Keratinase mutant with improved enzyme activity and substrate specificity and use thereof

Abstract

The application provides a keratinase mutant with improved enzyme activity and substrate specificity and an application thereof, and introduces mutations into a parent keratinase gene through site-directed mutagenesis technology, and obtains mutants DV1 and DV2 with improved K:C ratio and specific activity through a screening of a Bacillus subtilis expression system.The amino acid sequences of the keratinase mutants DV1 and DV2 are shown as SEQ ID NO.3 and SEQ ID NO.5 respectively, and the keratinase mutants DV1 and DV2 obtained by the application have stronger affinity and catalytic efficiency for the structurally compact keratin substrate compared with the original bacteria ker, and can more effectively break the strong structure of feather keratin while maintaining the basic protein hydrolysis capacity.Therefore, the application can be applied to the biological conversion of keratin waste such as feathers to generate high-quality feed protein raw materials, and has a good market application prospect.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a keratinase mutant with enhanced enzyme activity and substrate specificity and its applications. Background Technology

[0002] Keratinases are proteases that can efficiently degrade keratin and have important applications in the feed industry. Poultry feathers and other keratin waste products are high in crude protein and have a relatively complete amino acid composition, making them a high-quality protein feed resource. However, natural keratin has a dense structure containing numerous disulfide bonds and hydrophobic interactions, making it difficult to be degraded by conventional proteases. Therefore, obtaining enzyme preparations that can efficiently hydrolyze feather keratin is of great significance for developing new protein feed ingredients and alleviating protein resource shortages.

[0003] One of the key indicators for evaluating the performance of keratinase is its catalytic specificity for different substrates. Casein, a loosely structured and easily hydrolyzed protein, is often used as a general substrate for determining the basic activity of proteases; while natural feather keratin, with its dense structure, is an ideal substrate for evaluating the practical application capabilities of keratinase. The activity ratio (K:C, i.e., the ratio of keratinase activity to casein activity) can effectively reflect the relative affinity and degradation efficiency of the enzyme for keratin substrates. The higher the ratio, the stronger the substrate specificity of the enzyme for natural keratin, and the greater its potential for applications in feather degradation.

[0004] Bacillus subtilis, as a commonly used expression host for feed enzyme preparations, possesses advantages such as a clear genetic background, strong protein secretion capacity, high safety, and no codon bias, making it an ideal platform for heterologous expression and industrial production of keratinase. Therefore, developing keratinase mutants with significantly improved K:C ratios based on the Bacillus subtilis expression system to enhance keratin degradation catalytic efficiency has significant practical implications and broad application prospects for improving feather bioconversion efficiency, developing novel feed protein resources, and promoting cost reduction and efficiency improvement in the aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide a keratinase mutant with enhanced enzyme activity and substrate specificity and its application. This invention uses site-directed mutagenesis to molecularly modify the keratinase gene derived from Bacillus licheniformis, and expresses it in Bacillus subtilis. Through primary screening in milk agar plates and secondary screening by enzyme activity assay, keratinase mutants DV1 and DV2 with enhanced K:C ratio and specific activity were obtained.

[0006] To achieve the above-mentioned objectives, the present invention employs the following technical solution: The present invention provides a keratinase mutant DV1, the amino acid sequence of which is shown in SEQ ID NO.3, obtained by changing alanine at position 307 of the amino acid sequence shown in SEQ ID NO.1 to valine.

[0007] The present invention provides the encoding gene of the keratinase mutant DV1, the nucleotide sequence of which is shown in SEQ ID NO.4.

[0008] This invention provides a keratinase mutant DV2, whose amino acid sequence is shown in SEQ ID NO.5. It is obtained by changing alanine at position 307 to valine and glutamic acid at position 216 to aspartic acid in the amino acid sequence shown in SEQ ID NO.1.

[0009] The present invention provides the encoding gene of the keratinase mutant DV2, the nucleotide sequence of which is shown in SEQ ID NO. 6.

[0010] The present invention further provides a recombinant vector and a recombinant strain containing the encoding genes of the aforementioned keratinase mutants DV1 and DV2.

[0011] The present invention further provides a fermentation broth containing the aforementioned keratinase mutants DV1 and / or DV2.

[0012] The present invention further provides the application of the aforementioned keratinase mutants DV1 and / or DV2 in the preparation of feed additives that enhance enzyme activity and substrate specificity.

[0013] Furthermore, the keratinase hydrolysis conditions for the keratinase mutants DV1 and DV2 are: pH 10, 55℃, 1 h; and the casein hydrolysis conditions are: pH 10, 55℃, 10 min.

[0014] Furthermore, the K:C value, specific activity, and catalytic efficiency of the keratinase mutants DV1 and DV2 are all improved, thereby increasing the digestibility of protein in animal feed.

[0015] Compared with existing technologies, the advantages and technical effects of this invention are as follows: This invention uses the keratinase gene Ker (SEQ ID NO.2) as a template and performs site-directed mutagenesis to molecularly modify it, causing nucleotide mutations to obtain the coding gene of the Ker mutant. Using pWB980 (commercially available) as an expression vector, a recombinant plasmid carrying the mutant gene is constructed, and Bacillus subtilis SCK6 (commercially available) is used as the host to express the mutant protein. The mutant strain is plated on milk plates, and the production zone on the plates is observed. Positive mutants are preliminarily screened. Shake-flask fermentation is performed, and the keratinase activity and casein activity are measured. The K:C ratio is calculated, and the protein is purified to determine the specific activity of keratinase and the catalytic efficiency of enzyme kinetics.

[0016] This invention obtained keratinase mutants DV1 and DV2 through mutation screening. Compared with the original Ker, these mutants exhibit stronger affinity and catalytic efficiency for dense keratin substrates, and can more effectively break down the rigid structure of feather keratin while maintaining the basic protein hydrolysis ability. Therefore, they can be applied to the bioconversion of keratin waste such as feathers to generate high-quality feed protein raw materials, showing good market application prospects. Attached Figure Description

[0017] Figure 1 A flowchart for constructing a recombinant expression vector; Figure 2 The results of agarose gel electrophoresis for each target fragment; Figure 3 The results were validated by PCR of the recombinant bacterial culture. Figure 4 Results of keratinase activity and alkaline protease activity in mutants and wild-types; Figure 5 The ratio of keratinase activity to casein activity (K:C value) for mutants and wild-types. Figure 6 Results of keratinase specific activity for mutants and wild-types. Detailed Implementation

[0018] The following embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications may be made without departing from the technical solutions described in the claims. The protection and scope of the claims of the present invention are not limited to the examples provided.

[0019] Solution preparation: LB liquid medium: Yeast extract 5 g, Tryptone 10 g, NaCl 10 g, add 1 L deionized water, autoclave at 121℃ for 30 min.

[0020] Milk solid culture medium: Dissolve 20 g of skim milk powder in 400 ml of deionized water and autoclave at 108°C for 10 min. Add 20 g of agar powder to 600 ml of deionized water and autoclave at 120°C for 30 min. Mix the two solutions after sterilization.

[0021] 50 mg / mL kanamycin solution: Dissolve 5 g kanamycin sulfate in 85 ml of ultrapure water, bring the volume to 100 ml in a volumetric flask, sterilize with a 0.22 μM filter membrane, dispense, and store at -20°C.

[0022] Casein substrate: Weigh 1 g of casein, moisten it with a small amount of 0.5 mol / L sodium hydroxide solution, add about 80 mL of appropriate amount of pH10 buffer solution, heat and stir in a boiling water bath for 20 min until completely dissolved, cool, transfer to a 100 mL volumetric flask, and dilute to volume with buffer solution.

[0023] Example 1: Construction of expression vector This invention uses the wild-type ker of SEQ ID NO.1 as the original amino acid and mutates it. The nucleotide sequence of the corresponding wild-type coding gene is shown in SEQ ID NO.2.

[0024] I. Construction of Recombinant Expression Vectors PCR primer design and target fragment amplification and recovery Primers were designed using SnapGene software. The mutation site was designed onto the primers. Using the Ker sequence as a template, PCR was performed using primers KF, DV1-R, and DV1-F, KR to amplify the two fragments before and after the mutation site. The recovered products of the two fragments were then mixed, and overlap PCR was performed using primers DV1-F, DV1-R to obtain the DV1 mutant sequence. Using the DV1 sequence as a template, PCR was performed using primers KF, DV2-R, and DV2-F, KR to amplify the two fragments, which were then recovered. Overlap PCR was then performed using primers DV2-F, DV2-R to obtain the DV2 mutant sequence.

[0025] KF: GTACATAAAAAAGGAGACATGAACGATGATGAGGAAAAAGAGTTTTTGG (SEQ ID NO.7); KR: CTTGGAATTGTGCTGAAGTTATTGAGCGGCAGCTTCGACA (SEQ ID NO.8); DV1-F: CCTGGCGTAGGCGTATACAGCACTT (SEQ ID NO.9); DV1-R: CTGTATACGCCTACGCCAGGAGCCATGA (SEQ ID NO. 10); DV2-F: GGAATCGATTGGGCGACAACAAACGG (SEQ ID NO. 11); DV2-R: GTTGTCGCCCAATCGATTCCGCTTACAAT (SEQ ID NO. 12); The PCR reaction system is as follows: 2×PrimeSTAR Max DNA Polymerase 25μL; DNA (4 ng / μL) 2μL; Primer-F (10 μM) 2.5μL; Primer-R (10 μM) 2.5μL; add ddH2O to 50μL.

[0026] PCR reaction conditions: (1) 98℃, 2 min; (2) 98℃, 10 s; 55℃, 15 s; 72℃, 20 s; 32 cycles; (3) 72℃, 10 min.

[0027] The overlap extension PCR reaction system is as follows: 2×PrimeSTAR Max DNA Polymerase 12.5 μL; DNA molar ratio 1:1; add ddH2O to 25 μL.

[0028] Overlap extension PCR reaction conditions: (1) 98℃, 2 min; (2) 98℃, 10 s; 66-58℃, 10 s; 72℃, 1 min; 10 cycles; (3) 98℃, 10 s; 58℃, 10 s; 72℃, 1 min; 15 cycles; (4) 72℃, 10 min.

[0029] Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the procedure for constructing the recombinant expression vector is as follows: Figure 1 As shown.

[0030] Using a plasmid containing the full-length pWB980 sequence as a template, and pWB980-F and pWB980-R as primers, the vector was linearized by PCR amplification.

[0031] pWB980-F:GAAGCTGCCGCTCAATAACTTCAGCACAATTCCAAGAAAGA (SEQ ID NO. 13); pWB980-R:CCTCATCATCGTTCATGTCTCCTTTTTTATGTACTGTGT (SEQ ID NO. 14); II. Agarose gel electrophoresis of PCR products and gel recovery of target gene Take 1 μL of PCR product and perform 1.0% agarose gel electrophoresis to check for a single band. Then purify the product using a DNA purification kit. Results are as follows: Figure 2As shown, a single band of the target gene and vector was obtained, and the size was correct. The purified PCR products of the target gene and vector were digested with Dpn I enzyme to reduce the probability of false positives due to the template plasmid during transformation. The reaction system was as follows: Dpn I 1 μL; 10×T buffer 2 μL; DNA ≤1 μg; add ddH2O to 20 μL.

[0032] III. Construction of K-pWB980 expression vector The target gene PCR product was extended and overlapped with the vector. The reaction system was as follows: 2×PrimeSTAR®Max DNA Polymerase 25μL; linearized plasmid purified fragment 5 ng / μL; mutant Ker fragment 5 ng / μL; addddH2O to 50μL. Reaction conditions: (1) 98℃, 2 min; (2) 98℃, 10 s; 55℃, 15 s; 72℃, 5 min, 32 cycles; (3) 72℃, 10 min.

[0033] IV. Transformation of the host expression Mix 1-2 μL of POE-PCR product with 100 μL of competent cells. Culture the cells at 37°C, 200 rpm, for 1.5 h to complete transformation. Spread the transformed competent cells onto LB agar plates containing 50 µg / mL kanamycin. Incubate at 37°C for 8-12 hours and select transformants. Collect single colonies of positive transformants, shake the cells, and perform culture PCR verification. Results are as follows: Figure 3 As shown, the strip size is verified to be correct.

[0034] Example 2: Preliminary screening of mutant bacteria Select recombinant mutant bacteria and control bacteria and spread them on milk plates. Observe the production pattern to preliminarily screen strains with high casein activity and screen out positive mutants such as DV1 and DV2.

[0035] The amino acid sequence of the keratinase mutant DV1 obtained through screening is shown in SEQ ID NO.3, which is obtained by changing amino acid alanine at position 307 of the amino acid sequence shown in SEQ ID NO.1 to valine. The nucleotide sequences of the encoding gene of the keratinase mutant DV1 are shown in SEQ ID NO.4.

[0036] The amino acid sequence of the keratinase mutant DV2 obtained through screening is shown in SEQ ID NO.5, which is obtained by changing amino acid 307 from alanine to valine and amino acid 216 from glutamic acid to aspartic acid. The nucleotide sequence of the encoding gene of the keratinase mutant DV2 is shown in SEQ ID NO.6.

[0037] Example 3: Determination and comparison of enzyme activity and K:C value of crude fermentation enzyme solution Using a keratinase mutant as a seed culture, 2% was inoculated into fermentation flasks for fermentation, with three replicates per strain. After two days of fermentation, the enzyme activity in the supernatant was measured using feather meal and casein as substrates, and the ratio of keratinase activity to alkaline protease activity (K:C) was calculated.

[0038] Keratinase activity assay: First, mix 2 ml of pH 10 borax-sodium hydroxide buffer containing 10 mg of substrate feather powder with 1 ml of the enzyme solution to be tested. Incubate at 55°C with shaking for 1 h. Immediately add 2 ml of 10% trichloroacetic acid to terminate the reaction. After standing for 3-5 min, centrifuge at 9000 rpm for 10 min. Take the supernatant and measure its A280. The control is the sample with the stop agent added beforehand. Enzyme activity definition: Compared with the blank control, 1 U is defined as an increase of 0.01 units in A280 during 1 h of enzymatic reaction.

[0039] Alkaline protease activity assay: Take 1 ml of appropriately diluted enzyme solution, add 1 ml of 2% casein, react in a 55℃ water bath for 10 minutes, then add 2 ml of 10% trichloroacetic acid (TCA), centrifuge, take 1 ml of supernatant, add 5 ml of 0.4 M sodium carbonate, then add 1 ml of Folin reagent, develop color in a 40℃ water bath for 20 minutes, and measure color at a wavelength of 680 nm. The control is a sample with a stop agent added beforehand. Enzyme activity definition: The amount of enzyme that hydrolyzes casein to produce 1 μg of tyrosine per minute under conditions of 55℃ and pH 10.0 is defined as one enzyme activity unit (U).

[0040] Enzyme activity test results as follows Figure 4 As shown, the results indicate that the activity of keratinase in the mutant is increased. Figure 5 The ratio of keratinase activity to casein activity (K:C value) of mutant keratinase activity was also increased.

[0041] Example 4: Comparison of specific activities of mutant keratinases The original and mutant strains were fermented, and the protein was purified to obtain a pure keratinase enzyme solution. Protein concentration was determined by the BCA method, and keratinase activity was measured using feather meal as a substrate to obtain specific enzyme activity. The differences between the mutant and wild-type strains were compared, and the results are as follows: Figure 6 As shown, the specific activity of mutants DV1 and DV2 was increased compared to the wild type.

[0042] Example 5: Catalytic efficiency of mutant keratinase Using the synthetic peptide Succinyl-Ala-Ala-Pro-Phe-pNA (AAPF) as a substrate, the kinetic parameters of wild-type and mutant keratinases were determined under the reaction conditions of glycine-NaOH buffer at pH 10.0 and 55 °C. The detection wavelength was 410 nm (ε410 = 8480 M). -1 cm -1 The absorbance value change curve was measured, and the catalytic kinetic parameters were calculated. The results are shown in Table 1.

[0043] Table 1 Enzyme kinetic parameters of Ker and different mutants

[0044] Km reflects the affinity between the enzyme and the substrate; the larger the Km, the weaker the enzyme's affinity for the substrate. Kcat represents the enzyme's ability to catalyze a specific substrate; the larger the Kcat, the stronger the catalytic ability. Kcat / Km reflects the enzyme's catalytic efficiency for the substrate; this value reflects both the enzyme's affinity for the substrate and its catalytic ability, and the larger the Kcat / Km, the higher the catalytic efficiency. As shown in Table 1, the catalytic efficiency of mutants DV1 and DV2 is improved.

[0045] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A keratinase mutant DV1, characterized in that, The amino acid sequence of the mutant DV1 is shown in SEQ ID NO.3, which is obtained by changing alanine at position 307 of the amino acid sequence shown in SEQ ID NO.1 to valine.

2. The encoding gene of the keratinase mutant DV1 according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

4.

3. A keratinase mutant DV2, characterized in that, The amino acid sequence of the mutant DV2 is shown in SEQ ID NO.

5. It is obtained by changing alanine at position 307 to valine and glutamic acid at position 216 to aspartic acid.

4. The encoding gene of the keratinase mutant DV2 according to claim 3, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

6.

5. A recombinant vector containing the encoding gene as described in claim 2 or 4.

6. A recombinant strain containing the encoding gene as described in claim 2 or 4.

7. A starter culture containing the keratinase mutant DV1 of claim 1 and / or the keratinase mutant DV2 of claim 3.

8. The use of the keratinase mutant DV1 of claim 1 and / or the keratinase mutant DV2 of claim 3 in the preparation of feed additives that enhance enzyme activity and substrate specificity.

9. The application according to claim 8, characterized in that, The substrates include casein and feather meal.

10. The application according to claim 8, characterized in that, The keratinase mutants DV1 and DV2 all exhibited improved K:C ratios, specific activity, and catalytic efficiency, thereby enhancing the digestibility of protein in animal feed.

Images