5' utr for enhancing mrna expression and use thereof

Abstract

This invention provides a 5'UTR for enhancing mRNA expression and its applications. Firstly, this invention provides a nucleic acid molecule selected from one or more nucleic acid molecules shown in any one of SEQ ID NO:3, 5, 8-12, and 14. This invention also provides nucleic acid constructs, recombinant vectors, host cells, mRNA, cells transfected with mRNA, and related applications prepared using any one of the sequences in SEQ ID NO:3, 5, 8-12, and 14 as a 5'UTR. The nucleic acid molecule of this invention, as a 5'UTR, can improve mRNA expression levels and shows excellent promise for application in nucleic acid therapeutics or mRNA vaccines.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid technology, and more specifically, to a 5'UTR for enhancing mRNA expression and its applications. Background Technology

[0002] As an emerging vaccine technology, mRNA vaccines offer advantages over traditional vaccines, including good immunogenicity, no need for adjuvants, and a shorter development cycle. MRNA vaccines produced and marketed by Moderna (mRNA-1273) and Pfizer (BNT162b2) have proven to be among the most effective against the novel coronavirus, greatly promoting the rapid development of nucleic acid drugs, represented by mRNA. In fact, the application of mRNA therapy is not limited to infectious disease vaccines; it also includes tumor immunotherapy, regenerative medicine, and protein replacement therapy. Currently, the main obstacle for most mRNA vaccine development is achieving rapid vaccine development and optimization.

[0003] mRNA therapy typically uses a typical linear mRNA sequence as the carrier for therapeutic effects, usually consisting of five parts: from 5' to 3', the 5' cap, the 5' untranslated region (5'UTR), the coding DNA sequence (CDS), the 3' untranslated region (3'UTR), and the poly(A) tail. For a long time, researchers have been continuously developing and optimizing methods to improve the expression efficiency, stability, immunogenicity, and targeting of mRNA in eukaryotic cells and / or in vivo, focusing on core issues such as the expression efficiency, stability, immunogenicity, and targeting of proteins. These methods include chemical modification, the introduction of enhancers, codon optimization, UTR sequence screening, and poly(A) sequence screening.

[0004] It has been reported that some endogenous genes, such as HSP70 mRNA 5'UTR, α-globin 5'UTR, and CYBA 5'UTR, can improve mRNA translation efficiency. In addition to utilizing 5'UTRs from endogenous genes, 5'UTRs can also be artificially designed de novo. For example, the 5'UTR sequence in Moderna's COVID-19 vaccine was artificially designed de novo.

[0005] Artificially designed novel 5'UTR sequences that enhance mRNA expression levels can increase target protein yield and reduce the unit dose of mRNA administration, making it a key research focus in the field of mRNA drug development. The artificial design of highly efficient mRNA-expressing 5'UTR sequences is of great significance for the application of mRNA therapy. Summary of the Invention

[0006] The purpose of this invention is to provide a 5'UTR sequence that enhances mRNA expression levels for use in mRNA drugs. The 5'UTR nucleotide sequence of this invention is more efficient than the 5'UTR of human α-globin mRNA known in the art.

[0007] On the one hand, the present invention provides a nucleic acid molecule, wherein the nucleic acid molecule is selected from one or more nucleic acid molecules as shown in any one of SEQ ID NO:3, 5, 8-12, 14.

[0008] According to a specific embodiment of the present invention, preferably, the nucleic acid molecule is DNA.

[0009] On the other hand, the present invention provides a nucleic acid construct, the sequence of which comprises, from 5' to 3', the sequence of the above-mentioned nucleic acid molecule and the sequence of the target protein expression gene;

[0010] Preferably, the sequence of the nucleic acid construct further includes one or more of the following sequences:

[0011] promoter;

[0012] kozak sequence;

[0013] 3'UTR;

[0014] Poly(A).

[0015] According to a specific embodiment of the present invention, the target protein expression gene can be a reporter gene or a gene encoding a disease-therapeutic or preventative protein or peptide (e.g., cytokines, antibodies, antigens, immunogenic epitopes, enzymes, hormones, transcription factors, etc.). Preferably, the target protein expression gene is selected from the GFP gene, EGFP gene, Luc gene, IL-2 gene, IL-7 gene, IL-12 gene, IL-23 gene, or an antigen gene expressing a coronavirus, influenza virus, respiratory syncytial virus (RSV), varicella-zoster virus (VZV), or Mycobacterium tuberculosis.

[0016] In this invention, the aforementioned elements can be prepared using conventional methods and then ligated using conventional methods to form the nucleic acid construct described herein. If desired, an enzymatic digestion reaction can be optionally performed before the ligation reaction.

[0017] On the other hand, the present invention provides a recombinant vector having inserted the nucleotide sequence of the above-mentioned nucleic acid construct. The vector can be a cloning vector or an expression vector.

[0018] According to a specific embodiment of the present invention, preferably, the promoter may be a T7 promoter.

[0019] On the other hand, the present invention provides a host cell comprising the above-described recombinant vector. Preferably, the host cell is DH5α, BL21, TOP10, or JM109.

[0020] On the other hand, the present invention provides an mRNA which is obtained by constructing a DNA molecule using the above-mentioned nucleic acid molecule as the 5'UTR and transcribing it in vitro;

[0021] Preferably, the mRNA is unmodified or modified mRNA; the modification is selected from one or more of the following modifications:

[0022] 5' cap structure;

[0023] Poly(A);

[0024] Pseudouridine;

[0025] N1-Methyl-pseudouridine;

[0026] N6-methyladenosine;

[0027] 5-Methylcytidine.

[0028] On the other hand, the present invention provides a cell transfected with the above-mentioned mRNA, wherein the cell is a 293T cell, an A375 cell, a HeLa cell, or a THP-1 cell.

[0029] In a specific embodiment of the present invention, the cell is a 293T cell. Compared with the α-globin 5'UTR sequence, the nucleic acid molecules shown in SEQ ID NO:3, 5, 8-12, 14 provided by the present invention, when inserted as the 5'UTR sequence, can increase the expression level of EGFP in 293T cells by 20.7%-82.9% compared with the insertion of the α-globin 5'UTR sequence.

[0030] On the other hand, the present invention provides a pharmaceutical composition comprising: the above-described mRNA and pharmaceutically acceptable excipients.

[0031] On the other hand, the present invention provides the use of the above-mentioned nucleic acid molecule as a 5'UTR, the above-mentioned nucleic acid construct, the above-mentioned recombinant vector or the above-mentioned host cell in the preparation of mRNA, wherein the mRNA is preferably the above-mentioned mRNA.

[0032] On the other hand, the present invention provides the use of the above-mentioned nucleic acid molecule as a 5'UTR, the above-mentioned nucleic acid construct, the above-mentioned recombinant vector, the above-mentioned host cell, or the above-mentioned mRNA in the preparation of a formulation for improving the expression intensity of a target protein, prolonging the expression time of a target protein, and / or improving the expression of a target protein.

[0033] On the other hand, the present invention provides the use of the above-mentioned nucleic acid molecules as 5'UTR, the above-mentioned nucleic acid constructs, the above-mentioned recombinant vectors, the above-mentioned host cells, or the above-mentioned mRNA in the preparation of medicaments for treating immune system diseases or respiratory diseases, preferably, the medicaments being vaccines.

[0034] Terminology Definition

[0035] In this invention, unless otherwise specified, the term "nucleic acid molecule" refers to a nucleotide sequence consisting of polynucleotides containing purine and pyrimidine bases, wherein the nucleotides represent the primary structure of a nucleic acid molecule. Here, the term "nucleic acid molecule" includes cDNA, genomic DNA, RNA, synthetic DNA, and mixed polymers containing two or more of these molecules. Furthermore, the term "nucleic acid molecule" also includes sense strands and antisense strands.

[0036] The term "nucleic acid construct" refers to single-stranded or double-stranded nucleic acid molecules that are isolated from naturally occurring genes or modified to contain nucleic acid fragments in a manner not found in nature.

[0037] The nucleic acid molecule provided by this invention has excellent mRNA expression-promoting function. Compared with the commonly used α-globin 5'UTR sequence, the insertion of the 5'UTR sequence provided by this invention can increase the expression level of the target protein. The 5'UTR fragment provided by this invention can play a translation-promoting role in multiple genes and multiple types of host cells, showing broad-spectrum activity and demonstrating application prospects in the preparation of RNA therapeutics or mRNA vaccines. The 5'UTR can serve as an enhancer for RNA molecule expression in RNA therapeutics or mRNA vaccines. Attached Figure Description

[0038] Figure 1 This is a diagram of the carrier template in the embodiment.

[0039] Figure 2 This is a schematic diagram of the vector structure containing the target mRNA sequence in the embodiment.

[0040] Figure 3 The fluorescence intensity of different UTR EGFP mRNAs in 293T cells over 24 hours is shown in the examples. Detailed Implementation

[0041] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0042] Table 1 lists the sequences and names involved in the embodiments.

[0043]

[0044]

[0045]

[0046]

[0047] Example

[0048] This study used the EGFP gene as a reporter gene to investigate the regulatory effects of different 5'UTRs (corresponding to SEQ ID NO: 1-16), including the control group α-globin 5'UTR, on EGFP-mRNA expression in 293T cells. Specific sequences are shown in Table 1, and the detailed process is as follows:

[0049] 1. Plasmid construction

[0050] To facilitate subsequent experiments, the 5' end of all 5'UTRs (corresponding to SEQ ID NO:1-16) in Table 1, including the control group α-globin 5'UTR, was uniformly augmented with the sequence 5'-CAGAAGCTAATACGACTCACTATA-3' (SEQ ID NO:22), and the 3' end was uniformly augmented with the sequence 5'-atggtgagcaagggc-3' (SEQ ID NO:20). Genentech was then outsourced to synthesize the gene. In this embodiment, the existing plasmid SEQ ID NO:19 was modified, and the 5'UTR was constructed at the 5' end of the plasmid CDS. The specific steps are as follows:

[0051] (a) PCR: Using SEQ ID NO:20 and SEQ ID NO:21 as primers, existing plasmids as templates, and PrimeSTAR Max DNA Polymerase from Takara as polymerase, PCR amplification was performed to obtain PCR products.

[0052] (b) Enzyme digestion: The PCR product was digested with NEB's RI, the corresponding 5'UTR gene fragment was added, and then the product was treated with NEB's T5 exonuclease.

[0053] (c) Transformation: The T5 exonuclease digestion product was chemically transformed into the DH5α strain by Escherichia coli.

[0054] (d) Sequencing: The transformants were sequenced to obtain plasmids correctly inserted into the 5'UTR. The plasmid map is shown below. Figure 1 As shown.

[0055] All plasmid construction steps are the same as above.

[0056] 2. Template preparation

[0057] Using the plasmid successfully constructed in step 1 as a template, a PCR reaction was configured, and the system is shown in Table 2:

[0058] Table 2 Reaction System

[0059] reagents Volume (μL) Forward primer 3 Reverse primer 3 PCR mix 50 DNA template 1 Nuclease-free water Up to 100

[0060] After mixing, the samples were placed in a PCR instrument for PCR reaction, following the procedure: 95℃ for 3 min, (95℃ for 20 s, 55℃ for 20 s, 72℃ for 30 s) × 22, 72℃ for 5 min. The PCR products were then analyzed by agarose gel electrophoresis to confirm the band sizes were correct. Linear DNA was obtained, comprising the T7 promoter, the 5' UTR, the EGFP gene (SEQ ID NO: 17), the 3' UTR (SEQ ID NO: 18), and a polyA sequence from the 5' end to the 3' end. OMEGA was used. Gel extraction was performed using a gel extraction kit for purification. Purity was confirmed by nanodrop evolutionary quantification and agarose gel electrophoresis.

[0061] Among them, the forward primer sequence in Table 2 is TTGGACCCTCCGTACAGAAGCTAATACG (SEQ ID NO.23), and the reverse primer sequence is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTACTCAGGCTTTATTCAAAGA CCA (SEQ ID NO.24).

[0062] 3. mRNA synthesis and purification

[0063] The configuration of the IVT system is shown in Table 3:

[0064] Table 3 IVT System

[0065] reagents Volume (μL) ATP 7.5 T7 RNA Ploymerase 20 Inorganic Pyrophosphatase 2 Rnase inhibitor 5 CTP 7.5 GTP 7.5 N1-Me-Pseudo UTP 7.5 CAG Trimer 7.5 Buffer (10×) 10 Linear DNA template 5 (≥200 ng / μL) Nuclease-free water up to 100

[0066] The above system was reacted in a metal bath at 37°C for 4 hours. Then, 10 μL of DNase I was added and the reaction was continued at 37°C for 30 minutes to remove DNA from the system. The DNA was analyzed using MEGAclear technology from Thermo Fisher Scientific.TM RNA purification was performed using a Transcription Clean-Up Kit. Agarose gel electrophoresis was performed for detection, and quantification was conducted using nanodrop. A schematic diagram of the vector structure containing the target mRNA sequence is shown below. Figure 2 As shown, the reporter gene is the EGFP gene.

[0067] 4. Cell experiments

[0068] 4.1 Cell resuscitation

[0069] Prepare complete culture medium (89% DMEM + 10% FBS + 1% Penicillin-Streptomycin Solution, total volume 500 mL). Take 293T cells and thaw them in a 37°C water bath. Pipette the thawed cell suspension into a 15 mL centrifuge tube, add complete culture medium to a total volume of 10 mL, centrifuge at 1000 rpm for 5 min, and discard the supernatant. Resuspend the cells in an appropriate amount of complete culture medium and transfer them to a cell culture flask for incubation.

[0070] 4.2 Cell transfection

[0071] Remove cells in the logarithmic growth phase from the CO2 incubator, rinse once with 10 mL PBS, digest with 2 mL Trypsin-EDTA, and stop digestion with 4 mL complete culture medium. Transfer the digested cells to 15 mL centrifuge tubes; centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the cells in 5 mL complete culture medium. Count the cells from the cell suspension and dilute the cell density to 7 × 10⁶ cells / mL. 4 Seeds were collected at a concentration of 0.1 μg mRNA / mL and seeded into 96-well plates. Cells were incubated overnight. The transfection complex was prepared as follows: 0.1 μg mRNA + 12.5 μL mRNA buffer, vortexed to mix; 0.2 μL JetMESSENGER transfection reagent was added, and the mixture was gently pipetted 10 times. The mixture was then allowed to stand for 15 min. Transfected cells were aspirated and added to 96-well plates. Cells were observed under a fluorescence microscope and collected for FACS analysis after 24 h of transfection.

[0072] 4.3 Flow cytometry detection

[0073] 24 h after transfection, the culture medium was discarded, and the cells were gently rinsed once with 100 μL PBS. The PBS was removed, and 50 μL of Trypsin containing 0.25% EDTA was added for digestion. The digestion was stopped by adding 150 μL of complete culture medium, and the digested cells were transferred into 96-cell conical plates. The 96-cell conical plates were centrifuged at 500g for 5 min. The supernatant was removed, and the cells were resuspended in 100 μL PBS. The EGFP expression level was detected by flow cytometry.

[0074] The results showed that, Figure 3As shown, in 293T cells, compared with the control sequence α-globin 5'UTR (SEQ ID NO. 16), among the 15 experimental 5'UTR sequences tested, the insertion of 3 5'UTR sequences increased the expression level of the EGFP reporter gene by more than 20%, namely: UTR_r2_23 (SEQ ID NO. 3) by 27.0%; UTR_r2_32 (SEQ ID NO. 12) by 22.6%; and UTR_r2_34 (SEQ ID NO. 14) by 20.7%. The insertion of 3 5'UTR sequences increased the expression level of the EGFP reporter gene by more than 30%, namely: UTR_r2_25 (SEQ ID NO. 5) by 31.6%; UTR_r2_28 (SEQ ID NO. 8) by 36.6%; and UTR_r2_30 (SEQ ID NO. 10) by 30.2%. The insertion of one 5' UTR sequence increased the expression level of the EGFP reporter gene by more than 60%, specifically a 61.1% increase for UTR_r2_31 (SEQ ID NO.11). The insertion of another 5' UTR sequence increased the expression level of the EGFP reporter gene by more than 80%, specifically an 82.9% increase for UTR_r2_29 (SEQ ID NO.9).

Claims

1. A nucleic acid molecule, said nucleic acid molecule being selected from one or more nucleic acid molecules such as SEQ ID NO:3, 5, 8-12, 14.

2. A nucleic acid construct, wherein the sequence of the nucleic acid construct comprises, from 5' to 3', the following: The sequence of the nucleic acid molecule and the target protein expression gene sequence as described in claim 1; Preferably, the sequence of the nucleic acid construct further includes one or more of the following sequences: promoter; kozak sequence; 3'UTR; Poly(A).

3. A recombinant vector having inserted the nucleotide sequence of the nucleic acid construct of claim 2.

4. A host cell comprising the recombinant vector of claim 3.

5. An mRNA, which is obtained by constructing a DNA molecule using the nucleic acid molecule of claim 1 as the 5'UTR and transcribing it in vitro; Preferably, the mRNA is unmodified or modified mRNA; the modification is selected from one or more of the following modifications: 5' cap structure; Poly(A); Pseudouridine; N1-Methyl-pseudouridine; N6-methyladenosine; 5-Methylcytidine.

6. A cell transfected with the mRNA of claim 5, preferably, the cell is a 293T cell, an A375 cell, a HeLa cell, or a THP-1 cell.

7. A pharmaceutical composition comprising: the mRNA of claim 5 and a pharmaceutically acceptable excipient.

8. The use of the nucleic acid molecule of claim 1 as a 5'UTR, the nucleic acid construct of claim 2, the recombinant vector of claim 3, or the host cell of claim 4 in the preparation of mRNA, wherein, The mRNA is preferably the mRNA described in claim 5.

9. The use of the nucleic acid molecule of claim 1 as a 5'UTR, the nucleic acid construct of claim 2, the recombinant vector of claim 3, the host cell of claim 4, or the mRNA of claim 5 in the preparation of formulations for improving the expression intensity of target protein, prolonging the expression time of target protein, and / or improving the expression of target protein.

10. The use of the nucleic acid molecule of claim 1 as a 5'UTR, the nucleic acid construct of claim 2, the recombinant vector of claim 3, the host cell of claim 4, or the mRNA of claim 5 in the preparation of a medicament for treating immune system diseases or respiratory diseases, preferably, the medicament is a vaccine.

Images