UDP-d-arabinose synthetase combination and its use

Abstract

This invention discloses an enzyme combination AfhEF for the synthesis of UDP-D-arabinose and its applications. The AfhE and AfhF proteins, encoded by the bacteriophage-derived afhE and afhF genes, can convert D-arabinose 5-phosphate into UDP-D-arabinose. The AfhE protein of this invention possesses D-arabinose 5-phosphate kinase and UTP pyrophosphatase activities in vitro, while the AfhF protein possesses D-arabinose 1,5-bisphosphate phospholipase activity in vitro, enabling the synthesis of UDP-D-arabinose using ATP and UTP as energy. This invention provides a new pathway for the biosynthesis and development of UDP-sugars, the production of UDP-D-arabinose and its derivatives in industrial fermentation, and the in vitro green synthesis of UDP-D-arabinose and its derivatives.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an enzyme combination for synthesizing UDP-D-arabinose and its application, and belongs to the field of carbohydrate compound synthesis technology. Background Technology

[0002] Carbohydrates are essential substances for life. Organisms utilize carbohydrates by activating them into monosaccharide-1-phosphate forms, which can then be used for energy metabolism or the synthesis of sugar compounds. In nature, L-arabinose is more common and plays an important role in human life. In recent years, D-arabinose has also been found in the cell wall components of bacteria (such as Mycobacterium tuberculosis), for example... Arabicafurans.

[0003] UDP-D-arabinose is the most common activated form of arabinose and serves as a glycosyl donor for various arabinosyltransferases, playing a crucial role in glycosylation modification. Currently reported synthetic methods mainly focus on UDP-L-arabinose, including enzymatic methods, cell fermentation, and chemical synthesis, while no synthetic methods for UDP-D-arabinose have been reported. The structure of UDP-D-arabinose is as follows: To address the shortcomings of existing synthetic methods, developing an efficient and green method for synthesizing UDP-D-arabinose has significant application value. Summary of the Invention

[0004] To address the shortcomings of existing synthesis methods, this invention provides an enzyme combination for catalyzing the production of UDP-D-arabinose, its encoding gene, and its applications, thus solving the technical problems of in vitro synthesis of UDP-D-arabinose and in vivo fermentation production of UDP-D-arabinose.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: This invention discovers novel functions of the AfhE and AfhF proteins. Expression of AfhE and AfhF in the genome of the bacteriophage HY126 of *E. coli* JM109 generates UDP-D-arabinose in the JM109 cytoplasm. UDP-D-arabinose can serve as a glycosyl donor for glycosylation reactions, contributing to the synthesis of various glycosylated molecules.

[0006] This invention provides an enzymatic system for the specific synthesis of UDP-D-arabinose, comprising the afhE and afhF genes, whose nucleotide sequences are SEQ ID NO.1 and SEQ ID NO.2, respectively, and whose encoded amino acid sequences are SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0007] AfhE protein: Encoded by the afhE gene (SEQ ID NO.3), it is a bifunctional enzyme with UDP-D-arabinose pyrophosphorylase activity at its N-terminus and D-arabinose-5-phosphokinase activity at its C-terminus, and functions as a dimer; or it refers to a protein with the same or similar function resulting from the substitution, deletion, or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO.3.

[0008] AfhF protein: Encoded by the afhF gene (SEQ ID NO.4), it is a D-arabinose-1,5-bisphosphatase that functions in tetrameric form; or it refers to a protein with the same or similar function resulting from the substitution, deletion, or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO.4.

[0009] This invention provides a vector pWHU4512 for heterologous expression of the afhEF gene in Escherichia coli.

[0010] This invention provides a vector pWHU4511 for expressing recombinant AfhE protein in Escherichia coli BL21(DE3).

[0011] This invention provides a vector pWHU4509 for expressing recombinant AfhF protein in Escherichia coli BL21(DE3).

[0012] This invention provides an in vitro enzymatic synthesis method for UDP-D-arabinose, wherein the enzyme is encoded by the genes shown in SEQ ID NO.1 and SEQ ID NO.2, and provides a corresponding protein purification method.

[0013] This invention discovers two substrate-specific enzymes capable of converting D-arabinose-5-phosphate to UDP-D-arabinose. This enzyme combination can be used for the industrial fermentation production or in vitro enzymatic synthesis of UDP-D-arabinose, providing a new direction and method for the synthesis of UDP-D-arabinose and its derivatives. The synthetic reaction formula is as follows: UDP-D-arabinose synthesis reaction formula The advantages of this invention are as follows: 1. The phage-derived enzyme combination AfhE / AfhF discovered in this invention is a novel enzyme system with no reported structure or activity in the literature, and there are currently no reported methods for synthesizing UDP-D-arabinose.

[0014] 2. Dual-enzyme synergy: AfhE, as a bifunctional enzyme, has both kinase and pyrophosphorylase activities. It works synergistically with AfhF to efficiently convert D-arabinose-5-phosphate into UDP-D-arabinose.

[0015] 3. Green synthesis: UDP-D-arabinose is synthesized via enzymatic methods, which can replace traditional chemical synthesis methods. The reaction conditions are mild, highly selective, and environmentally friendly.

[0016] 4. Application value: UDP-D-arabinose can be used as a glycosyl donor for arabinosyltransferases for various glycosylation studies and biosynthesis of sugar-containing compounds, and has important scientific research and industrial application value. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0018] Figure 1 Distribution of afhE and afhF genes on the genome of HY126 bacteriophage; Figure 2 This is a schematic diagram of the structure of plasmid pWHU4512 (co-expressing afhE and afhF); Figure 3 This is a schematic diagram of the structure of plasmid pWHU4511 (expressing recombinant AfhE protein). Figure 4 This is a schematic diagram of the structure of plasmid pWHU4509 (expressing recombinant AfhF protein). Figure 5 The results of heterologous expression of AfhE and AfhF proteins in Escherichia coli JM109 (HPLC-MS chromatogram). Figure 6 The results of in vitro purification of AfhE and AfhF proteins (SDS-PAGE image). Figure 7 The results of in vitro activity assays of AfhE and AfhF proteins (HPLC-MS chromatograms) are shown. Figure 8 A diagram illustrating the mechanism by which AfhE and AfhF catalyze the production of UDP-D-arabinose.

[0019] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0020] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention in any way. Unless otherwise stated, the present invention is implemented using conventional molecular biology, biochemistry, and microbiology techniques in the art.

[0021] Materials and general methods used in the examples: Strains and plasmids: Escherichia coli BL21(DE3) and JM109 were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; plasmids pACYC184 / tac and pET28a(+) were preserved in our laboratory; bacteriophage HY126 was isolated and preserved in our laboratory.

[0022] Enzymes and reagents: Restriction endonucleases, homologous recombinase kits, and high-fidelity DNA polymerases were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; IPTG, ATP, UTP, and D-arabinose-5-phosphate standards were purchased from Sigma-Aldrich; UDP-D-arabinose standards were prepared in our laboratory previously; HPLC-grade methanol and acetonitrile were purchased from Merck; other routine reagents were domestically produced analytical grade.

[0023] Culture conditions: Escherichia coli was cultured in LB medium (1% tryptone, 0.5% yeast extract, 1% sodium chloride), with appropriate antibiotics (chloramphenicol) added as needed. Kanamycin ).

[0024] HPLC-MS analysis method: The chromatographic column was a Waters Atlantis T3 column (2.1 × 150 mm). Mobile phase A was 0.1% formic acid aqueous solution, and mobile phase B was 0.1% formic acid methanol solution; gradient elution program: 0-5 min, 5% B; 5-20 min, 5%-30% B; 20-25 min, 30% B; flow rate: 0.2 mL / min; column temperature: 30℃; injection volume: Mass spectrometry was performed using an electrospray ionization (ESI) negative ion mode.

[0025] Example 1: Identification of afhE and afhF genes.

[0026] This invention involves whole-genome sequencing of bacteriophage HY126, a strain of Escherichia coli JM109 preserved in the laboratory. Bioinformatics analysis revealed a 2075 bp gene cluster in the HY126 genome, containing two open reading frames, named afhE and afhF, respectively. Figure 1 ).

[0027] afhE gene: 1689 bp in length, encoding a protein of 563 amino acids, with the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.3.

[0028] afhF gene: 387 bp in length, encoding a protein of 133 amino acids, the nucleotide sequence of which is shown in SEQ ID NO.2 and the amino acid sequence of which is shown in SEQ ID NO.4.

[0029] BLASTp alignment analysis showed that the AfhE protein had low homology with proteins of known function. Its N-terminus showed limited similarity (approximately 30%) to some bacterial UDP-glucose pyrophosphorylase family proteins, and its C-terminus showed limited similarity (approximately 28%) to some kinase family proteins, suggesting it may be a novel bifunctional enzyme. The AfhF protein showed 40%-60% homology with some phage putative proteins and limited similarity to previously reported phosphatase family proteins.

[0030] Example 2: Construction of the heterologous expression plasmid pWHU4512 for afhE and afhF genes.

[0031] 2.1 Primer Design Primers for homologous recombination were designed based on the afhEF gene cluster sequence and the multiple cloning site sequence of the pACYC184 / tac vector.

[0032] Primers for amplifying the afhEF gene cluster: Upstream primer P1: 5'- CTAAAGAGGAGAAAGGATCT ATGAAAAAAGCTGTTATTCTTG-3' Downstream primer P2: 5'- GTCCGGCGTAGAGGATCC TTATAGATTCGGTTTATATGAT-3' The underlined parts are sequences homologous to the vector, used for homologous recombination.

[0033] Primers for amplifying linearized vectors: Upstream primer P3: 5'-AGATCCTTTCTCCTCTTTAGATCTCCT-3' Downstream primer P4: 5'-GGATCCTCTACGCCGGACG-3' 2.2 PCR amplification Using phage HY126 genomic DNA as a template, PCR amplification was performed using primers P1 / P2. The reaction system ( Template DNA 100 ng, upstream and downstream primers each dNTPs 0.2 mM, high-fidelity DNA polymerase 1 U, 10× buffer Add sterile water until .

[0034] Amplification program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 30 cycles; 72℃ final extension for 5 min.

[0035] Using pACYC184 / tac plasmid as a template, PCR amplification was performed using primers P3 / P4 to obtain the linearized vector fragment. The amplification program was the same as above, but the extension time was changed to 2 min.

[0036] The PCR products were analyzed by 1% agarose gel electrophoresis, yielding an approximately 2.1 kb afhEF gene cluster fragment and an approximately 4.5 kb linearized vector fragment. The two fragments were purified separately using a gel extraction kit.

[0037] 2.3 Homologous recombination linkage Prepare homologous recombination reactions according to the system in Table 1 ( After gently mixing, the mixture was placed at 50°C for 30 minutes. After the reaction was complete, the product was placed on ice to cool and store for later use.

[0038] Table 1. Homologous recombination reaction system 2.4 Transformation and Identification Will Addition of recombinant products In *E. coli* JM109 competent cells, incubate on ice for 30 min, heat shock at 42°C for 90 s, and immediately incubate on ice for 2 min. Add Culture medium, incubate at 37°C for 1 hour to recover. Take... Bacterial solution applied to chloramphenicol-containing ( Incubate overnight at 37°C on LB plates.

[0039] Single clones were selected and inoculated into LB liquid medium (containing chloramphenicol), and cultured overnight at 37°C with shaking. Plasmids were then extracted and sequenced for verification. Sequencing results showed that the afhE and afhF genes were correctly inserted into the vector without mutations, indicating that the recombinant plasmid pWHU4512 was successfully constructed. Its plasmid map is shown below. Figure 2 As shown. This plasmid drives the expression of the afhEF gene cluster via the tac promoter and carries a chloramphenicol resistance marker.

[0040] Example 3: Construction of AfhE recombinant protein expression plasmid pWHU4511.

[0041] 3.1 Primer Design Primers for homologous recombination were designed based on the afhE gene sequence and the multiple cloning site sequence of the pET28a(+) vector: Primers for amplifying the afhE gene: Upstream primer P5: 5'- CTGGTGCCGCGCGGCAGCCA TATGAAAAAAGCTGTTATTCTTG-3' Downstream primer P6: 5'- GTCGACGGAGCTCGAATTCG TTAGATTCGTTCCCATTGATG-3' The underlined part represents a sequence homologous to the vector.

[0042] Primers for amplifying linearized vectors: Upstream primer P7: 5'-TGGCTGCCGCGCGGCACCAG-3' Downstream primer P8: 5'-GTCGACGGAGCTCGAATTCG-3' 3.2 PCR amplification and homologous recombination Using pWHU4512 plasmid as a template, the afhE gene was amplified using primers P5 / P6; using pET28a(+) plasmid as a template, the linearized vector was amplified using primers P7 / P8. The PCR reaction system and procedure were the same as in Example 2 (afhE gene extension time 1.5 min).

[0043] The purified afhE gene fragment and the linearized pET28a(+) vector fragment were ligated according to the homologous recombination reaction system, transformed into E. coli JM109 competent cells, and plated on a substrate containing kanamycin ( On the LB plate.

[0044] 3.3 Identification and Verification After selecting and culturing single clones, plasmids were extracted and sequenced to obtain the correct recombinant plasmid pWHU4511, as shown in the plasmid map below. Figure 3 As shown in the figure, the afhE gene is expressed by fusion with a 6× His tag at the N-terminus, controlled by the T7 promoter, and has a kanamycin resistance marker, making it suitable for inducing recombinant AfhE protein expression in Escherichia coli BL21(DE3).

[0045] Example 4: Construction of AfhF recombinant protein expression plasmid pWHU4509.

[0046] 4.1 Primer Design Primers for homologous recombination were designed based on the afhF gene sequence and the multiple cloning site sequence of the pET28a(+) vector: Primers for amplifying the afhF gene: Upstream primer P9: 5'- CTGGTGCCGCGCGGCAGCCATATGCACCGTGTAGAAAAC-3' Downstream primer P10: 5'- GTCGACGGAGCTCGAATTCG TTATAGATTCGGTTTATATG-3' The underlined part represents a sequence homologous to the vector.

[0047] Primers for amplifying linearized vectors: Upstream primer P11: 5'-TGGCTGCCGCGCGGCACCAG-3' Downstream primer P12: 5'-GTCGACGGAGCTCGAATTCG-3' 4.2 PCR Amplification and Homologous Recombination The afhF gene was amplified using pWHU4512 plasmid as a template and primers P9 / P10; the linearized vector was amplified using pET28a(+) plasmid as a template and primers P11 / P12. The PCR reaction system and procedure were the same as in Example 2 (afhF gene extension time 15 s).

[0048] The purified afhF gene fragment and the linearized pET28a(+) vector fragment were ligated according to the homologous recombination reaction system, transformed into E. coli JM109 competent cells, and plated on a substrate containing kanamycin ( On the LB plate.

[0049] 4.3 Identification and Verification After selecting and culturing single clones, plasmids were extracted and sequenced to obtain the correct recombinant plasmid pWHU4509, as shown in the plasmid map below. Figure 4 As shown in the figure, the afhF gene is expressed by fusion with a 6× His tag at the N-terminus, controlled by the T7 promoter, and has a kanamycin resistance marker, making it suitable for inducing recombinant AfhF protein expression in Escherichia coli BL21(DE3).

[0050] Example 5: In vivo heterologous expression of AfhE and AfhF to generate UDP-D-arabinose.

[0051] 5.1 Transformation and Induced Expression The pWHU4512 plasmid was transformed into E. coli JM109 competent cells, plated on LB agar plates containing chloramphenicol, and incubated overnight at 37°C. Single colonies were picked and inoculated into 10 mL of LB medium (containing chloramphenicol), and incubated overnight at 37°C with shaking at 220 rpm.

[0052] Transfer the overnight culture to fresh LB medium (containing chloramphenicol) at a ratio of 1:100 and incubate at 37°C until... Approximately 0.6. Add IPTG to a final concentration of 1 mM and continue induction culture at 37°C overnight (approximately 16 h). Simultaneously, a non-induced group (without IPTG) and an empty vector control group (transformed with pACYC184 / tac empty plasmid) were set up as controls.

[0053] 5.2 Sample Preparation Collect the bacterial culture and centrifuge at 6000 × g for 5 min at 4 °C, discarding the supernatant. Wash the bacterial pellet twice with pre-chilled PBS buffer (pH 7.4), centrifuging after each wash to collect the bacterial cells. Resuspend the bacterial cells in 2 mL of pre-chilled anhydrous ethanol and transfer to a 2 mL centrifuge tube.

[0054] Centrifuge tubes were placed in an ice-water mixture, and the bacterial cells were disrupted using an ultrasonic disruptor (60 W power, 5 s operation, 5 s interval, total operation time 5 min). The disrupted mixture was then incubated overnight at -80°C to allow for the full release of intracellular small molecule metabolites.

[0055] The following day, the sample was centrifuged at 4°C and 10000 × g for 10 min, and the supernatant was carefully collected. The supernatant was dried using a vacuum dryer and then added... The product of anhydrous methanol redissolution, the solution is... The organic filter membrane was used for filtration, followed by HPLC-MS analysis.

[0056] 5.3 HPLC-MS Detection Results HPLC-MS analysis results are as follows Figure 5 As shown. Compared with the standard, in the JM109 strain sample induced to express pWHU4512, a chromatographic peak with the same retention time (7.2 min) and mass spectrometric characteristics as the UDP-D-arabinose standard was detected (m / z 535 [MH)). - In contrast, no obvious chromatographic peak was observed at this position in the uninduced group and the empty vector control group. This result confirms that heterologous expression of the afhE and afhF genes in E. coli JM109 can synergistically catalyze the production of UDP-D-arabinose within the cell.

[0057] Example 6: Expression and purification of recombinant AfhE and AfhF proteins.

[0058] 6.1 Protein-induced expression The pWHU4511 and pWHU4509 plasmids were transformed into E. coli BL21(DE3) competent cells, respectively, and plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Single clones were picked from each cell and inoculated into 10 mL of LB medium (containing kanamycin) and incubated overnight at 37°C.

[0059] Overnight cultures were transferred to 1 L LB medium (containing kanamycin) at a ratio of 1:100 and incubated at 37°C and 220 rpm until... Approximately 0.6. Lower the culture temperature to 16℃, adjust the rotation speed to 180 rpm, and after the temperature stabilizes, add IPTG to a final concentration of 1 mM, and continue induction culture at 16℃ for 16 h.

[0060] 6.2 Collection and Disruption of Bacterial Cells Collect bacterial cells by centrifuging at 4°C and 6000 × g for 15 min. Resuspend the bacterial pellet in pre-cooled lysis buffer (25 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, pH 8.0) and add 10 mL of lysis buffer per gram of wet bacterial weight.

[0061] The resuspension was placed in an ice bath and homogenized using a high-pressure homogenizer at 4°C and 600 bar for 5 min. The homogenized homogenate was centrifuged at 4°C and 10000 × g for 1 h to remove cell debris and insoluble impurities. The supernatant was then... The solution was filtered through a membrane to obtain a clear crude enzyme solution.

[0062] 6.3 Nickel column affinity chromatography Load the crude enzyme solution onto a 5 mL HisTrap HP nickel column (GE Healthcare) equilibrated with lysis buffer at a flow rate of 1 mL / min. To ensure complete binding, repeat the column pass three times with the supernatant. After loading, wash the column with 3 column volumes of lysis buffer to remove unbound contaminants.

[0063] Subsequently, the fractions were eluted in stages using lysis buffer containing 60 mM, 100 mM, 200 mM, 300 mM and 500 mM imidazole, with each eluent fraction collected.

[0064] 6.4 SDS-PAGE Analysis Each eluted fraction was analyzed by 12% SDS-PAGE. Based on the electrophoresis results, the eluted fraction with the highest protein purity (AfhE is usually eluted by 200-300 mM imidazole, and AfhF is usually eluted by 100-200 mM imidazole) was selected for further purification.

[0065] 6.5 Size Exclusion Chromatography The target protein fractions collected by affinity chromatography were combined and concentrated to 2 mL using an ultrafiltration tube (10 kDa molecular weight cutoff). The concentrate was loaded onto a Superdex 200 Increase 10 / 300 GL column (GE Healthcare) equilibrated with gel filtration buffer (25 mM Tris-HCl, 150 mM NaCl, pH 8.0) at a flow rate of 0.5 mL / min, and each elution peak was collected.

[0066] 6.6 Purity Verification and Protein Preservation The target protein peak was collected and validated by SDS-PAGE. The results are as follows: Figure 6 As shown, the purified AfhE protein exhibited a single protein band with a molecular weight of approximately 66 kDa (consistent with the theoretical molecular weight of 65.7 kDa); the AfhF protein also exhibited a single protein band with a molecular weight of approximately 15 kDa (consistent with the theoretical molecular weight of 14.8 kDa), indicating that high-purity recombinant proteins were obtained.

[0067] The purified AfhE and AfhF proteins were concentrated to approximately 10 mg / mL using ultrafiltration tubes, and the protein concentrations were determined (Bradford method). They were then aliquoted into... Small batches were flash-frozen in liquid nitrogen and stored at -80°C for later use. Approximately 15 mg of AfhE protein and approximately 20 mg of AfhF protein were obtained from 1 L of culture.

[0068] Example 7: In vitro activity detection of Afh and AfhF.

[0069] 7.1 Reaction System Prepare in 1.5 mL centrifuge tubes Reaction system: Tris-HCl buffer: 50 mM, pH 8.0 10 mM D-arabinose-5-phosphate: 1 mM ATP: 1 mM UTP: 1 mM AfhF protein: (about ) AfhE protein: (about ) Simultaneously set the following controls: Control 1: Without AfhE and AfhF Comparison 2: Without AfhE Control 3: Without AfhF Control 4: No ATP added Comparison 5: Without UTP Control 6: AfhE and AfhF were pre-inactivated by boiling. 7.2 Reaction Conditions After mixing the reaction system, place it in a 37°C water bath for 1 hour.

[0070] 7.3 Sample Preparation After the reaction was complete, the reaction solution was transferred to an ultrafiltration membrane with a molecular weight cutoff of 10 kDa and centrifuged at 12000×g for 20 min at 4°C to remove proteins and insoluble impurities. The filtrate was then used directly for HPLC-MS analysis.

[0071] 7.4 HPLC-MS Detection Results HPLC-MS analysis results are as follows Figure 7 As shown. Compared with the control groups, a new chromatographic peak was detected in the complete reaction system (with simultaneous addition of AfhE and AfhF), with a retention time of 11.2 min, consistent with the UDP-D-arabinose standard. Mass spectrometry analysis showed that the molecular ion peak of this peak was m / z 535.1 [MH]. - The molecular weight is consistent with that of UDP-D-arabinose. Secondary mass spectrometry analysis further confirmed the structural characteristics of the product.

[0072] In the control groups lacking any enzyme component (controls 2 and 3), lacking any phosphate donor (controls 4 and 5), or with enzyme inactivation (control 6), no UDP-D-arabinose was detected.

[0073] This result fully confirms that AfhE and AfhF proteins can work synergistically in vitro to catalyze the production of UDP-D-arabinose in the presence of ATP and UTP, using D-arabinose-5-phosphate as a substrate.

[0074] Example 8: Enzymatic Properties Analysis of AfhE and AfhF 8.1 Validation of the bifunctional activity of AfhE To verify the bifunctional activity of AfhE, the following experiment was designed: Kinase activity assay: 50 mM Tris-HCl (pH 8.0) was added to the reaction system. 1 mM D-arabinose-5-phosphate, 2 mM ATP The reaction was carried out at 37℃ for 30 min. The formation of D-arabinose-1,5-bisphosphate was detected by HPLC-MS.

[0075] Pyrophosphorylase activity assay: In 50 mM Tris-HCl (pH 8.0) was added to the reaction system. 1 mM D-arabinose-1-phosphate, 1 mM UTP The reaction was carried out at 37℃ for 30 min. The formation of UDP-D-arabinose was detected by HPLC-MS.

[0076] The results showed that when AfhE exists alone, it can catalyze the formation of D-arabinose-5-phosphate from D-arabinose-1,5-bisphosphate, and it can also catalyze the reaction of D-arabinose-1-phosphate with UTP to form UDP-D-arabinose, confirming its bifunctional enzyme properties.

[0077] 8.2 Metal ion dependence Using different divalent metal ions ( , , , , , (Final concentration 10 mM) to replace the standard reaction system Alternatively, metal ions can be chelated with EDTA (5 mM), and the activity of the dual-enzyme combination can be measured. Results showed: 100% relative activity 82% relative activity 5% relative activity , , <1% relative activity EDTA-treated group: inactive This indicates that the catalytic activity of the dual-enzyme combination depends on divalent metal ions. The optimal metal ion.

[0078] 8.3 pH and temperature characteristics Optimal pH: The activity of the dual enzyme combination was measured in different pH buffers. The results showed that the optimal reaction pH was 8.0-8.5, and the activity remained high in the pH range of 7.5-9.0.

[0079] Optimal temperature: The activity of the dual enzyme combination was measured at different temperatures. The results showed that the optimal reaction temperature was 37℃, and the activity was higher in the range of 30-42℃.

[0080] Example 9: Application of AfhE and AfhF in the preparation of UDP-D-arabinose 9.1 Preparative-scale reaction To verify the application potential of AfhE and AfhF in the preparation of UDP-D-arabinose, a scale-up reaction was conducted. The following were added to a 10 mL reaction system: D-arabinose-5-phosphate: 5 mM (approximately 11.5 mg) ATP: 5 mM (approximately 25.3 mg) UTP: 5 mM (approximately 24.2 mg) 2 μM 1 μM 10 mM Tris-HCl buffer: 50 mM, pH 8.0 The reaction system was incubated at 37°C for 4 hours. Samples were taken every 30 minutes to monitor the reaction progress.

[0081] 9.2 Product Purification After the reaction, the reaction solution was filtered through a 10 kDa ultrafiltration membrane to remove proteins. The filtrate was purified by preparative HPLC under the following conditions: C18 preparative column (10 × 250 mm, 5 μm); mobile phase: 20 mM acetic acid (pH 6.0); flow rate: 5 mL / min; detection wavelength: 260 nm; target peak was collected.

[0082] The collected target fraction was concentrated by rotary evaporation and then freeze-dried to obtain a white powder product.

[0083] 9.3 Product Identification HPLC-MS analysis showed that the purity of the purified product was 96.5%. NMR (nuclear magnetic resonance) further confirmed the product structure. 1 H NMR and 13 C10 NMR spectrum and standard spectrum of UDP-D-arabinose Figure 1 Approximately 21.4 mg of purified product was obtained from a 10 mL reaction system, with a molar conversion of approximately 80%.

[0084] This result indicates that the AfhE and AfhF enzyme combination can be used for large-scale UDP-D-arabinose synthesis, and the mechanism by which AfhE and AfhF catalyze the production of UDP-D-arabinose is as follows: Figure 8 As shown, this provides a key glycosyl donor for subsequent glycosylation research.

[0085] The above embodiments describe in detail the specific implementation of the present invention, and fully demonstrate that the combination of AfhE and AfhF enzymes can synergistically catalyze the production of UDP-D-arabinose from D-arabinose-5-phosphate, and that the green synthesis of UDP-D-arabinose can be achieved through fermentation or enzymatic methods.

[0086] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made using the contents of the present invention's specification and drawings under the inventive concept of the present invention, or direct / indirect applications in other related technical fields, are included within the patent protection scope of the present invention.

Claims

1. An enzyme combination for synthesizing UDP-D-arabinose, characterized in that, Include: (a) AfhE protein, the amino acid sequence of which is shown in SEQ ID NO.3: 1 MKKAVILGAG LATRLYPITH HIPKVLVNYK QDTILSNLYT IYSDLGADEI IVVVHSKFAE 61 TVRAYCEQEG FNVTIRTVDE AYGSAYALAK LHKDLDGHNV IVNWCDIIPD FGSWSWNVNA 121 IYVKGDECRY NFDGENITNV GSTGGNVVGI YQFKDWEFYM GSTDEEIHEY CKGRDFVEFL 181 YGSAFNKSEL MNIIDLGDMP KLEKAHEVRE LNRSFNAVEI GEETVTKIAL TEQGVALQKD 241 EVNWYKKVKS DSVPRIVSYH PGGHFIMERI KGKPAFEYIK SKSSLARPQI VDAILDALKF 301 STDTYFVSPE TVRRDFTKEF YTKVIDRCES IQPLIDSFGK ITHVNYTKIG RLKPMLKQAL 361 EHLIRYHNRS QGQYSVIHGD PNFSNTMITD NCEVKFIDPR GYFGETKIYG PKLYDEAKVL 421 YAVSGYDEFN ANPTWGQFTI DETTCNVSIN INPLVYKYGK MSSFNEYHHL AVAIIWIALG 481 GYFKNNPLKA VAAYYKGMEL LTKQLRNMGR VLQDGSISYD VAEPVTATLI TKNPGKWVLT 541 DKETGVSYRP IGGDITHQWE RI (b) AfhF protein, the amino acid sequence of which is shown in SEQ ID NO.4: 1 MHRVENMLNL CFDVDDCITE WNNNRDYVNF KPDVEMVSAI NALYDAGHTI TLYTARGMKS 61 VGPGRIAIDI LPSLIQNLAN IGLKYHNLLT HKPVYDWIID DKAMRPDEFK ALMNKGEFET 121 FKSYKPNL.

2. The enzyme combination according to claim 1, characterized in that, The AfhE protein is a derivative protein of the amino acid sequence shown in SEQ ID NO.3, which has been substituted, deleted or added with one or more amino acids and has UDP-D-arabinose pyrophosphorylase activity and / or D-arabinose-5-phosphokinase activity. The AfhF protein is a derivative protein of the amino acid sequence shown in SEQ ID NO.4, which has been modified by one or more amino acid substitutions, deletions, or additions and has D-arabinose-1,5-bisphosphatase activity.

3. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the AfhE protein and / or AfhF protein in the enzyme combination of claim 1 or 2, wherein the nucleotide sequence of the nucleic acid molecule encoding the AfhE protein is shown in SEQ ID NO.1, and the nucleotide sequence of the nucleic acid molecule encoding the AfhF protein is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule of claim 3, and the recombinant expression vector simultaneously comprises nucleic acid molecules encoding AfhE protein and AfhF protein.

5. An engineered cell, characterized in that, The engineered cells comprise the recombinant expression vector of claim 4.

6. The engineered cell according to claim 5, characterized in that, The host cell of the engineered cell is a prokaryotic cell or a eukaryotic cell; the prokaryotic cell is preferably Escherichia coli, Streptomyces, Bacillus subtilis or Pseudomonas aeruginosa; the eukaryotic cell is preferably yeast, insect cell, plant cell, mammalian cell or human cell.

7. A method for producing UDP-D-arabinose, characterized in that, Includes the following steps: (1) Culturing the engineered cells of claim 5 or 6 to express AfhE and AfhF proteins; (2) Isolating UDP-D-arabinose from the culture.

8. A method for in vitro enzymatic synthesis of UDP-D-arabinose, characterized in that, Using D-arabinose-5-phosphate as a substrate, the enzyme combination described in claim 1 or 2, ATP, UTP, and divalent metal ions or The reaction proceeds in the presence of [a specific substance], producing UDP-D-arabinose.

9. A reaction system for synthesizing UDP-D-arabinose, characterized in that, It comprises the enzyme combination as described in claim 1 or 2, D-arabinose-5-phosphate, ATP, UTP, and divalent metal ions.

10. The use of the enzyme combination of claim 1 or 2, or the recombinant expression vector of claim 4, or the engineered cell of claim 5 or 6, or the reaction system of claim 9 in the preparation of UDP-D-arabinose.

Images