] (c3) Templates for homology-directed repair: single-stranded nucleotide sequences or plasmid vectors.

[0088] In another preferred embodiment, the reagent for performing CRISPR gene editing includes a ribonucleoprotein (RNP) complex.

[0089] In another preferred embodiment, the reagent for performing CRISPR gene editing also includes a homologous targeted repair template.

[0090] In another preferred embodiment, the reagent for performing CRISPR gene editing is a gene editing composition comprising the following components: RNA-guided endonuclease and guide RNA.

[0091] In another preferred embodiment, the gene editing composition further comprises a homologous recombination template.

[0092] In another preferred embodiment, the homologous recombination template is donor DNA containing the donor sequence (i.e., homologous directed repair template, HDRT).

[0093] In another preferred embodiment, the donor sequence is flanked by a 5' homologous arm and a 3' homologous arm, wherein the 5' homologous arm is homologous to the 5' target sequence located upstream of the insertion site on the genome, and the 3' homologous arm is homologous to the 3' target sequence located downstream of the insertion site on the genome.

[0094] In another preferred embodiment, the donor DNA is provided by a single-stranded DNA template donor ssODN, an AAV adeno-associated virus template donor, or a plasmid template donor.

[0095] In another preferred embodiment, the RNA-guided endonuclease is Cas9.

[0096] In another preferred embodiment, the guide RNA is sgRNA.

[0097] In a fifth aspect of the invention, the use of the reagent combination as described in the fourth aspect of the invention is provided for preparing a kit to improve gene knock-in efficiency in cells.

[0098] In another preferred embodiment, the kit further includes a label or instruction manual indicating that the kit is used to improve the efficiency of gene knock-in in cells.

[0099] In another preferred embodiment, the specification describes the method of the present invention for improving the efficiency of gene knock-in in cells.

[0100] In another preferred embodiment, the cells are human and non-human mammalian cells.

[0101] In another preferred embodiment, the cells include primary cells and passaged cells.

[0102] In another preferred embodiment, the cells are stem cells and / or immune cells.

[0103] In another preferred embodiment, the stem cells are induced pluripotent stem cells, embryonic stem cells, or a combination thereof.

[0104] In another preferred embodiment, the immune cells are T cells, NK cells, or a combination thereof.

[0105] In another preferred embodiment, the T cells are primary T cells.

[0106] In a sixth aspect of the invention, a kit is provided, comprising:

[0107] (i) a first container, and a first reagent located within the first container, wherein the first reagent is a reagent for improving gene knock-in efficiency, and the reagent for improving gene knock-in efficiency includes:

[0108] (a) Inhibitors of histone H3 lysine 9-methyltransferase (H3K9me3) demethylation; and

[0109] (ii) A second container, and a second reagent located within the second container, the second reagent being a reagent for performing CRISPR gene editing.

[0110] In another preferred embodiment, the gene editing includes gene knock-in.

[0111] In another preferred embodiment, the reagent for improving gene knock-in efficiency further includes:

[0112] (b) Inhibitors of the non-homologous end junction repair pathway (NHEJ inhibitors).

[0113] In another preferred embodiment, the reagent for performing CRISPR gene editing includes a ribonucleoprotein (RNP) complex.

[0114] In another preferred embodiment, the reagent for performing CRISPR gene editing also includes a homology-directed repair template (HDRT).

[0115] In another preferred embodiment, the reagent for performing CRISPR gene editing is a gene editing composition comprising the following components: RNA-guided endonuclease and guide RNA.

[0116] In another preferred embodiment, the gene editing composition further comprises a homologous recombination template.

[0117] In another preferred embodiment, the homologous recombination template is donor DNA containing the donor sequence (i.e., homologous directed repair template, HDRT).

[0118] In another preferred embodiment, the donor sequence is flanked by a 5' homologous arm and a 3' homologous arm, wherein the 5' homologous arm is homologous to the 5' target sequence located upstream of the insertion site on the genome, and the 3' homologous arm is homologous to the 3' target sequence located downstream of the insertion site on the genome.

[0119] In another preferred embodiment, the donor DNA is provided by a single-stranded DNA template donor ssODN, an AAV adeno-associated virus template donor, or a plasmid template donor.

[0120] In another preferred embodiment, the RNA-guided endonuclease is Cas9.

[0121] In another preferred embodiment, the guide RNA is sgRNA.

[0122] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0123] Figure 1 The hPSC electro-spinning process flow chart is shown.

[0124] Figure 2 The results show that Sanger sequencing validated the accurate insertion of the B2M site of H9 and human iPSC into the HLA-E gene sequence.

[0125] Figure 3 The gene knock-in efficiency of flow cytometry is shown. iPSC_Ctrl is the control group, iPSC_KI is the knock-in cell group without inhibitor treatment, and iPSC_KI_CI is the experimental group of cells treated with CP-2 and IOX1 after electroporation.

[0126] Figure 4 The study showed that treatment with CP-2 and IOX1 inhibitors improved gene knock-in efficiency by 5.68-fold in iPSC cells and by 2.33-fold in H9 cells.

[0127] Figure 5 The EB spheres of iPSCs without inhibitor treatment are shown compared with those treated with CP-2 and IOX1.

[0128] Figure 6The gene knock-in efficiency of the TRAC gene locus in T cells at different time points is shown. T_Ctrl represents electroporation of T cells only; T_KO represents co-electroporation of T cells with a mixture of RNP; T_KI_001 represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells; T_KI_002(M) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by treatment with M3814 small molecules; T_KI_003(I) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by treatment with IOX1 small molecules; T_KI_004(MI) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by treatment with M3814 and IOX1 small molecules.

[0129] Figure 7 The results showed that the gene knock-in efficiency of T cells treated with inhibitors was higher than that of untreated T cells. The addition of M3814 to T cells (T_KI_002) increased gene knock-in efficiency by 1.5-3.4 times; the addition of IOX1 to T cells (T_KI_003) increased gene knock-in efficiency by 1.5-3.4 times; and the combination of IOX1 and M3814 (T_KI_004) increased gene knock-in efficiency by 3-5 times.

[0130] Figure 8 The cell viability of different experimental groups was shown at different time points after T cell TRAC site editing.

[0131] Figure 9 The gene knock-in efficiency of the CD3 gene locus on T cells at different time points is shown. T_Ctrl represents electroporation of T cells only; T_KO represents co-electroporation of T cells with a mixture of RNP; T_KI_001 represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells; T_KI_002(M) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by treatment with M3814 small molecules; T_KI_003(I) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by treatment with 10X1 small molecules.

[0132] Figure 10 The results showed that the gene knock-in efficiency was 1.9-3.2 times higher in the T cells with added IOX1 compared to the T cells without the inhibitor.

[0133] Figure 11 The cell viability of different experimental groups was shown at different time points after CD3 site editing of T cells.

[0134] Figure 12The gene knock-in efficiency of the CD3 gene locus on T cells at different time points is shown. T_Ctrl represents electroporation of T cells only; T_KO represents co-electroporation of T cells with a mixture of RNP; T_KI_001 represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells; T_KI_002(I) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by IOX1 treatment; T_KI_003(C) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by CP-2 treatment; T_KI_004(CI) represents co-electroporation of T cells with a mixture of RNP, donor template dsDNA, and T cells, followed by CP-2 and IOX1 treatment.

[0135] Figure 13 The results showed that the gene knock-in efficiency of T cells treated with inhibitors was higher than that of untreated T cells. The addition of IOX1 to T cells (T_KI_002) increased gene knock-in efficiency by 2.1–3.2 times; the addition of CP-2 to T cells (T_KI_003) increased gene knock-in efficiency by 1.3–2.4 times; and the addition of CP-2 and IOX1 in combination to T cells (T_KI_004) increased gene knock-in efficiency by 3.1–3.8 times.

[0136] Figure 14 The cell viability of different experimental groups was shown at different time points after CD3 site editing of T cells. Detailed Implementation

[0137] Through extensive and in-depth research and screening, the inventors unexpectedly discovered that inhibitors of H3K9me3 demethyltransferase (including CP-2 and / or IOX1) can effectively improve gene knock-in efficiency without affecting cell viability. Experiments conducted in this invention show that, in both stem cell and T cell experiments, the addition of CP-2 and / or IOX1 significantly improves gene knock-in efficiency compared to the group without inhibitors. Furthermore, the combined use of CP-2 and IOX1 significantly enhances efficiency than their individual use. Based on these findings, this invention was completed.

[0138] Specifically, the method of the present invention uses the CP-2 polypeptide, a histone H3 lysine trimethylation (H3K9me3) demethyltransferase inhibitor, the IOX1 chemical small molecule, the M3814 small molecule inhibitor of the non-homologous end junction repair pathway, and a combination thereof. First, in electroporation experiments in human pluripotent induced stem cells (iPSCs) and human embryonic stem cells (H9), it was demonstrated that the addition of CP-2 and IOX1 after cell electroporation significantly improves gene knock-in efficiency.

[0139] Subsequently, in T-cell electroporation experiments at the TRAC site, it was found that using IOX1 alone improved gene knock-in efficiency comparable to using M3814 alone. Furthermore, the combination of IOX1 and M3814 significantly increased gene knock-in efficiency in human cells due to its much higher knock-in efficiency compared to using M3814 or an IOX1 inhibitor alone. In CD3 site electroporation experiments, it was found that using IOX1 as a histone modification inhibitor alone and using CP-2 alone both improved gene knock-in efficiency. The combined use of CP-2 and IOX1 also improved gene knock-in efficiency, with higher efficiency than either alone.

[0140] Therefore, this invention provides a new method to improve the efficiency of gene knock-in, namely, the use of an inhibitor of H3K9me3 demethyltransferase alone, and / or in combination with an inhibitor of non-homologous end linkage repair.

[0141] the term

[0142] To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0143] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0144] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0145] As used herein, unless otherwise stated, any concentration range, percentage range, proportion range, or integer range shall be understood to include any integer value within the range and, where appropriate, its fractional value (e.g., one-tenth and one-hundredth of an integer).

[0146] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0147] The relationship between inhibitors of the non-homologous end repair pathway and improved gene knock-in efficiency

[0148] DNA double-strand breaks (DSBs) are primarily repaired through two competing pathways: non-homologous end joining (NHEJ) and homologous-directed repair (HDR). In NHEJ, the proteins that first bind to the DNA ends are Ku70 / Ku80, followed by the catalytic subunits of DNA protein kinases (DNA-pkcs). These kinases phosphorylate themselves and other downstream effectors at the repair site, leading to the ligation of DNA ends via DNA ligase IV4. If the NHEJ pathway is inhibited, the cell initiates other repair pathways, resulting in an increased frequency of HDR. Therefore, inhibiting molecules associated with the NHEJ pathway can improve gene knock-in efficiency (Reference: 10.1038 / s41467-018-04609-7).

[0149] Histone H3 lysine 9 demethyltransferase inhibitor (H3K9me3)

[0150] H3K9me3 demethyltransferases are a class of enzymes that catalyze the removal of the trimethylation (H3K9me3) label from lysine nine on histone H3. These enzymes play a crucial role in epigenetic regulation, modulating gene expression by affecting chromatin structure and function. H3K9me3 demethyltransferase inhibitors are compounds that inhibit the activity of H3K9me3 demethyltransferases. Currently, there are no reported studies on whether inhibiting H3K9me3 demethyltransferase activity improves gene knock-in efficiency.

[0151] CP-2 and IOX1 are both known inhibitors in the art that can inhibit the activity of H3K9me3 demethyltransferase, thereby maintaining a high level of histone methylation.

[0152] CP-2

[0153] Macrocyclic peptides (CP-2) are polypeptides. It has been reported that the Arg6 residue in the CP-2 sequence can compete with histone demethyltransferase, preventing it from binding to methylated histone lysine residues, thereby inhibiting the demethylation activity of the enzyme and maintaining a high level of histone methylation (reference: doi:10.1038 / ncomms14773).

[0154] IOX1

[0155] 5-Carboxy-8-hydroxyquinoline (IOX1) is a potent broad-spectrum inhibitor of 2OG oxygenases, including demethylases of the JmjC family. Studies have shown that IOX1 treatment can effectively inhibit the activity of related demethylases, leading to a significant increase in H3K9me3 levels (Reference: doi:10.1002 / cmdc.201300428).

[0156] Gene knock-in

[0157] Gene knock-in is a gene editing technology that uses the principle of homologous recombination to transfer exogenous functional genes (which may not have been present in the original genome or have been inactivated) into cells, where they recombine with homologous sequences in the genome and are inserted into the genome, enabling the gene to be stably expressed in the host cell or organism.

[0158] Gene knock-in systems typically include the following key components:

[0159] Target gene: This refers to the foreign gene that is desired to be inserted into the genome. This gene can be a new gene with a specific function, or it can be a modified endogenous gene used to restore or enhance its function.

[0160] Homologous arms: Homologous arms are DNA fragments that are highly homologous to the target genome sequence. They are located on either side of the gene to be inserted into the vector. The role of homologous arms is to guide the gene in the vector to be correctly inserted into the target location in the genome.

[0161] Vector: A vector is a DNA molecule (e.g., a plasmid) that can carry and deliver foreign genes. In gene knock-in, vectors are typically designed to contain homologous arms and the gene to be inserted.

[0162] Gene editing tools: The CRISPR / Cas9 system is one of the most commonly used gene editing tools. Guided by gRNA (small guide RNA), the Cas9 protein cuts the target DNA site, creating a double-strand break (DSB). Subsequently, the cell uses homology-directed repair (HDR) to repair the DSB using a donor DNA template containing the knock-in gene, thereby integrating the knock-in gene into the genome.

[0163] Screening and identification methods: To determine whether gene knock-in was successful, specific screening and identification methods are usually required. For example, the expression regulation of the target gene can be marked and the target gene can be tracked by detecting the expression product of the reporter gene. In addition, drug screening markers (such as Puro, Neo, BSD, etc.) can be used to screen cells with successfully knocked-in genes.

[0164] The present invention provides a method for improving gene knock-in efficiency.

[0165] In this invention, a novel method for improving gene knock-in efficiency is provided, comprising: (s1) after introducing a gene editing composition into target cells, adding an active ingredient for co-culturing, thereby improving the gene knock-in efficiency of the cells; the active ingredient comprises: (a) an H3K9me3 demethyltransferase inhibitor.

[0166] In a preferred embodiment, the active ingredient further includes: (b) an inhibitor of the non-homologous end junction repair pathway (NHEJ inhibitor).

[0167] In a preferred embodiment, the method further includes the following steps:

[0168] (s2) After co-culturing the active ingredient with the cells into which the gene editing composition has been transferred for a period of time, the active ingredient is removed.

[0169] In a preferred embodiment, the gene editing composition comprises: an RNA-guided endonuclease, guide RNA, and a homologous recombination template.

[0170] In some implementations, RNA-guided endonucleases are introduced into eukaryotic cells either as proteins or as nucleic acids that have been edited with RNA-guided endonucleases, such as messenger RNA (mRNA) or cDNA. The nucleic acids can be delivered as part of a larger construct, such as a plasmid or viral vector, or, for example, directly via electroporation, lipid vesicles, viral transporters, and microinjection. RNA-mediated endonucleases can be introduced into cells by a variety of methods known in the art, including transfection, calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, use of gene guns, use of DNA vector transporters, and biological bombs (e.g., particle bombardment).

[0171] In some embodiments, the nucleic acid of the RNA-guided endonuclease can be introduced into cells via transfection (including, for example, transfection via electroporation (i.e., electroporation)). In some embodiments, the nucleic acid of the RNA-guided endonuclease can be introduced into cells via injection.

[0172] In some embodiments, for example, guide RNA (gRNA) may be introduced as RNA or as a plasmid or other nucleic acid vector for editing guide RNA. An RNA-guided endonuclease binds to the gRNA and the target DNA linked thereto and cleaves the chromosome at a designed specific site. Guide RNA (gRNA) can be introduced into cells, for example, by a variety of means known in the art, including transfection, calcium phosphate-DNA coprecipitation, DEAE-glucan-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, use of a gene gun, use of DNA vector transporters, and biological bombardment (e.g., particle bombardment). In some embodiments, the guide RNA comprises crRNA and tracrRNA, which form a complex through hybridization.

[0173] In some embodiments, the gene editing composition used in this invention comprises a ribonucleoprotein (RNP) complex and / or a homology-directed repair template (HDRT). The RNP complex is a complex formed by in vitro incubation of a Cas nuclease protein and sgRNA. In another preferred embodiment, the Cas nuclease is a Cas9 nuclease.

[0174] In some embodiments, the homologous recombination template is donor DNA (HDRT) containing a donor sequence flanked by 5' and 3' homologous arms, wherein the 5' homologous arm is homologous to a 5' target sequence upstream of the insertion site in the genome, and the 3' homologous arm is homologous to a 3' target sequence downstream of the insertion site in the genome. When the donor DNA (HDRT) is a plasmid, the donor plasmid can be introduced into the cell by various means known in the art, including transfection, calcium phosphate-DNA coprecipitation, DEAE-glucan-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, use of a gene gun, use of DNA vector transporters, and biological bombardment (e.g., particle bombardment).

[0175] In some embodiments, the donor sequence size is from about 1 bp to about 100 kbp. In some embodiments, the donor sequence size is between about 1 bp and about 10 bp, between about 10 bp and about 50 bp, between about 50 bp and about 100 bp, between about 100 bp and about 500 bp, between about 500 bp and about 1 kb, between about 1 kb and about 10 kb, between about 10 kb and about 50 kb, between about 50 kb and about 100 kb, or greater than about 100 kb.

[0176] In some implementations, the donor sequence is a foreign gene to be inserted into the chromosome.

[0177] The donor sequence is a modified sequence that replaces the foreign sequence at the target site. For example, the donor sequence may be a gene with the desired mutation and may be used for a foreign gene present on the replacement chromosome. In some embodiments, the donor sequence is a regulatory element. In some embodiments, the donor sequence is a tag or coding sequence encoding a reporter protein and / or RNA. In some embodiments, the donor sequence is inserted into the coding sequence of a target gene within a frame, the target gene allowing the expression of a fusion protein comprising a foreign sequence fused to the N- or C-terminus of the target protein.

[0178] The main advantages of this invention include:

[0179] (a) The gene knock-in method of the present invention has a significantly higher knock-in efficiency than traditional genome editing methods that use RNA-guided endonucleases such as CRISPR-Cas9.

[0180] (b) Compared with the small molecule M3814, H3K9me3 demethyltransferase inhibitors (including CP-2 and IOX1) have a higher safety profile.

[0181] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0182] Example 1: Adding CP-2 and IOXI to improve the efficiency of gene editing (gene knock-in)

[0183] In this embodiment, the efficiency of gene knock-in was verified by knocking in human leukocyte antigen E (HLA-E) molecules at the B2M site and observing the expression of HLA-E at the B2M site.

[0184] 1.1 Experimental Procedure

[0185] (1) Plasmid construction:

[0186] The following plasmids were constructed: B2MsgRNA-pX459 (a plasmid expressing guide RNA and Cas9 endonuclease) and pUC57-HLA-E (homologous recombination template plasmid HDRT).

[0187] The B2MsgRNA-px459 plasmid was constructed using BbSI and T4 ligases, transformed into TOP10F E. coli, and single clones were selected for sequencing verification. Homologous recombination template DNA sequences (two homologous arms and an HLA-E sequence) were synthesized and constructed into the pUC57 vector, and sequenced for verification.

[0188] The sgRNA sequences are shown in Table 1.

[0189] Table 1

[0190] Gene sgRNA sequence SEQ ID NO: B2M ACATGTAAGCAGCATCATGG 1

[0191] (2) Experimental group setup

[0192] In this embodiment, three experimental groups were set up, as follows:

[0193] Control group 1: H9 cells and iPSC cells (electroplated H9 and iPSC cells only);

[0194] Control group 2 (knock-in cell group): B2M-sgRNA-px459 plasmid and pUC57-HLA-E plasmid were electroporated into H9 cells and iPSC cells, respectively.

[0195] Experimental group 3 (knock-in cells with CP-2 and IOX1): B2M-sgRNA-px459 plasmid and pUC57-HLA-E plasmid were electroporated into H9 cells and iPSC cells, respectively. CP-2 and IOX1 were added after plasmid electroporation. After co-culturing for 24 hours, the culture medium was replaced with fresh medium. Due to the natural immunorestriction of H9 and iPSC cells, IFN-γ was added on the fifth day after electroporation and co-cultured for 48 hours.

[0196] (3) Electro-rotation

[0197] The process of electroporating B2M-sgRNA-px459 plasmid and pUC57-HLA-E plasmid into cells is as follows: Figure 1 As shown. First, 4-5 μg of B2M-sgRNA-px459 plasmid and 2-3 μg of pUC57-HLA-E plasmid were mixed in electroporation buffer. The plasmid mixture was then electroporated into stem cells. Seven days after electroporation, 1-2 × 10⁻⁶ cells were collected. 6iPSCs were used to extract genomic DNA. The iPSCs were then digested with 0.5 mM EDTA working solution, washed with PBS, and centrifuged to precipitate the DNA. Genomic DNA was extracted using a Takara gene extraction kit. PCR was performed using primers targeting the outer left and right homologous arms of the genome, using KOD polymerase. The PCR thermal cycling program was as follows: 98℃ for 10 s, 60℃ for 5 s, and 68℃ for 30 s, for 34 cycles. Finally, the PCR products were validated by electrophoresis on a 0.5% agarose gel (the PCR product without knock-in was approximately 2000 bp, and the PCR product after homologous recombination repair was approximately 3000 bp). The amplified products were then recovered from the gel.

[0198] like Figure 2 As shown, the experimental group with HLA-E molecule knock-in produced two PCR product bands. The band with the longer nucleic acid size is the band with HLA-E molecule knock-in. The longer PCR product was recovered by gel electrophoresis and the insertion of HLA-E molecule was verified by Sanger sequencing.

[0199] 1.2 Experimental Results

[0200] Seven days after plasmid electroporation into H9 and iPSC cells, the gene knock-in efficiency was detected by flow cytometry.

[0201] In this invention, gene knock-in efficiency is represented by detecting low expression levels of HLA-A / B / C (B2M knockout affects the expression levels of HLA- / A / B / C recruited by B2M) and overexpression levels of HLA-E molecules. Figure 3 and Figure 4 It can be seen that CP-2 and IOX1 (histone demethyltransferase inhibitors) increased gene knock-in efficiency by 5.68 times in iPSC cells and by 2.33 times in H9 cells, proving that CP-2 and IOX1 can significantly improve gene knock-in efficiency.

[0202] Example 2 Cytotoxicity Study

[0203] To demonstrate that the gene knock-in process in Example 1 had no toxic side effects on cells, this example uses an embryoid body (EB) spheroidization experiment to identify whether CP-2 and IOX1 (histone demethyltransferase inhibitor) treatment affects the stemness of iPSCs.

[0204] The specific experimental steps are as follows: iPSC cells from experimental group 2 after electroporation in Example 1 and iPSC cells from experimental group 3 after electroporation and the addition of CP-2 and IOX1 were taken. The iPSC cell confluence was approximately 70-80%. Cells were digested with StemProAccutase for 6 min, washed twice with calcium- and magnesium-free phosphate-buffered saline (D-PBS), centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Cells were resuspended in EB medium (E8 medium + 10 μM MY27362), and 8000 cells were seeded per well in 96-well ultra-low adsorption U-shaped plates. The EB medium was changed every other day.

[0205] The results are as follows Figure 5 As shown, on days 2 and 8 of EB culture, the inhibitor treatment did not affect the spheroidization ability of iPSCs compared with the control group (experimental group 2).

[0206] Example 3: Validating the effects of small molecule inhibitors CP-2, IOX1, and M3814 on T cell gene knock-in in primary αβT cells.

[0207] In this embodiment, the gene editing sites of primary αβT cells were the TRAC site and the CD3 site. The gene editing system was the RNP system (synthesizing sgRNA and Cas9 nuclease). The knock-in HDRT was CAR-B7H3. The gene knock-in efficiency was detected by flow cytometry analysis of cell populations that simultaneously expressed TRAC knockout and CAR-B7H3.

[0208] 3.1 Preparation of the knock-in system:

[0209] The sgRNA sequences for TRAC and CD3 were synthesized by GenScript. The Cas9 nuclease used was TrueCut Cas9 Protein v2 from Thermofisher. The HDRT plasmids for the TRAC and CD3 sites were pUC57-TRAC-CAR-B7H3 and pUC57-CD3-CAR-B7H3, respectively. The sgRNA sequences are shown in Table 2.

[0210] Table 2

[0211] Gene sgRNA sequence SEQ ID NO: TRAC TCAGGGTTCTGGATATCTGT 2 CD3 AGGGAAAGGACAAGATGAAG 3

[0212] Small molecule inhibitors: CP-2, IOX1, and M3814;

[0213] Preparation of RNP mixtures:

[0214] Dissolve the purchased RNA (sgRNA) in RNase-free sterile water and adjust the final concentration to 100 μM. Add 100 pmol of sgRNA and 50 pmol of Cas9 protein (purchased from Thermofisher) to the electroporation buffer and incubate at room temperature for 15 min to form the RNP complex.

[0215] Preparation of donor template dsDNA: Upstream and downstream primers for the 5' and 3' ends of the TRAC and CD3 homologous arm sequences were designed. Using the pUC57 homologous recombinant plasmid as the donor template, amplification was performed using KOD enzyme in a PCR thermal cycler. The reaction program was as follows: 98℃ for 10s, 60℃ for 5s, and 68℃ for 30s, for 34 cycles. PCR products were validated and recovered by electrophoresis on a 1% agarose gel. dsDNA was recovered using an Omega gel extraction kit, with the dsDNA concentration controlled at 1-2 μg / μL.

[0216] 3.2 Gene knock-in

[0217] The experimental groups are divided as follows:

[0218] Experimental group 1: Detection of gene knock-in efficiency of TRAC gene locus in T cells at different time points (with IOX1 and / or M3814 added);

[0219] Experimental Group 2: Detection of gene knock-in efficiency of CD3 gene locus in T cells at different time points (with IOX1 or M3814 added);

[0220] Experimental group 3: Detection of gene knock-in efficiency of CD3 gene locus in T cells at different time points (with CP-2 and / or IOX1 added);

[0221] The grouping of Experimental Group 1 is as follows:

[0222] T_Ctrl: Electroporation of T cells only;

[0223] T_KO: T cells co-electroporated with a mixture of T cells and RNPs;

[0224] T_KI_001: A mixture of T cells and RNP, with donor template dsDNA co-electroporated with T cells;

[0225] T_KI_002(M): This is a mixture of T cells and RNP, with donor template dsDNA and T cells co-electrolyzed, followed by treatment with M3814 small molecules after electroporation;

[0226] T_KI_003(I): T cells and RNP mixture, donor template dsDNA and T cells co-electropometry, followed by IOX1 small molecule treatment;

[0227] T_KI_004(MI): A mixture of T cells and RNP, donor template dsDNA and T cells were co-electrolyzed, and then treated with M3814 and IOX1 small molecules after electroporation.

[0228] The grouping of Experimental Group 2 is as follows:

[0229] T_Ctrl: Electroporation of T cells only;

[0230] T_KO: T cells co-electroporated with a mixture of T cells and RNPs;

[0231] T_KI_001: A mixture of T cells and RNP, with donor template dsDNA co-electroporated with T cells;

[0232] T_KI_002(M): This is a mixture of T cells and RNP, with donor template dsDNA and T cells co-electrolyzed, followed by treatment with M3814 small molecules after electroporation;

[0233] T_KI_003(I): T cells and RNP mixture, donor template dsDNA and T cells co-electropometry, followed by IOX1 small molecule treatment;

[0234] The groups in Experiment 3 are as follows:

[0235] T_Ctrl: Electroporation of T cells only;

[0236] T_KO: T cells co-electroporated with a mixture of T cells and RNPs;

[0237] T_KI_001: A mixture of T cells and RNP, with donor template dsDNA co-electroporated with T cells;

[0238] T_KI_002(I): T cells and RNP mixture, donor template dsDNA and T cells co-electropometry, followed by IOX1 small molecule treatment;

[0239] T_KI_003(C): T cells and RNP mixture, donor template dsDNA and T cells co-electropometry, followed by CP-2 small molecule treatment;

[0240] T_KI_004(CI): A mixture of T cells and RNP, donor template dsDNA and T cells co-electropographed, followed by treatment with CP-2 and IOX1 small molecules.

[0241] The gene knock-in method is as follows: The prepared RNP complex, dsDNA and T cells activated for 48 hours (CD3 / CD28 activation) are electroporated together, and the cells are transferred to 96-well plates for further culture.

[0242] 3.3 Results

[0243] (1) Detection method

[0244] Gene knock-in efficiency at the TRAC site was assessed by flow cytometry on days 3 (D3), 5 (D5), 7 (D7), 10 (D10), and 12 (D12) after electroporation. TRAC knockout efficiency was detected using APC-TCRαβ fluorescent dye antibody, and CAR-B7H3 expression level was detected using B7H3-FITC antigen. Similarly, gene knock-in efficiency at the CD3 site was assessed by flow cytometry on days 5, 7, 10, and 12 after electroporation, CD3 knockout efficiency was detected using APC-CD3 fluorescent dye antibody, and CAR-B7H3 expression level was detected using B7H3-FITC antigen.

[0245] (2) Test results

[0246] 1) The gene knock-in results of experimental group 1 are as follows: Figure 6-7 As shown in Table 3-4.

[0247] IOX1 and M3814 inhibitors affected T cell gene knock-in efficiency; the gene knock-in efficiency of T cells treated with inhibitors was higher than that of untreated T cells. In TRAC site gene knock-in, the knock-in efficiencies at different time points for T cells without small molecule inhibitors were 5.97%, 5.63%, 7.56%, 9.31%, and 10.7%, respectively. The knock-in efficiencies at different time points for T cells with M3814 were 15.3%, 16.1%, 20.4%, 28.7%, and 32.6%, respectively. The addition of M3814 to T cells increased gene knock-in efficiency by 1.5–3.4 times, consistent with existing technical literature.

[0248] The gene knock-in efficiency of T cells after electroporation with the addition of the IOX1 inhibitor was 8.98%, 17.7%, 23.7%, 32.4%, and 34% at different time points (Table 3). Figure 7 , Figure 8 As shown in Table 4, compared with the T cell knock-in group without the addition of small molecule inhibitors, the addition of small molecule inhibitor IOX1 to T cells increased gene knock-in efficiency by 1.5-3.4 times while maintaining cell viability, which is comparable to the level of gene knock-in improvement achieved by M3814.

[0249] The gene knock-in efficiency of T cells after electroporation with simultaneous addition of IOX1 and M3814 inhibitors was 18.5%, 25.7%, 35.6%, 47.2%, and 50.7% at different time points (Table 3). Compared with the T cell knock-in group without small molecule inhibitors, the simultaneous addition of IOX1 and M3814 increased the gene knock-in efficiency by 3-5 times, which was much higher than the experimental groups using M3814 or IOX1 alone. This shows that the combined use of these two inhibitors can greatly improve the gene knock-in efficiency and provides a new method for improving gene knock-in efficiency.

[0250] Table 3 Gene knock-in efficiency detected at different time points at the TRAC site.

[0251]

[0252] Table 4. Cell viability detected at different time points at the TRAC site.

[0253]

[0254] 2) The gene knock-in experiment in experimental group 2 also achieved the same effect at the CD3 site.

[0255] like Figure 9 , Figure 10 As shown in Table 5, the knock-in efficiencies detected at different time points in the T cell knock-in group without the addition of small molecule inhibitors were 4.54%, 5.44%, 21.1%, and 25.7%, respectively. Since the T cell donors in this study were highly sensitive to the drug M3814, Figure 10 and Figure 11 The results showed that low cell viability led to reduced gene knock-in efficiency. However, compared with the control group, the knock-in group with added IOX1 maintained good cell viability (Table 6 and...). Figure 11 The knock-in efficiencies detected at different time points were 11.8%, 17.9%, 46.2%, and 49.3%, respectively. Compared with T cells without inhibitors, the gene knock-in efficiency was increased by 1.9-3.2 times, indicating that IOX1 alone can greatly improve gene knock-in efficiency.

[0256] Table 5. Gene knock-in efficiency detected at the CD3 site at different time points.

[0257]

[0258] Table 6. Cell viability detected at different time points at the CD3 site.

[0259]

[0260] 3) The gene knock-in results of experimental group 3 are as follows: Figure 12 , 13As shown in Table 7-8.

[0261] The use of CP-2 and IOX1, both individually and in combination, can also improve gene knock-in efficiency. For example... Figure 12 and Figure 13 The results showed that the knock-in efficiencies at different time points in the T cell knock-in group without small molecule inhibitors were 7.86%, 12.7%, and 18.0% (Table 7). The knock-in efficiencies in the IOX1-treated group were 17.0%, 41.9%, and 51.8%, respectively, representing a 2.1-3.2-fold increase in gene knock-in efficiency. The knock-in efficiencies in the CP-2-treated group were 10.5%, 27.4%, and 43.1%, respectively, representing a 1.3-2.4-fold increase in gene knock-in efficiency. The combination of CP-2 and IOX1 resulted in gene knock-in efficiencies of 24.6%, 49.4%, and 56.3% at different time points, representing a 3.1-3.8-fold increase in gene knock-in efficiency. These results indicate that the use of these two histone modification inhibitors, alone and in combination, does not affect cell viability (Table 8 and 9). Figure 14 At the same time, they can greatly improve gene knock-in efficiency.

[0262] Table 7. Gene knock-in efficiency detected at the CD3 site at different time points.

[0263]

[0264] Table 8. Cell viability detected at different time points at the CD3 site.

[0265]

[0266] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of an active ingredient, characterized in that, The active ingredient is used to prepare a reagent that improves gene knock-in efficiency in cells, and the active ingredient comprises: (a) Inhibitor of histone H3 lysine trimethylation (H3K9me3) demethyltransferase.

2. The use as described in claim 1, characterized in that, The H3K9me3 demethyltransferase inhibitor is selected from the group consisting of CP-2 peptide, IOX1, or combinations thereof.

3. The use as described in claim 1, characterized in that, The active ingredient also includes: (b) an inhibitor of the non-homologous end junction repair pathway (NHEJ inhibitor).

4. The use as described in claim 3, characterized in that, The NHEJ inhibitors are selected from the following group: M3814, NU7441, NU7026, or combinations thereof.

5. A method for improving gene knock-in efficiency in cells in vitro in a non-diagnostic and non-therapeutic manner, characterized in that, The method includes: (s1) After introducing the gene editing composition into cells, an active ingredient is added for co-culturing, thereby improving the efficiency of gene knock-in in the cells; the active ingredient includes: (a) H3K9me3 demethyltransferase inhibitor.

6. The method as described in claim 5, characterized in that, The gene editing composition comprises: an RNA-guided endonuclease, guide RNA, and a homologous recombination template.

7. A reagent for improving gene knock-in efficiency in cells, characterized in that, The reagent includes the following active ingredients: (a) Inhibitors of histone H3 lysine 9-methyltransferase (H3K9me3) demethylation; and (b) Inhibitors of the non-homologous end junction repair pathway (NHEJ inhibitors).

8. A reagent combination, characterized in that, include: (i) A first reagent, wherein the first reagent is a reagent for improving gene knock-in efficiency, the reagent for improving gene knock-in efficiency comprising: (a) Inhibitor of histone H3 lysine trimethylation (H3K9me3) demethyltransferase; and (ii) A second reagent, which is a reagent for performing CRISPR gene editing.

9. The use of the reagent combination as described in claim 8, characterized in that, This kit is used to prepare a solution for improving gene knock-in efficiency in cells.

10. A reagent kit, characterized in that, include: (i) a first container, and a first reagent located within the first container, said first reagent being a reagent for improving gene knock-in efficiency, said reagent for improving gene knock-in efficiency comprising: (a) Inhibitor of histone H3 lysine trimethylation (H3K9me3) demethyltransferase; and (ii) A second container, and a second reagent located within the second container, the second reagent being a reagent for performing CRISPR gene editing.