A vaccine composition for blocking transmission of schistosomiasis japonica in reservoir hosts

Abstract

This application relates to a reservoir-based vaccine composition for blocking the transmission of schistosomiasis japonicus. This invention maximizes the synergistic effect of the antigen-delivery system-adjuvant by clearly defining the component formulation and optimizing process parameters, offering advantages such as potent immunogenicity, controllable process, and safe compatibility. Animal experiments show that this vaccine is particularly suitable for reservoir hosts, significantly reducing intestinal egg load (cecal egg reduction rate reaches 98.68%), effectively blocking the excretion of eggs into water bodies via feces, and cutting off key transmission links. This provides crucial technical support for achieving the schistosomiasis prevention and control strategy of "focusing on source control" and the goal of eliminating schistosomiasis in "Healthy China 2030".

Description

Technical Field

[0001] This application belongs to the field of schistosomiasis control technology, and in particular relates to a host-protecting vaccine composition for blocking the transmission of schistosomiasis japonicus. Background Technology

[0002] Schistosomiasis japonicus is a serious zoonotic parasitic disease caused by infection with Schistosoma japonicum. It is widespread in many Asian countries and regions, and its dual harm to human and animal health, along with its transmission risk, continues to challenge public health security. The "Healthy China 2030" plan clearly states the strategic goal of "eliminating schistosomiasis in all endemic counties nationwide by 2030," and emphasizes "adhering to a comprehensive prevention and control strategy focused on controlling the source of infection." Retaining hosts (cattle, sheep, and other livestock and related wild animals) are the core source of infection for schistosomiasis japonicus transmission. Studies have confirmed that cattle contribute up to 75% to the transmission of schistosomiasis. Developing highly effective transmission-blocking vaccines targeting this key group of retaining hosts is a core technological requirement for cutting off the transmission chain of schistosomiasis and achieving the elimination goal. It is also a crucial breakthrough in filling the gaps in the current prevention and control system.

[0003] Current schistosomiasis control methods have significant limitations: Praziquantel, as the mainstream treatment drug, can only kill adult worms already infected in the body, but cannot block the oviposition process of surviving adult worms. The eggs can still be excreted and contaminate the environment, completing the transmission cycle. Moreover, the large-scale application of this drug to host populations is difficult to operate and costly, and long-term single use has shown potential drug resistance risks. Physical and chemical interventions such as environmental snail control are limited by complex geographical conditions such as lakes, marshes, and hills, resulting in high implementation costs and limited coverage. At the same time, they conflict with the ecological protection requirements under the "One Health" concept, making it difficult to achieve sustainable control.

[0004] In the field of vaccine development, traditional technical routes (such as recombinant protein vaccines, inactivated vaccines, and live attenuated vaccines) generally face problems such as long preparation cycles, high production costs, and insufficient immunogenicity. Although candidate antigens such as glutathione S-transferase (SjGST) and calreticulin (SjCRT) have been studied, all traditional vaccine development focuses on killing the schistosome parasites that have invaded the body, focusing only on the infection protection of the individual host and not on the core links of schistosomiasis transmission. To date, there is no commercially available anti-Schistosoma japonicum vaccine in the world, and both human and animal populations lack effective active immunization protection.

[0005] The rise of mRNA vaccine technology has provided a new pathway for the development of anti-schistosomiasis vaccines. Compared with traditional vaccines, mRNA vaccines do not require cell culture, can be rapidly synthesized in cell-free systems, are easy to mass-produce, and can precisely encode target antigens, simultaneously inducing strong humoral and cellular immune responses. Through technologies such as cap1 cap structure, polyA tail modification, and N1-methylpseudouracil replacement, the stability and translation efficiency of mRNA molecules can be significantly improved, avoiding rapid degradation by nucleases in the body and ensuring their continued function within cells.

[0006] However, the implementation of anti-schistosomiasis mRNA vaccines still faces two major technological bottlenecks: First, mRNA molecules are water-soluble, lack cell membrane penetration ability, and are easily degraded by the body's nucleases. Therefore, they need to rely on efficient delivery systems to achieve targeted transport and ensure that they enter the host's immune cells and are released. Second, the immune activation intensity of mRNA vaccines alone is limited. Adjuvants are needed to enhance antigen presentation efficiency and induce the body to produce long-term memory immunity in order to resist the long-term threat of schistosomiasis infection.

[0007] In existing delivery systems, lipid nanoparticles (LNPs) have the advantages of efficiently encapsulating mRNA, protecting it from degradation, and promoting uptake by immune cells. Their safety and delivery efficacy in organisms have been verified in multiple mRNA vaccines. However, a single LNP delivery system can only solve the problem of "delivery efficiency" and still has the defect of insufficient immune activation, making it difficult to meet the needs of anti-schistosomiasis vaccines for a sustained and potent immune response.

[0008] β-glucan, as a natural immunomodulator, can enhance antigen presentation efficiency by activating the body's innate immune cells (such as macrophages and dendritic cells), significantly improve the strength of specific immune responses, and has good biocompatibility and safety with no obvious toxic side effects, making it an excellent choice for mRNA vaccine adjuvants.

[0009] Meanwhile, the Sj23 antigen of Schistosoma japonicum, as a key protective antigen expressed in the early stage of infection, has extremely strong immunogenicity and can accurately induce the body to produce specific immune protection against schistosomiasis infection. It is the core antigen target of anti-schistosomiasis vaccines.

[0010] To date, there is no research on transmission-blocking vaccines that target the host of the parasite and focus on blocking the oviposition of adult schistosomes. Summary of the Invention

[0011] The purpose of this invention is to overcome the shortcomings of existing technologies, which have not yet achieved the synergistic integration of LNP delivery systems, β-glucan adjuvants, and Sj23-modified mRNA. There is no research on combining LNP and β-glucan to address the dual requirements of "delivery efficiency" and "immune activation" in anti-schistosomiasis mRNA vaccines; nor has a specific vaccine composition targeting the Sj23 antigen and specific to the body's immune characteristics been developed. Furthermore, research on vaccines targeting the reservoir host of Schistosoma japonicum is lacking. This invention provides a reservoir host vaccine composition for blocking the transmission of schistosomiasis japonicum.

[0012] This application constructs an Sj23 mRNA vaccine using a combination of β-glucan adjuvant and an LNP delivery system. This vaccine induces a specific immune response in the host to block the oviposition process of adult schistosomes, preventing the production and release of eggs, thus preventing the formation of cercariae and the creation of new infections. Ultimately, this breaks the transmission chain of schistosomiasis, achieving natural reduction of the schistosome population and long-term transmission interruption. This technical solution can effectively overcome the current technical bottlenecks in schistosomiasis control and provide new technical support for achieving the strategic goal of eliminating schistosomiasis by 2030.

[0013] The first objective of this invention is to provide an mRNA vaccine.

[0014] A second objective of this invention is to provide a method for preparing the mRNA vaccine.

[0015] A third objective of this invention is to provide an mRNA vaccine composition.

[0016] A fourth object of the present invention is to provide the use of the mRNA vaccine and / or the mRNA vaccine composition in the preparation of a Schistosoma japonicum vaccine.

[0017] To achieve the above objectives, the present invention is implemented through the following technical solution: An mRNA vaccine comprising mRNA with a nucleotide sequence as shown in SEQ ID NO:5 encapsulated in lipid nanoparticles; The lipid nanoparticles are composed of ionizable lipids, cofactor phospholipids, cholesterol and PEG-lipids; the molar ratio of the ionizable lipids, cofactor phospholipids, cholesterol and PEG-lipids is 50: (9-11): (38-39): (1-2).

[0018] Preferably, the molar ratio of the ionizable lipid, cofactor phospholipid, cholesterol, and PEG lipid is 50:10:38.5:1.5.

[0019] Preferably, the mRNA contains a 5' cap structure.

[0020] Preferably, the mRNA is modified with N1-methylpseuuridine.

[0021] More preferably, the 5' cap structure is an m7G cap structure.

[0022] Preferably, the ionizable lipid is DLin-MC3-DMA.

[0023] Preferably, the phospholipid is distearylphosphatidylcholine.

[0024] Preferably, the PEG-lipid is DMG-PEG2000.

[0025] The method for preparing the mRNA vaccine uses a sodium citrate buffer solution of mRNA with a nucleotide sequence as shown in SEQ ID NO:5 as the aqueous phase; an ethanol solution of the lipid nanoparticles as the ethanol phase; the ethanol phase and the aqueous phase are mixed, and the ethanol is replaced with phosphate buffer by dialysis for storage.

[0026] Preferably, the total lipid concentration of the ethanol phase is 9–11 mM.

[0027] Preferably, the volumetric flow rate ratio of the ethanol phase to the water phase is 1:(2.5 to 3.5).

[0028] More preferably, the volumetric flow rate ratio of the ethanol phase to the water phase is 1:3.

[0029] An mRNA vaccine composition comprising the mRNA vaccine and an adjuvant, wherein the adjuvant is β-glucan.

[0030] Preferably, the mass ratio of the mRNA vaccine to the adjuvant is (1-10):1000.

[0031] The use of the mRNA vaccine and / or the mRNA vaccine composition in the preparation of a Schistosoma japonicum vaccine.

[0032] Preferably, the Schistosoma japonicum vaccine is a Schistosoma japonicum vaccine that protects the host worm.

[0033] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention achieves a potent synergistic effect between β-glucan adjuvant and Sj23-mRNA-LNP. At the same antigen dose, the hepatic oocyte reduction rate increased from 66.36% to 97.74%, and the cecal oocyte reduction rate increased from 78.17% to 98.68%, which is superior to the group using 15μg mRNA alone. The synergistic use of β-glucan adjuvant and Sj23-mRNA-LNP can almost completely eliminate fecal eggs from the host, preventing the eggs from being excreted in the feces, thereby blocking the next generation of schistosomiasis infection and achieving the core advantages of "dose saving + enhanced effect + prevention of transmission". 2. This invention focuses on the core pathogenesis of schistosomiasis, with an inhibition rate of over 97% on egg deposition, effectively preventing pathological damage such as egg granulomas and fibrosis, while achieving a 67.18% reduction rate of parasites, thus possessing a dual control effect of "parasite suppression + egg suppression". 3. The preparation process of this invention is stable and controllable. LNP is prepared on a large scale using microfluidic technology, and key parameters such as particle size and potential are uniform (particle size 91.22nm, PDI 0.248). β-glucan is evenly dispersed after standardized ultrasonic treatment, and the endotoxin level meets the standards for injection. 4. The present invention exhibits excellent safety. Animal experiments have verified that mice showed no abnormal reactions after immunization, their weight steadily increased, and there were no pathological changes such as swelling or necrosis in the major organs. It meets the abnormal toxicity test requirements of the Pharmacopoeia of the People's Republic of China and has good biocompatibility. 5. The antigen design of this invention is scientific and reasonable. Sj23 mRNA targets the key membrane-binding functional domain of the juvenile worm stage. Combined with m7G cap, N1-methylpseudouracil modification and poly(A) tail, it significantly improves the stability and translation efficiency of mRNA and can effectively induce specific humoral immunity (significantly increased IgG antibody level). 6. This invention has a clear target and significant public health implications. The vaccine specifically targets the reservoir host, a key link in the transmission of schistosomiasis, and has shown good immunoprotective effects in animal experiments. It is expected to be applied to livestock and wild animals, providing a new technological tool and solution for the ultimate elimination of schistosomiasis.

[0034] Therefore, this invention develops a combined vaccine composition with modified Sj23 mRNA as the core antigen, LNP as a highly efficient delivery carrier, and β-glucan as an immune-enhancing adjuvant. This composition not only overcomes the technical bottleneck of anti-Schistosoma japonicum vaccines and fills the product gap in this field, but also provides key technical support for the "Healthy China 2030" goal of eliminating schistosomiasis. It is suitable for herd immunity control of carriers of Schistosoma japonicum such as cattle and sheep, and has important public health value and technological innovation significance in the prevention and control of zoonotic diseases. With its high efficiency, safety, and scalability, this vaccine composition can be applied to the prevention of Schistosoma japonicum in livestock and humans, immunizing carriers to control the source of infection and building a solid immune barrier in the population.

[0035] This invention discloses an anti-Schistosoma japonicum Sj23 mRNA vaccine and its composition based on LNP delivery and β-glucan adjuvant. By clarifying the component formulation and optimizing the process parameters, the synergistic effect of antigen-delivery system-adjuvant is maximized. It has the advantages of strong immunogenicity, controllable process, and safety. It has shown good immunoprotective effect in animal experiments. It is suitable for large-scale prevention and control in pest hosts such as cattle and sheep, and is also expected to be applied to the protection of livestock and susceptible populations. It provides key technical support for blocking the spread of Schistosoma japonicum and achieving the goal of eliminating schistosomiasis in "Healthy China 2030". Attached Figure Description

[0036] Figure 1 This is a gel electrophoresis image of the PCR products of the Sj23 DNA fragment. Lane M is the DNA molecular weight standard (marker), and lanes 1-6 are the PCR amplification products of the purified Sj23 antigen coding sequence, showing that the size of the target fragment is consistent with the expectation.

[0037] Figure 2 Capillary electrophoresis image of the Sj23 antigen mRNA transcription product; the purity and integrity of the mRNA product after in vitro transcription confirm the successful synthesis of the expected Sj23 antigen mRNA.

[0038] Figure 3 The particle size distribution of Sj23-mRNA-LNP is shown. The average hydrodynamic particle size of the lipid nanoparticles is 91.22 nm, and the polydispersity index (PDI) is 0.248, indicating that the particles are uniform in size and have a narrow distribution.

[0039] Figure 4 The image shows the zeta potential distribution of Sj23-mRNA-LNP. Under physiological pH conditions, the average zeta potential on the surface of the nanoparticles is 0.01107 mV, which is close to electroneutrality and is beneficial to improving the colloidal stability of the formulation.

[0040] Figure 5The image shows the statistical diagram of the liver egg load in each group of mice during the adjuvant screening experiment; the results showed that the liver egg reduction rate in the β-glucan adjuvant group was significantly better than that in the Zymosan group (P<0.05).

[0041] Figure 6 The figure shows the cecal egg load of mice in each group during the adjuvant screening experiment. The results showed that the cecal egg reduction rate of the β-glucan adjuvant group was significantly better than that of the Zymosan group (P<0.05).

[0042] Figure 7 The images show gross liver images and HE staining pathological images of mice in each group during the adjuvant screening experiment. The results showed that β-glucan had a better effect than Zymosan in reducing liver egg deposition, liver inflammation, and fibrosis, which was consistent with the previous results on the reduction of eggs in the liver and cecum.

[0043] Figure 8 The figure shows the serum IgG antibody titer of mice in each group on day 14 after primary immunization. All vaccine groups could induce the production of specific IgG antibodies. The serum specific IgG GMT values ​​in groups B, C, and D were significantly higher than those in group A (P<0.001 for group B, P<0.0001 for groups C and D), and group C was significantly higher than group B (P<0.0001). Figure 9 The serum IgG antibody titers of mice in each group were measured on day 28 after the initial immunization. After the booster immunization, the IgG GMT levels in each vaccine group were higher than those in the control group. Group B was significantly higher than Group A (P<0.05), and Groups C and D were extremely significantly higher than Group A (P<0.0001). Group C was also significantly higher than Group B (P<0.0001).

[0044] Figure 10 The graph shows the number of adult insects recovered after the insect attack. Compared with the control group (Group A), the adult insect load in the vaccine groups (Groups B, C, and D) was significantly reduced (P<0.0001); and Group C was significantly better than Group B (P<0.001), indicating that the combined vaccine had the best insect reduction effect.

[0045] Figure 11 The graph shows the liver egg load statistics. Compared with group A, all vaccine groups (groups B, C, and D) showed a significant reduction in liver egg load (P < 0.0001), and the combined vaccine group C achieved a liver egg reduction rate of 97.74%, which was significantly better than the antigen-only group B (P < 0.01).

[0046] Figure 12The chart shows the cecal egg load statistics. Compared with group A, all vaccine groups showed a significant reduction in cecal egg load (group B P<0.01, groups C and D P<0.0001). Furthermore, the combined vaccine group C achieved a cecal egg reduction rate of 98.68%, significantly better than the antigen-only group B (P<0.01). This result indicates that the vaccine has a strong inhibitory effect on cecal eggs in intestinal tissue, effectively reducing the excretion of eggs in feces and blocking transmission.

[0047] Figure 13 The images show gross and HE-stained pathological images of the liver. Group A shows dense, grayish-white nodules of parasite eggs in the liver, which are enlarged, have blunt edges, and are dark red in color. HE staining shows extensive inflammatory cell infiltration and typical granulomas. Group B shows a significant reduction in nodules. Group C shows a smooth, reddish liver surface with almost no nodules. Group D shows fewer nodules, but the improvement is not as good as in Group C. HE staining in Groups B, C, and D shows only focal inflammatory cell aggregation and no typical parasite eggs. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0049]

[0050] Example 1: Preparation of Schistosoma japonicum Sj23 antigen mRNA I. Experimental Methods (1) Antigen sequence optimization and PCR amplification The conserved functional domains of the Schistosoma japonicum Sj23 gene were optimized: nucleotide sequences corresponding to amino acids 18-125 of Sj23 (membrane-binding domain, amino acid sequence as shown in SEQ ID NO:1) were selected, and the coding sequence of the HA tag (TATCCTTATGACGTGCCTGACTACGCC) was tandemly connected to the 3' end of its coding gene sequence to form a fragment encoding the "antigen coding sequence - HA tag coding sequence". Codon optimization was performed to obtain the fragment with the nucleotide sequence shown in SEQ ID NO:2, and the optimized DNA fragment was then synthesized.

[0051] Specific primers were designed to optimize the sequence. An EcoRI restriction site was introduced at the 5' end of the upstream primer, and an XhoI restriction site was introduced at the 3' end of the downstream primer. The primer sequences are as follows: Sj23 upstream primer: 5'-CGGAATTCATGAAGAAGAAGAAGAAG-3'; Sj23 downstream primer: 5'-CCGCTCGAGTTAGTGGTGGTGGTGGTG-3'.

[0052] PCR amplification was performed using the synthesized DNA fragment as a template. The reaction system (50 μL) consisted of: 25 μL of 2× high-fidelity DNA polymerase premix, 2 μL each of forward and reverse primers (10 μM), 1 μL of template DNA, and 20 μL of enzyme-free water. The reaction conditions were: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0053] Take 5 μL of PCR product and perform 1.5% agarose gel electrophoresis (120V, 30 min). The target fragment is recovered from the gel. The electrophoresis results are as follows. Figure 1 As shown (lane M: molecular marker; lanes 1-6: purified transcription product), the detection concentration was ≥50 ng / μL, and sequencing confirmed that there were no mutations in the sequence.

[0054] (2) Construction of recombinant transcription vector The commercially available pUC57-T7 vector containing the T7 promoter, 5'UTR (nucleotide sequence as shown in SEQ ID NO:3), 3'UTR (nucleotide sequence as shown in SEQ ID NO:4), and 100 PolyA tails was digested with EcoRI / XhoI (37℃, 3h) along with the recovered Sj23 fragment, and the digestion products were recovered by gel electrophoresis.

[0055] The fragment was ligated to the vector using T4 DNA ligase (16°C, overnight). The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar containing ampicillin, and incubated at 37°C for 12–16 h. Single colonies were picked and cultured, and the plasmid was extracted, then subjected to double enzyme digestion and sequencing verification to obtain the recombinant plasmid pUC57-T7-Sj23.

[0056] (3) mRNA in vitro transcription and purification The recombinant plasmid pUC57-T7-Sj23 was linearized by single enzyme digestion with XhoI (37℃, 4h). After confirming complete linearization, the template was purified and the concentration was adjusted to 1μg / μL. mRNA was synthesized using an in vitro transcription kit and modified with N1-methylpseudouracil. The reaction system (20μL) consisted of: 2μL 10× reaction buffer, 1.5μL 2× NTP / Ribo-Cap1 Mix (containing m7G cap analogue), 2μL T7 RNA polymerase, 2μL linearized template, 2μL magnesium acetate (52mM), and enzyme-free water to a final volume of 20μL. The mixture was incubated at 37℃ for 2h. DNase I was then added (37℃, 15min) to remove residual DNA.

[0057] The transcript was purified using an RNA purification kit, and its accuracy was verified by capillary electrophoresis. The results are as follows: Figure 2 As shown; the A260 / A280 ratio was detected to be 1.8–2.1, and the concentration was adjusted to 1 μg / μL. The purified Sj23 antigen mRNA (nucleotide sequence as shown in SEQ ID NO:5) was successfully prepared and stored at -80℃ for later use.

[0058] Example 2: Preparation and physical characterization of lipid nanoparticles (LNPs) (1) LNP lipid formulation A four-component system consisting of ionizable lipids, cofactor phospholipids, cholesterol, and PEG-lipids was used. The molar ratio of each component was: ionizable lipids: phospholipids: cholesterol: PEG-lipids = 50:10:38.5:1.5. The ionizable lipid used was DLin-MC3-DMA, the phospholipid was DSPC (distearylphosphatidylcholine), and the PEG-lipid was DMG-PEG2000.

[0059] (2) Preparation of mRNA-LNP using microfluidic mixing technology The above lipid components were dissolved in anhydrous ethanol to prepare an ethanol phase with a total lipid concentration of 10 mM.

[0060] Total lipid concentration = total moles of four lipids / ethanol phase volume.

[0061] The purified Sj23 antigen mRNA (prepared in Example 1) was dissolved in sodium citrate buffer at pH 4.0 to prepare an aqueous phase with a concentration of 0.1 mg / mL.

[0062] At room temperature, the ethanol and aqueous phases were rapidly mixed at a volumetric flow rate of 1:3 using a microfluidic mixer. The resulting suspension was then transferred to a dialysis bag (MWCO 10 kDa) and dialyzed at 4°C with PBS buffer for 24 hours to remove ethanol and replace the buffer system. Finally, the solution was filtered through a 0.22 μm sterile membrane to obtain the final formulation Sj23-mRNA-LNP, aliquoted, and stored at -80°C.

[0063] (3) Characterization of mRNA-LNP The key physical characterization of the prepared Sj23-mRNA-LNP complex was performed, and the results are as follows: Particle size and distribution: Dynamic light scattering was used to determine the average hydrodynamic particle size of the nanoparticles, which was 91.22 nm, and the polydispersity index (PDI) was 0.248 (e.g., ...). Figure 3 As shown in the figure, this indicates that the particles are uniform in size and have a narrow distribution.

[0064] Zeta potential: Under physiological pH conditions, the average zeta potential on the nanoparticle surface is 0.01107 mV in the Tris-HCl / sucrose buffer system, close to electroneutrality (e.g., ...). Figure 4 As shown in the figure, this is beneficial for improving the colloidal stability of the formulation and reducing non-specific adsorption.

[0065] The characterization data above confirms that this embodiment successfully prepared an Sj23 antigen mRNA-LNP complex (Sj23-mRNA-LNP) with suitable particle size and uniform potential distribution, which is suitable for subsequent vaccine preparation and immunization experiments.

[0066] Example 3 Selection of vaccine adjuvants β Glucan (Catalog No.: HY-134816) and Zymosan (Catalog No.: HY-159069) are both potent adjuvants for innate immunity. They both drive a Th1-based response through PRR activation, precisely matching the core requirements of schistosomiasis vaccines for cellular immunity, humoral immunity, and immune memory, making them highly promising adjuvants for schistosomiasis vaccines.

[0067] I. Experimental Methods 1. Animal grouping and immunization program SPF-grade ICR mice aged 6–8 weeks were selected, with a weight controlled within the range of 18–25g. All mice were housed in individual IVC cages with constant temperature and humidity, and were allowed to acclimatize to the environment for 3–7 days in advance. The temperature of the housing was maintained at 20–26℃ and the humidity at 40–70%, using a 12-hour light / 12-hour dark circadian rhythm (light from 8:00 AM to 8:00 PM, darkness from 8:00 PM to 8:00 AM the next day). During the experiment, sterile feed and sterilized drinking water were continuously provided, and the mice had free access to food and water, ensuring that the housing environment met the standards for SPF-grade animal experiments.

[0068] After the acclimatization period, the mice were randomly divided into 3 groups using a random number table and marked with ear tags. The immunization regimens for each group are shown in Table 1.

[0069] Table 1: Animal grouping and immunization for adjuvant screening

[0070] Note: Both β-glucan and Zymosan were purchased from MCE.

[0071] 2. Methods and evaluation schemes for detecting and evaluating the effectiveness of insect attack protection After all groups of mice completed their second immunization (boost immunization) on Day 14, a further 14-day interval was observed (to ensure the establishment of stable specific immune memory in the body), during which each group of mice underwent pathogen challenge treatment: Each mouse was infected with Schistosoma japonicum cercariae via abdominal skin contact, with an infection dose of 30 cercariae per mouse. The mice were continuously monitored for health status 42 days after infection. All mice were euthanized, and target organs such as the liver and intestines were collected for statistical analysis of the following indicators: (1) Liver egg count: Liver tissue of equal weight from each group of mice was dissolved in 1 ml of 4% KOH solution overnight. The number of eggs was counted by microscopic examination, and the egg reduction rate was calculated. Egg reduction rate = [(Average number of eggs in group A - Average number of eggs in experimental group) / Average number of eggs in group A] × 100%.

[0072] (2) Cecal egg count: Cecal tissue of equal weight from each group of mice was dissolved overnight in 1 ml of 4% KOH solution. The number of eggs was counted by microscopic examination, and the egg reduction rate was calculated. Egg reduction rate = [(Average number of eggs in group A - Average number of eggs in experimental group) / Average number of eggs in group A] × 100%.

[0073] (3) Liver pathological assessment Six weeks post-attack, mice were euthanized, and their livers were completely isolated. Before egg counting, the livers of each group of mice were grossly observed and photographed. Tissue blocks (approximately 1.0 cm × 0.5 cm × 0.3 cm) from the same location (left lobe) of the liver were taken from each group of mice and immediately fixed in 4% paraformaldehyde solution for 48 hours. After fixation, the tissues were dehydrated with graded ethanol, cleared with xylene, embedded in paraffin, and then prepared into serial sections with a thickness of 5 μm. The sections were routinely dewaxed to water, stained with hematoxylin and eosin (H&E), and mounted with neutral resin. The morphological characteristics of the liver egg granulomas were observed under an optical microscope (Olympus BX53, Japan).

[0074] II. Experimental Results The results of liver egg load are shown in Table 2. Figure 5 As shown.

[0075] Table 2: Adjuvant screening for liver oocyte load

[0076] Note: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 Compared with the blank control group (NC group), β Both glucan and Zymosan, as adjuvants, significantly reduced the hepatic egg load, with β-glucan being particularly effective. The dextran group showed a p-value of <0.001, and the Zymosan group showed a p-value of <0.01, with oocyte retrieval rates of 88.11% and 45.67%, respectively. Furthermore, β... The liver egg load in the dextran group was significantly lower than that in the Zymosan group (p<0.05), indicating that β-carotene was present in mice. Both β-glucan and Zymosan adjuvants can effectively reduce the liver egg load in experimental mice, but β-glucan is significantly more effective than Zymosan in reducing the liver egg load in mice.

[0077] The results of the cecal worm egg count are shown in Table 3. Figure 6 As shown.

[0078] Table 3: Adjuvant screening of cecal worm egg load

[0079] Note: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 The results of cecal tissue oocyte load measurements were highly consistent with the trend observed in the liver. Compared with the blank control group (NC group), β Both glucan and Zymosan, as adjuvants, significantly reduced the hepatic egg load, with β-glucan being particularly effective. The dextran group showed a p-value of <0.001, while the Zymosan group showed a p-value of <0.05. The oocyte retrieval rates for the two groups were 87.55% and 57.17%, respectively. Furthermore, β... The liver egg load in the dextran group was significantly lower than that in the Zymosan group (p<0.05), indicating that β-carotene was present in mice. Both β-glucan and Zymosan adjuvants can effectively reduce the cecal egg load in experimental mice, but β-glucan is significantly more effective than Zymosan in reducing the liver egg load in mice.

[0080] Gross photographs of the livers of mice in each group, and HE-stained pathological images are shown below. Figure 7 As shown.

[0081] It was observed that the liver surface of mice in the NC group showed densely distributed grayish-white schistosomiasis egg nodules, increased liver volume, blunted edges, and dark red color, exhibiting typical pathological changes of schistosomiasis liver. In contrast, the number of schistosomiasis egg nodules on the liver surface of mice in the β-glucan group and Zymosan group was significantly reduced, and the liver color and morphology were improved.

[0082] HE staining revealed multiple clusters of parasite eggs in the liver of mice in the NC group, surrounded by extensive inflammatory cell infiltration, primarily eosinophils, lymphocytes, and macrophages, forming well-defined, large granulomatous structures. Some eggs showed calcification, and surrounding hepatocytes were compressed, atrophied, or necrotic. In the β-glucan group, only focal inflammatory cell aggregations were observed in the liver, without typical egg structures, and the granuloma volume was significantly reduced. Compared to the NC group, the granulomatous structures of parasite eggs in the liver of mice in the Zymosan group were not significantly smaller, and multiple eggs were still aggregated within the granulomas, with some calcification, indicating that there was still a large amount of egg deposit in the liver, accompanied by severe inflammation and fibrosis.

[0083] The above results indicate that, compared with Zymosan, β-glucan has a better effect on reducing liver egg deposition, liver inflammation, and fibrosis, which is consistent with previous results on the reduction of egg count in the liver and cecum.

[0084] Combining the data from Table 2 (liver oocyte reduction rate) and Table 3 (cecal oocyte reduction rate) and Figure 7 The results indicate that β-glucan is superior to Zymosan in reducing the deposition of parasite eggs in the liver and cecum, as well as reducing liver inflammation and fibrosis. Therefore, choosing β-glucan as an adjuvant for combination vaccines can better enhance the protective effect of the vaccines.

[0085] Example 4: Preparation and Characterization of β-glucan Adjuvant β-glucan, derived from the cell wall of Saccharomyces cerevisiae, is a high-purity β-1,3-D-glucan with a main chain linked by β-1,3 glycosidic bonds and branched by β-1,6 glycosidic bonds. This product is supplied in micron-sized particle form, and its water-insoluble properties are crucial for activating innate immune receptors such as Dectin-1.

[0086] 1. Preparation of β-glucan suspension To obtain a homogeneous and stable suspension suitable for animal immunization, follow these steps: (1) Take an appropriate amount of β-glucan granules and place them in sterile phosphate buffered saline.

[0087] (2) Use a vortex oscillator to shake violently for 1 to 2 minutes to initially disperse the particles and obtain a β-glucan suspension.

[0088] (3) Place the β-glucan suspension in an ice-water bath and use an ultrasonic cell disruptor for ultrasonic treatment. The specific parameters are: power 200W, working time 2 seconds, interval 3 seconds, total ultrasonic time 5 minutes, in order to further break up the aggregates and obtain a more uniform dispersion system.

[0089] (4) After ultrasonic treatment, the β-glucan suspension was immediately centrifuged at 4°C and 10,000 rpm for 5 minutes, and the supernatant containing a small amount of undispersed large particles was discarded.

[0090] (5) Resuspend the precipitate with sterile PBS or adjust the supernatant to the required concentration, and filter it through a 0.45 μm sterile filter membrane to obtain a sterile β-glucan adjuvant working solution with a concentration of 1 to 2 mg / mL. Store at 4°C for a short period or at -20°C for a long period. Vortex again before use to obtain the treated β-glucan suspension.

[0091] 2. Physicochemical characterization of the treated β-glucan suspension Particle morphology and size: Observed by optical microscope or dynamic light scattering instrument, the processed particles are mainly distributed in the range of 0.5 μm to 5 μm, showing a well-dispersed granular morphology.

[0092] Chemical structure confirmed: Fourier transform infrared spectroscopy (FT-IR) at 890 cm⁻¹ - ¹ and 1040 cm - ¹ A characteristic absorption peak was observed near the site, confirming its β-glycosidic bond configuration.

[0093] Endotoxin levels: To ensure safety, the Limulus amebocyte lysate (LAL) assay was used to detect endotoxin levels in the treated β-glucan suspension, confirming that the endotoxin levels were below 0.1 EU / mL, meeting the requirements for injectable formulations.

[0094] The treated β-glucan suspension was subsequently sterilized to ensure that the treated β-glucan suspension (finished β-glucan suspension) used in subsequent immunoassays met the following standards: negative sterility test, qualified endotoxin test, uniform particle dispersion, and no visible sediment. Example 5: Protection against Schistosoma japonicum infection in mice with mRNA-LNP / β-glucan combined vaccine I. Vaccine Components Antigen component: Lipid nanoparticles (Sj23-mRNA-LNP) encapsulated with Sj23 antigen mRNA prepared in Example 2. The concentration of mRNA in this formulation is 0.5 μg / μL.

[0095] Adjuvant component: The finished β-glucan suspension prepared in Example 3, with a concentration of 10 μg / μL.

[0096] Prepare the buffer solution: sterile phosphate buffer (PBS, pH 7.4).

[0097] II. Animal Grouping and Immunization Procedures SPF-grade ICR mice aged 6–8 weeks were selected, with a weight controlled within the range of 18–25g. All mice were housed in individual IVC cages with constant temperature and humidity, and were allowed to acclimatize to the environment for 3–7 days in advance. The temperature of the housing was maintained at 20–26℃, and the humidity at 40–70%, using a 12-hour light / 12-hour dark circadian rhythm (light from 8:00 AM to 8:00 PM, and darkness from 8:00 PM to 8:00 AM the next day). During the experiment, sterile feed and sterilized drinking water were continuously provided, and the mice had free access to food and water, ensuring that the housing environment met the standards for SPF-grade animal experiments.

[0098] After the acclimatization period, the mice were randomly divided into 4 groups using a random number table and marked with ear tags. The immunization regimens for each group are shown in Table 4 (the dosages in the table refer to the effective content of the active ingredient in the vaccine).

[0099] Table 4: Animal Grouping

[0100] The immunization method was: quadriceps injection; the immunization schedule was: first immunization on Day 0 and second immunization on Day 14.

[0101] III. Serum-specific IgG detection 1. Experimental Methods Serum samples from mice in each group were collected on day 14 (DAY 14) and day 28 (DAY 28) after the initial immunization for ELISA detection of serum IgG antibody titers. 2. Experimental Results like Figure 8 As shown, the results indicated that 14 days after the initial immunization, the serum specific IgG GMT values ​​of groups B, C, and D were significantly higher than those of group A (blank control group). The statistical difference in group B met the criteria of P < 0.001, and the statistical differences in groups C and D met the criteria of P < 0.0001. Furthermore, the serum specific IgG GMT value of group C was significantly higher than that of group B, with a statistical difference of P < 0.0001.

[0102] like Figure 9 As shown, on day 28 after the initial immunization, the serum specific IgG GMT values ​​of groups B, C, and D were significantly higher than those of group A (blank control group). The statistical difference in group B met the criteria of P < 0.05, and the statistical differences in groups C and D met the criteria of P < 0.0001. Furthermore, the serum specific IgG GMT value of group C was significantly higher than that of group B, and the statistical difference met the criteria of P < 0.0001.

[0103] Mice immunized in groups B, C, and D all showed an effective induction of systemic humoral immune response, and β-glucan adjuvant significantly enhanced the systemic humoral immune response in the experimental mice.

[0104] IV. Insect Protection Effect 1. Experimental Methods After all groups of mice completed their second immunization (boost immunization) on Day 14, a further 14-day interval was observed (to ensure the establishment of stable specific immune memory in the body), during which each group of mice underwent pathogen challenge treatment: Each mouse was infected with Schistosoma japonicum cercariae via abdominal skin contact, with an infection dose of 30 cercariae per mouse. The mice were continuously monitored for health status 42 days after infection. All mice were euthanized, and target organs such as the liver and intestines were collected for statistical analysis of the following indicators: (1) Adult worm count: Adult Schistosoma worms were recovered from mice by perfusion after dissection. The average number of adult worms in each group of mice was counted, and the worm reduction rate was calculated. The insect reduction rate is calculated as follows: [(Average number of adults in Group A - Average number of adults in the experimental group) / Average number of adults in Group A] × 100%.

[0105] (2) Liver egg count: Liver tissue of equal weight from each group of mice was dissolved in 1 ml of 4% KOH solution overnight. The number of eggs was counted by microscopic examination, and the egg reduction rate was calculated. Egg reduction rate = [(Average number of eggs in group A - Average number of eggs in experimental group) / Average number of eggs in group A] × 100%.

[0106] (3) Cecal egg count: Cecal tissue of equal weight from each group of mice was dissolved overnight in 1 ml of 4% KOH solution. The number of eggs was counted by microscopic examination, and the egg reduction rate was calculated. Egg reduction rate = [(Average number of eggs in group A - Average number of eggs in experimental group) / Average number of eggs in group A] × 100%.

[0107] 2. Experimental Results The number of recovered adult insects is shown in Table 5 and Figure 10 The results showed that the number of adult worms recovered from different vaccine groups (groups B, C, and D) was significantly lower than that from the control group (group A), clearly demonstrating a consistent worm reduction trend. The worm reduction rates were 61.03% for group B, 67.18% for group C, and 73.33% for group D. Statistical analysis showed that the number of adult worms recovered from groups B, C, and D was significantly lower than that from group A (control group). The differences among the vaccine groups were all highly significant (p<0.0001), and the number of adult worms recovered from group C was significantly lower than that from group B (p<0.001). This indicates that the Sj23-mRNA-LNP preparation can reduce the adult schistosome load in experimental mice, and the combined use of β-glucan can significantly enhance the worm reduction effect of the vaccine.

[0108] Table 5 Data on recovered adult insects

[0109] Liver egg counts are shown in Table 6 and Figure 11 The results showed that, compared with the blank control group, all vaccination groups (groups B, C, and D) significantly reduced the liver oviposition load (p<0.0001), and the liver oviposition load of mice in group C was significantly lower than that in group B (p<0.01). Among them, the combined vaccine of the present invention (group C) showed outstanding effects, exhibiting near-complete protection with an oviposition reduction rate as high as 97.74%, and its liver oviposition load (1.77±3.06 ×10³ / g) was numerically much lower than that of other experimental groups. This indicates that the Sj23-mRNA-LNP preparation can reduce the liver oviposition load of experimental mice, and the combination with β-glucan can significantly enhance the effect of the vaccine in reducing the liver oviposition load in mice.

[0110] Table 6: Liver oocyte load

[0111] The count of cecal eggs is shown in Table 7 and Figure 12The results showed that the cecal egg count and liver egg count trends were highly consistent. All vaccine groups (groups B, C, and D) significantly reduced cecal egg deposition. Group B mice showed a significantly lower cecal egg load than group A (p<0.01), while groups C and D mice showed significantly lower liver egg loads than group B (p<0.0001). Group C mice also showed a significantly lower liver egg load than group B (p<0.01). The combined vaccine of this invention (group C) showed the most outstanding effect, achieving almost complete protection, with a cecal egg reduction rate of 98.68% and an egg load reduced to an extremely low level (1.27±2.19 ×10³ / g). This indicates that the Sj23-mRNA-LNP preparation can reduce the cecal egg load in experimental mice, and the combination with β-glucan significantly enhances the vaccine's effect in reducing the cecal egg load.

[0112] Table 7: Cecal worm egg load

[0113] In summary, the Sj23-mRNA-LNP vaccine immunized with β-glucan as an adjuvant achieved an oocyte reduction rate of over 97% in both the liver and cecum, two key target organs. This indicates that it can almost completely inhibit the widespread deposition of parasite eggs in the host, which is of decisive significance for preventing major pathological damages such as oocyte granulomas and fibrosis.

[0114] At the same antigen dose (groups B and C), the combination of β-glucan adjuvant significantly increased the hepatic oocyte retardation rate from 66.36% to 97.74% and the cecal oocyte retardation rate from 78.17% to 98.68%. This combined regimen even outperformed the single antigen vaccine at a higher dose (group D), fully demonstrating the strong synergistic effect of β-glucan adjuvant and mRNA-LNP antigen, achieving top-level protective efficacy while reducing antigen dosage.

[0115] The core advantage of Group C (73.33% reduction rate, 97.74% reduction rate in liver egg production, and 98.68% reduction rate in cecum egg production) lies in its significantly better effect on inhibiting egg load than on reducing adult worms. This characteristic has crucial application value for controlling the pathogenic mechanism and transmission links of schistosomiasis centered on eggs.

[0116] V. Liver Pathological Assessment 1. Experimental Methods Six weeks after infection, mice were euthanized and their livers were completely isolated. Before counting the eggs, the livers of each group of mice were grossly observed and photographed.

[0117] Tissue blocks (approximately 1.0 cm × 0.5 cm × 0.3 cm) from the same liver region (left lobe) of mice in each group were immediately fixed in 4% paraformaldehyde solution for 48 hours. After fixation, the tissues were dehydrated with graded ethanol, cleared with xylene, embedded in paraffin, and then prepared into serial sections with a thickness of 5 μm. The sections were routinely dewaxed to water, stained with hematoxylin and eosin (H&E), and mounted with neutral resin. The morphological characteristics of liver parasite egg granulomas were observed under an optical microscope (Olympus BX53, Japan).

[0118] 2. Experimental Results Gross photographs of the livers of mice in each group, and HE-stained pathological images are shown below. Figure 13 As shown.

[0119] In group A, the liver surface of mice showed densely distributed grayish-white schistosomiasis egg nodules, increased liver volume, blunted edges, and a dark red color, exhibiting typical pathological changes in schistosomiasis-related livers. In group B, the number of schistosomiasis egg nodules on the liver surface was significantly reduced, and the liver color and morphology showed improvement. In group C, the liver surface was smooth, with a reddish color, and almost no obvious schistosomiasis egg nodules; the morphology was close to that of a normal mouse liver. In group D, the number of schistosomiasis egg nodules on the liver surface was fewer, but the degree of improvement was still less than that in the combined vaccine group.

[0120] In Group A, numerous inflammatory cells, primarily eosinophils, lymphocytes, and macrophages, were observed infiltrating the eggs, forming well-defined, large granulomatous structures. Some eggs showed calcification, and surrounding hepatocytes were compressed, atrophied, or necrotic. In all vaccine groups (Groups B, C, and D), only focal inflammatory cell aggregations were observed in the livers of mice, with no typical egg structures, and the granulomas were significantly smaller.

[0121] The above results demonstrate that the combined vaccine of this invention effectively inhibits the release of soluble antigens from eggs and the induced pathological immune response in the early stages of egg deposition by inducing a strong antigen-specific immune response, thereby blocking the pathological process of liver fibrosis in schistosomiasis at its source. This pathological improvement is highly consistent with the aforementioned liver egg reduction rate (97.74%), further confirming the remarkable efficacy and clinical application potential of the combined vaccine of this invention in controlling the main pathological damage of schistosomiasis.

[0122] VI. Safety of Vaccines 1. Experimental Methods General observation: During the experiment, the mice's mental state, food and water intake, and activity level were observed daily. They were weighed once a week, and abnormal reactions and weight changes were recorded. Organ pathological examination: After euthanasia, the morphology, color and texture of major organs such as heart, spleen, lungs and kidneys were observed with the naked eye.

[0123] 2. Experimental Results The results are shown in Table 8. No mice died in any group, all mice were in good spirits, ate and drank normally, and their weight showed a steady upward trend (no significant difference from group A). ​​All vaccine groups (groups B, C, and D) met the requirements of the Abnormal Toxicity Test Method in Part III of the Pharmacopoeia of the People's Republic of China.

[0124] Table 8

[0125] Organ pathological examination showed that, upon gross observation, no abnormalities such as enlargement, necrosis, or hemorrhage were observed in the major organs outside the liver.

[0126] The above examples demonstrate that the Sj23-mRNA-LNP (with or without adjuvant β-glucan) vaccines prepared in Examples 1, 2, and 4 have good safety and no obvious toxic side effects.

Claims

1. An mRNA vaccine, characterized in that, mRNA with a nucleotide sequence as shown in SEQ ID NO:5 is encapsulated in lipid nanoparticles; The lipid nanoparticles are composed of ionizable lipids, cofactor phospholipids, cholesterol and PEG-lipids; the molar ratio of the ionizable lipids, cofactor phospholipids, cholesterol and PEG-lipids is 50: (9-11): (38-39): (1-2).

2. The mRNA vaccine according to claim 1, characterized in that, The mRNA contains a 5' cap structure.

3. The mRNA vaccine according to claim 1, characterized in that, The ionizable lipid is DLin-MC3-DMA.

4. The mRNA vaccine according to claim 1, characterized in that, The phospholipid is distearylphosphatidylcholine.

5. The mRNA vaccine according to claim 1, characterized in that, The PEG-lipid is DMG-PEG2000.

6. The method for preparing the mRNA vaccine according to claim 1, characterized in that, A sodium citrate buffer solution of mRNA with a nucleotide sequence as shown in SEQ ID NO:5 was used as the aqueous phase; an ethanol solution of the lipid nanoparticles was used as the ethanol phase; the ethanol phase and aqueous phase were mixed, and the ethanol was replaced with phosphate buffer by dialysis for storage.

7. The preparation method according to claim 6, characterized in that, The volumetric flow rate ratio of the ethanol phase to the water phase is 1:(2.5~3.5).

8. An mRNA vaccine composition, characterized in that, The vaccine comprises the mRNA vaccine of claim 1 and an adjuvant, wherein the adjuvant is β-glucan.

9. The mRNA vaccine composition according to claim 8, characterized in that, The mass ratio of the mRNA vaccine to the adjuvant is (1-10):1000.

10. The use of the mRNA vaccine of claim 1 and / or the mRNA vaccine composition of claim 9 in the preparation of a Schistosoma japonicum vaccine.

Images