Expression cassette for preparing attenuated influenza vaccine, recombinant vector and application thereof
By introducing the DD protein system into the NS protein of influenza virus, a conditionally replication-deficient virus was constructed. The virus replication was regulated by the chemical small molecule Shield-1, which solved the safety and rapid production problems of existing attenuated influenza vaccines and achieved a highly safe and immunogenic influenza vaccine strategy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-19
AI Technical Summary
Existing live attenuated influenza vaccines (LAIV) have concerns regarding safety and rapid production, and face the problem of immune escape caused by antigenic drift and antigenic shift of seasonal circulating influenza viruses. The efficacy of traditional influenza vaccines is challenged, and there is a lack of effective new strategies.
A conditional replication-deficient virus (DDN-NS) was introduced into the NS protein of influenza virus using the DD protein system. Viral replication was regulated by the chemical small molecule Shield-1 to construct a conditional replication-deficient virus, thereby achieving external chemical control of viral replication and exhibiting both high safety and strong immunogenicity.
It achieved significant viral attenuation in the absence of Shield-1, restored replication ability in the presence of Shield-1, stimulated a strong immune response, provided a safe and effective influenza vaccine candidate strain, and improved the safety and stability of the vaccine.
Smart Images

Figure CN122235185A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to an expression cassette, recombinant vector, and their applications for preparing attenuated influenza vaccines. Background Technology
[0002] Globally, up to 650,000 people die each year from seasonal influenza virus infections, making the prevention and treatment of pathogenic viruses a major public health issue. Vaccines are considered a fundamental and effective measure for controlling and preventing influenza virus infection. However, in reality, commercially available vaccines offer limited protection against influenza viruses. A universal vaccine technology that can retain as many viral antigens as possible and rapidly respond to the virus's high variability has become a key goal for current vaccine researchers. Live attenuated influenza vaccines (LAIVs) received widespread attention upon their initial introduction because of their potential to induce a more durable and stronger immune response and their ease of administration. Nevertheless, LAIVs also have some drawbacks, such as long R&D cycles and the risk of virulence reversal.
[0003] With the development of reverse genetics and synthetic biology, several novel attenuation strategies have been used to create LAIVs with better control over replication and pathogenesis. Examples include NS1 truncated viruses, microRNA attenuated viruses, codon-deoptimized viruses, viruses carrying premature stop codons (PTCs), hyperinterferon-sensitive viruses, proteolytic targeted chimeric first and second generation (PROTAC & PROTAR) viruses, and 4-HT-regulated viruses. However, these reported strategies have not completely eliminated concerns about the safety and rapid production of LAIVs. Furthermore, the persistent antigenic drift and antigenic shifts of seasonal circulating influenza viruses, leading to immune escape, pose a significant challenge to the efficacy of traditional influenza vaccines. Given its high mortality rate and rapid spread, the development of effective vaccines using novel strategies remains a top priority.
[0004] Previously, Laura A. Banaszynski et al. developed a small, intrinsically unstable destabilizing domain (DD) to confer instability upon any fusion chaperone protein. This system allows the conditional stability of proteins to be controlled by a small molecule, Shield-1, which causes these fusions to rapidly and constitutively degrade in a proteasome-dependent manner when expressed in cells. Binding of the small molecule ligand (Shield-1) to this destabilizing domain stabilizes the fusion protein and protects it from degradation, thereby restoring the function of the target protein. This destabilizing domain can confer ligand-dependent stability to a variety of proteins, thus achieving versatility. However, there are currently no engineered attenuated vaccines designed with destabilizing domains against influenza A virus. Summary of the Invention
[0005] To address the aforementioned problems, this invention provides an expression cassette, recombinant vector, and their applications for preparing attenuated influenza vaccines. Utilizing the DD protein system, a conditionally replication-deficient influenza virus vaccine strain was constructed, achieving chemical control of viral replication and exhibiting both high safety and strong immunogenicity, thus providing a new strategy for influenza vaccine development.
[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides an expression cassette for preparing an attenuated influenza vaccine, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] This invention provides a recombinant plasmid for preparing an attenuated influenza vaccine, comprising a basic plasmid and an expression cassette cloned onto the basic plasmid; the expression cassette is the expression cassette described in the above technical solution.
[0008] Preferably, the base plasmid includes the pHW2000 plasmid.
[0009] Preferably, the expression cassette is located between two BsmBI restriction sites on the pHW2000 plasmid.
[0010] This invention provides a plasmid set for preparing an attenuated influenza vaccine, comprising plasmids 1-7 and the recombinant plasmids described in the above technical solution; wherein plasmids 1-7 are recombinant plasmids expressing the HA, NA, PA, PB1, PB2, NP and M proteins of H1N1 virus, respectively.
[0011] Preferably, the accession numbers of the genes encoding the HA, NA, PA, PB1, PB2, NP, and M proteins in the NCBI database are as follows: PB2: AB671295.1, PB1: MZ310487.1, PA: MZ310488.1, HA: AB671289.1, NA: MZ310491.1, NP: CY047401.1, M: OM488265.1.
[0012] This invention provides an attenuated influenza virus, obtained by viral packaging of the plasmid group described in the above technical solution.
[0013] Preferably, the transfected cells used for the virus packaging include 293T cells.
[0014] The present invention provides the application of the expression cassette, recombinant plasmid, plasmid group, or attenuated influenza virus described in the above-mentioned technical solutions in the preparation of influenza vaccines.
[0015] This invention provides an influenza vaccine prepared from the attenuated influenza virus described in the above technical solution.
[0016] Beneficial effects: The expression cassette provided by this invention introduces the DD protein domain into the NS protein of influenza virus (A / PR8 / H1N1) for the first time, constructing a conditionally replication-deficient virus (denoted as DDN-NS). The constructed virus exhibits limited replication in the absence of shield-1, but recovers its replication ability in the presence of shield-1, achieving external chemical control over viral replication. This approach combines high safety with strong immunogenicity, providing a new strategy for influenza vaccine development.
[0017] This invention systematically inserts DD domains into the carboxyl and amino termini of eight influenza protein fragments (HA, NA, PA, PB1, PB2, NP, M, and NS), screening for optimal fragments and sites to achieve efficient and controllable viral replication and attenuation. Through multi-site screening, the safety and stability of the vaccine are improved.
[0018] The conditionally replication-deficient virus (DDN-NS) constructed in this invention is significantly attenuated in vivo and in vitro under the absence of shield-1, but can elicit a strong humoral and cellular immune response after immunization, providing protection against wild-type virus attack, and can be used as a safe and effective candidate strain for influenza vaccine. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0020] Figure 1 The plasmids pHW2000-PR8-WT and pHW2000-PR8-ddFKBP were constructed. In section a, 01-08 represent the sequentially constructed plasmids PB2-pHW2000, PB1-pHW2000, PA-pHW2000, HA-pHW2000, NP-pHW2000, NA-pHW2000, M-pHW2000, and NS-pHW2000, with plasmid sizes matching the design. In section b, 09-25 represent the sequentially constructed DDN-PB2... Plasmids PB2-DDC, DDN-PB1, PB1-DDC, DDN-PA, PA-DDC, DDN-HA, HA-DDC, DDN-NP, NP-DDC, DDN-NA, NA-DDC, DDN-NS, NS-DDC, DDN-M, M1-DDC, and M2-DDC are shown; plasmid sizes are correct as designed. c shows the comparison results between NS-pHW2000 plasmid elements and sequencing data. d shows the comparison results between DDN-NS-pHW2000 plasmid elements and sequencing data. Figure 2 The whole virus yield (WT) after transfection of 293T cells with reverse genetics system before and after DD fusion to rescue the virus; Figure 3 Transmission electron microscope image of wild-type influenza virus; Figure 4 Transmission electron microscope image of DDN–NS virus; Figure 5 To detect the titer of amplified virus in chicken embryos using plaque assays; Figure 6 Reverse genetics system transfection of 293T cells rescues viral cytopathic effects; Figure 7 Viral survival curves after A549 cells were infected with WT and DDN-NS; Figure 8 The experimental results show the Shield-1-dependent expression of DDN-NS in chicken embryos; Figure 9 The 14-day survival rate of mice infected with WT virus (a) and DDN-NS virus (b) and the 14-day body weight curves of mice in different groups of infected mice (c); Figure 10 A schematic diagram illustrating the process of adjusting the DD virus replication mechanism for Shield-1. Detailed Implementation
[0021] This invention provides an expression cassette for preparing an attenuated influenza vaccine, the nucleotide sequence of which is shown in SEQ ID NO.1, and is detailed below: agcaaaagcagggtgacaaaaacataATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGTGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAAGTCGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTAT GCTAGGCAAGCAGGAGGTGATCCGAGGCTGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACCGGAA GGTGGAGGTGGATCTGGAGGTG GAGGTTCTGATCCAAACACTGTGTCAAGCTTTCAGGTAGATTGCTTTCTTTGGCATGTCCGCAAACGAGTTGCAGACCAAGAACTAGGCGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAAATCCCTAAGAGGAAGGGGCAGTACTCTCGGTCTGGACATCAAGACAGCCACACGTGCTGGAAAGCAGATAGTGGAGCGGATTCTGAAAGAAGAATCCGATGAGGCACTTAAAATGACCATGGCCTCTGTACCTGCGTCGCGTTACCTAACTGACATGACTCTTGAGGAAATGTCAAGGGACTGGTCCATGCTCATACCCAAGCAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGGATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGGAGACTCTAATATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTTCTCTTCCAGGACATACTGCTGAGGATGTCAAAAATGCAGTTGGAGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGAATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAACAATTAGGTCAGAAGTTtgaagaaataagatggttgattgaagaagtgagacacaaactgaagataacagagaatagttttgagcaaataacatttatgcaagccttacatctattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttagtactaaaaaacacccttgtttctact; Among them, the lowercase sequence agcaaaagcagggtgacaaaaacata (SEQ ID NO.2) of 1-26 bp is the 5' untranslated region (5' NCR), the ATG of 27-29 bp is the start codon, the sequence of 30-350 bp (SEQ ID NO.3) is the DD element, the sequence of 351-380 bp (SEQ ID NO.4) is the linker, the sequence of 381-1067 bp (SEQ ID NO.5) is the open reading frame of the NS gene without the start codon, and the sequence of 1068-1241 bp (SEQ ID NO.6) is the stop codon and the 3' untranslated region (3' UTR) of the NS gene.
[0022] The expression cassette provided by this invention introduces for the first time a chemically regulated protein stabilization switch, namely the DD:Shield-1 system (Destabilizing domain, DD), into influenza A virus. Using this system, the stability of the target protein (POI) can be specifically regulated, thereby modulating viral replication. Specifically, when the target protein POI fuses with a constitutive degradation domain or degrader DD, in the absence of the small molecule (Shield-1), DD itself, along with the fused target protein POI, rapidly degrades, and the POI loses its function. When the specific small molecule ligand Shield-1 is present, DD and its fusion protein remain stable, and the POI retains its function. Figure 10 This invention first utilizes a reverse genetics system to rescue all candidate mutant viruses in HEK293T cells. Screening revealed that viral replication exhibited the most stringent Shield-1-dependent regulation when DD and NS were fused at the N-terminus. Ultimately, IAV modified with the DDN-NS fusion was selected as a candidate live attenuated vaccine. The expression cassette provided by this invention achieves external chemical control of viral replication, possessing both high safety and strong immunogenicity, offering a new strategy for influenza vaccine development.
[0023] Based on the above advantages, the present invention provides a recombinant plasmid for preparing an attenuated influenza vaccine, comprising a basic plasmid and an expression cassette cloned onto the basic plasmid; the expression cassette is the expression cassette described in the above technical solution.
[0024] In one embodiment, the base plasmid includes the pHW2000 plasmid. In another embodiment, the expression cassette is located between the two BsmBI restriction sites of the pHW2000 plasmid; that is, the expression cassette is inserted between the two BsmBI restriction sites of the pHW2000 plasmid.
[0025] Based on the above advantages, this invention provides a plasmid set for preparing an attenuated influenza vaccine, comprising plasmids 1-7 and the recombinant plasmids described in the above technical solution; plasmids 1-7 are recombinant plasmids expressing the HA, NA, PA, PB1, PB2, NP, and M proteins of H1N1 virus, respectively. As one embodiment, the accession numbers of the encoding genes of the HA, NA, PA, PB1, PB2, NP, and M proteins in the NCBI database are as follows: PB2: AB671295.1, PB1: MZ310487.1, PA: MZ310488.1, HA: AB671289.1, NA: MZ310491.1, NP: CY047401.1, M: OM488265.1.
[0026] Based on the above advantages, the present invention provides an attenuated influenza virus, which is obtained by viral packaging of the plasmid group described in the above technical solution.
[0027] In one embodiment, the transfected cells used for virus packaging include 293T cells. The present invention does not impose any special requirements on the virus packaging method; methods well known to those skilled in the art can be used.
[0028] Based on the above advantages, the present invention provides the application of the expression cassette, recombinant plasmid, plasmid group, or attenuated influenza virus described in the above technical solutions in the preparation of influenza vaccines.
[0029] Based on the above advantages, this invention provides an influenza vaccine prepared from the attenuated influenza virus described in the above technical solution. This invention does not impose special requirements on the preparation method of the influenza vaccine; methods well-known to those skilled in the art can be used.
[0030] To further illustrate the present invention, the expression cassette, recombinant vector, and their applications for preparing an attenuated influenza vaccine provided by the present invention will be described in detail below with reference to embodiments and accompanying drawings, but these should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1 Influenza virus (PR8, H1N1) is an eight-segment inverted RNA virus. The establishment of an eight-plasmid transfection system has greatly promoted influenza genomics research. Each plasmid carries a gene segment of influenza virus PR8 (A / Puerto Rico / 8 / 1934, H1N1), namely HA, NA, PA, PB1, PB2, NP, M, and NS. Simultaneous transfection of these eight plasmids (equal volumes and concentrations) into 293T cells yields wild-type influenza virus. This invention incorporates a chemically regulated protein stabilizing switch (DD:Shield-1 system) into influenza A virus to construct an attenuated influenza virus. The steps are as follows: I. Cell Culture 293 cells (293T, ATCC, CRL-1573) or MDCK (ATCC, CCL-34) were cultured in DMEM (Life Technologies) supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin (Life Technologies, 100 μ / ml). All cells were maintained in a humidified incubator at 37°C and 5% CO2. All cell lines used in the experiments were mycoplasma-free, a finding confirmed by the Mycoplasma Polymerase Chain Reaction Assay Kit (SIGMA).
[0032] II. Plasmid Design 1. Constructing the WT-PR8 plasmid The construction method for eight plasmids containing the cDNA of Influenza A virus A / PR / 8 / 34 (H1N1) [pHW2000-PB2, pHW2000-PB1, pHW2000-PA, pHW2000-HA, pHW2000-NP, pHW2000-NA, pHW2000-M, and pHW2000-NS] is as follows: The eight-segment gene sequences of H1N1 (PB2: AB6) were obtained from the NCBI database. The gene sequence was synthesized using the following gene sequences: 71295.1, PB1: MZ310487.1, PA: MZ310488.1, HA: AB671289.1, NA: MZ310491.1, NP: CY047401.1, M: OM488265.1, NS: JX120148.1. A BsmBI restriction enzyme site (CGTCTC) was added to the 5' end of the synthesized gene. The pHW2000 plasmid and the synthesized gene sequence were digested using the BsmBI seamless cloning kit and ligated. The fragment was then cloned into the pHW2000 vector. To ensure that the viral cDNA obtained by RT-PCR amplification in the expression plasmid was free of unexpected mutations, the inserted cDNA was sequenced for verification (electrophoresis results are shown in [link to electrophoresis results]). Figure 1(a) Eight plasmids of WT-PR8 were obtained. A schematic diagram of the pHW2000-NS plasmid (NS-pHW2000) and sequencing alignment results are shown in [reference needed]. Figure 1 c.
[0033] 2. Construct recombinant plasmids containing DD engineered version elements. The "DD engineered version element" was integrated into the eight plasmids constructed in step 1 to obtain recombinant plasmids. Agarose gel electrophoresis was then performed to observe whether the constructed recombinant plasmids matched the predicted gene size. Figure 1 (b) Simultaneously, sequencing and alignment were performed, and the alignment results showed that the plasmid sequence was completely consistent with the expected design, indicating that the gene construction was accurate. DD elements were inserted into the N-terminus and C-terminus of each of the eight gene segments, resulting in a total of 17 recombinant plasmids (see [link to article]). Figure 2 (WT is the corresponding WT-PR8 plasmid), the construction method is as follows: Using the eight WT-PR8 plasmids constructed in step 1 as vector backbones, sequences containing engineered DD elements were first synthesized by a gene company. These sequences were then seamlessly ligated into the WT-PR8 plasmids to obtain recombinant plasmids. A schematic diagram of the DDN-NS plasmid elements and sequencing alignment results are shown below. Figure 1 d.
[0034] Taking the DDN-NS plasmid (DD element at the N-terminus) as an example, the engineered version of the DD element is inserted into the NS-pHW2000 plasmid. Specifically, the insertion location is after the ATG terminus of the start codon in the NS open reading frame. The inserted engineered version of the DD element is shown in SEQ ID NO.7, as follows: GGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGTGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAAGTCGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTG GGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACCGGAAGGTGGAGGTGGATCTGGAGGTGGAGGTTCT.
[0035] Taking the NS-DDC plasmid (DD element at the C-terminus) as an example, the engineered version of the DD element is inserted into the NS-pHW2000 plasmid. Specifically, the insertion position is before the carboxyl terminator of the NS open reading frame. The inserted engineered version of the DD element is shown in SEQ ID NO.8, as follows: GGTGGAGGTGGATCTGGAGGTGGAGGTTCTGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGGAGATGGAAAGAAAGTTGACTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAA GCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGGGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAGAACTGGAA; among them, the sequence of 1-30 bp (SEQID NO.4) is the Linker, and the 31-351bp sequence (SEQ ID NO.9) is the DD element set at the C-terminal.
[0036] Figure 2 The partial sequences (M1 gene + DD element, M2 gene + DD element) in the M1-DDC and M2-DDC plasmids are as follows: M1-DDC (SEQ ID NO.10): M2-DDC(SEQ ID NO.11):
[0037] The DDN-NS plasmid was transformed into DH5α competent cells. The host bacteria were plated on solid plates and incubated at 37 ℃ for 16 h. After single colonies grew, a single colony was picked from the solid plate and transferred to 3 mL of liquid culture medium. The culture was then incubated until the exponential growth phase. 500 μL of the culture was transferred to 50 mL of liquid culture medium and incubated at 37 ℃ for 16 h. The plasmid was extracted and its size was confirmed by agarose gel electrophoresis. Figure 1 (b) Obtained through the above method. Figure 2 The other 16 DD mutant plasmids.
[0038] III. Virus Packaging After washing and trypsin digestion of 293T cells in 10cm dishes, the cells were seeded into 6 wells (replicas) of 24-well plates, with 500μl of culture medium per well and a cell density of 80%-90%. After 12-24 hours, the influenza 8 plasmid transfection experiment was started. (1) Dilute each plasmid to 50 ng / μl in advance to facilitate the calculation of plasmid amount during transfection.
[0039] (2) Transfection process: each well was transfected with lipo3000 transfection reagent with a total mass of 500 ng of plasmid.
[0040] (3) The above transfection mixture was directly added to the cells in 6 wells of a 24-well plate, mixed well and cultured for 24 hours. The cell supernatant was collected and stored at -80℃.
[0041] (4) After 48 hours of transfection, the cell supernatant was collected into chicken embryos and stored at 37°C for 48 hours. The allantoic fluid was collected, centrifuged at 8000 rpm for 5 minutes, and hemagglutination was detected. The cells were then aliquoted and frozen at -80°C.
[0042] (5) RNA was extracted from allantoic fluid using the Tiangen RNA extraction kit, and cDNA was reverse transcribed. The cDNA was then amplified using the corresponding primers (Table 1) and sequenced to obtain the original virus.
[0043] Table 1 PCR Primers
[0044] IV. Screening of DD element insertion sites for influenza A virus To further evaluate the efficacy and regulatory performance of the attenuated live vaccine at the cellular level, this embodiment used human embryonic kidney 293T cells as a model. Mutant viruses were constructed using an eight-plasmid reverse genetics system carrying the PR8 genome of influenza A virus. The 17 recombinant influenza A virus DD mutant plasmids constructed above, along with 7 other plasmids encoding wild-type (WT) viral proteins, were co-transfected into 293T cells using the Lipofectamine 3000 system (see steps 3(1)-(3)). After transfection, cells were treated with or without 500nm Shield-1. Supernatant and cells were collected at 24h and 48h, respectively. Western blot analysis of the cell samples was performed, and the results are shown in […]. Figure 2 .
[0045] The results showed that the expression of the eight wild-type (WT) proteins was not affected by Shield-1. The fusion protein bands were slightly higher than the markers of their respective WT proteins. Among all 17 mutants, only the corresponding protein expression levels of HA-DDC, NP-DDC, NS-DDC, DDN-NS, PA-DDC, PB1-DDC, PB2-DDC, and DDN-PB2 showed a certain degree of Shield-1 dependence. Western blot analysis showed that inserting DD elements into the N-terminus (N-terminus) and C-terminus (C-terminus) of influenza A virus could stably express the target protein band of the expected size and be regulated by Shield-1. However, the translation status of DDN-NS was better than others. The following examples only used DDN-NS with good expression specificity for the experiment.
[0046] Example 2 Viral morphological observation To visually observe the morphological integrity of the DDN-NS virus prepared in Example 1, the morphology of the mutant virus particles was observed using transmission electron microscopy. The electron microscope images showed that the DDN-NS virus particles were typical spherical influenza virus particles, approximately 100 nm in diameter. The envelope structure of the virus particles was clearly visible, and their morphological characteristics were similar to those of wild-type influenza viruses, indicating that the engineering modification did not affect the normal assembly and structural integrity of the virus particles. Figure 3 and Figure 4 ).
[0047] Titration of virus titer To accurately determine the infectivity of the virus after replication, a plaque formation assay was performed in this embodiment. The results showed that the virus could form clear, well-defined plaques on MDCK cells. The accurate viral titer (PFU / mL) was obtained by counting the plaques, with a WT viral titer of 1 × 10⁻⁶. 8 PFU / mL, DDN-NS virus titer is 1×10⁻⁶ 10 PFU / mL ( Figure 5 ).
[0048] Plaque experiment: Madin-Darby canine kidney (MDCK) was cultured and passaged stably for 3 generations. The cells were then seeded into 24-well plates, with approximately 1 × 10⁶ cells per well. 5 indivual; Virus gradient dilution, 3 parallels, 1 mock: 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 (The original concentration is not required). When diluting: the final volume of each well is 200 μl. Serial dilution is performed in a 96-well plate, with 20 μL + 180 μL of culture medium aspirated each time for dilution. Once the cells have grown into a monolayer, discard the original culture medium in the 24-well plate; Wash cells with DMEM medium, repeat twice; Discard the culture medium in the 24-well plate, add 400 μL of serum-free virus isolation culture medium, and then add 100 μL of diluted virus solution to each well, starting from a low concentration. Shake to mix well and return to a 37 ℃, 5% CO2 incubator for 1 h, shaking once every 15 min during the process. Discard the incubated virus solution, add the top covering material, and incubate at room temperature for 20 min. Then, invert the container and place it back in a 37 ℃, 5% CO2 incubator for 3-5 days. The top covering material consists of: 25 mL 2×DMEM medium + 20 μL low melting point agar + 5 mL ddH2O; 0.2 μg / ml TPCK. Observe the spot formation daily. After spot formation, fix the cells (the spot size should ideally be 1 mm). Add 500 μL of 4% paraformaldehyde fixative to each well for at least 2 hours, or overnight. After fixation, the cells will die and can be removed for further processing. Discard the paraformaldehyde fixative and gently rinse away the gel with water; After staining with crystal violet for 20 minutes, rinse the crystal violet off with water and then air dry in an incubator at 37 ℃. Take photos on the LED lightbox, count the empty spots, and calculate the empty spot formation units (PFU / mL): Empty spot formation units (PFU / mL) = Average number of empty spots per well / Virus inoculation amount per well (ml) × Virus dilution.
[0049] Cellular CPE effect The generation and characteristics of Shield-1 dependent influenza A viruses To further verify the regulatory function of the DDN-NS element, this embodiment co-transfected the DDN-NS recombinant viral plasmid with the remaining seven unmodified segment plasmids of influenza virus (pHW2000-PB2, pHW2000-PB1, pHW2000-PA, pHW2000-HA, pHW2000-NP, pHW2000-NA, and pHW2000-M) into HEK293T cells to attempt to rescue Shield-1-dependent recombinant virus in vitro. After transfection, a treatment group supplemented with 500 nM Shield-1 (S+) and a control group without Shield-1 (S-) were set up. Untransfected HEK293T cells without any drugs were set up as a blank control group (NC).
[0050] Cells from different groups were observed and recorded using an optical microscope at two time points, 24h and 48h, to assess whether viral production depended on Shield-1.
[0051] The results showed that Shield-1 treatment had no significant effect on CPE after wild-type virus rescue; however, in the DDN-NS recombinant virus system, significant cytopathic effects were observed in the Shield-1 treated group, while no significant CPE was observed in the untreated group. Figure 6 This result demonstrates that the rescue and replication of the DDN-NS virus exhibit a clear Shield-1 dependence, further confirming the tunable activity of this engineered element at the viral level.
[0052] Virus growth curve A549 cells were seeded in 24-well plates until the cell count reached 1×10⁻⁶. 5 Cells were infected with WT virus and DDN-NS mutant virus (MOI=1) per well, and Shield-1 supplementation was set in each group. + 500nM) and no addition (S - The conditions were met, and viral titers were measured at two time points: 24h and 48h. The results are shown in […]. Figure 7 .
[0053] The results showed that, in the absence of Shield-1, the viral titer of DDN-NS in A549 cells was significantly reduced compared to WT virus. This result is consistent with observations in other cell lines, further confirming the reliability and safety of DDN-NS as a conditionally attenuated vaccine candidate. This mutant will remain highly attenuated in the in vivo environment lacking Shield-1, laying the foundation for subsequent vaccine immunogenicity evaluation.
[0054] Shield-1-dependent expression of DDN-NS in chicken embryos The inventors of this application have demonstrated the conditional replication characteristics of recombinant viruses based on the DD system using cell models. To further verify the controllability of this system in a more complex physiological environment, in this embodiment, a virus carrying the DD mutation (DDN-NS) was diluted 100-fold and inoculated into chicken embryos, and then treated with Shield-1 small molecules at concentrations of 0 nM, 500 nM, and 1000 nM, respectively. After 72 h of culture, the progeny virus titer was determined by plaque assay, and the results are shown below. Figure 8 .
[0055] The results showed that viral replication capacity exhibited a significant Shield-1 dose-dependent effect: the viral titers in the 1000 nM and 500 nM treatment groups were significantly higher than those in the untreated control group. This result confirmed at the in vivo level in chicken embryos that DDN-NS virus replication can be effectively rescued by its specific ligand Shield-1, and that a concentration gradient effect exists, thus successfully extending the verification of conditional replication from the cellular level to the whole embryo model.
[0056] As can be seen, this invention successfully constructed a conditionally replicating influenza A virus that can be precisely regulated in vivo by the small molecule Shield-1, and systematically verified its viral titer, genome correctness, typical viral morphology, and strictly dose-dependent replication characteristics, laying a solid foundation for its development into a novel vaccine platform.
[0057] The conditionally replicating virus DDN-NS is regulated by Shield-1 and is attenuated in mice. PR8 wild-type virus was selected as a positive control, PBS as a negative control, and DDN-NS infection was used as the experimental group. Based on the literature, WT set up five different doses to infect mice: 1 TCID50, 10 TICD50, 10 2 TCID50, 10 3 TCID50, 10 4 TCID50. DDN-NS was also administered at five different doses to infect mice: 10 TCID50, ... 2 TCID50, 10 3 TCID50, 10 4 TCID50, 10 5 TCID50 was administered, with 5 mice per group. After anesthetizing the mice, 50 μL of the above-mentioned dose was instilled into one nostril of each mouse, ensuring that it was inhaled and not expelled from the mouth. For 14 days after infection, the weight and mortality of the mice were recorded daily. The weight and mortality data over 14 days were summarized to plot the weight curves and survival rates for WT and DDN-NS mice. Results are shown below. Figure 9 .
[0058] The results showed that when the challenge dose was 10 3At TCID50, it caused 100% (5 / 5) mortality in mice; when the dose was diluted to 10... 4 At TCID50, no mice died (0 / 5). Based on this, it can be inferred that the LD50 of this WT strain is between 10. 3 Up to 10 4 Between TCID50 and TCID50. The DDN-NS strain, when challenged at a dose of 10... 5 At TCID50, it can cause death in 60% (3 / 5) of mice. Based on this, it can be inferred that the LD50 of this DDN-NS strain is 10. 4.8 TCID50.
[0059] It is evident that, under the condition of infection with the same dose of virus, the DDN-NS strain exhibited significantly weakened pathogenicity in mouse models, providing important in vivo experimental evidence for its safety as a potential attenuated strain.
[0060] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An expression cassette for the preparation of an attenuated influenza vaccine, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
1.
2. A recombinant plasmid for preparing an attenuated influenza vaccine, characterized by comprising a nucleic acid sequence of SEQ ID NO:
1. It includes a base plasmid and an expression cassette cloned onto the base plasmid; the expression cassette is the expression cassette as described in claim 1.
3. The recombinant plasmid according to claim 2, characterized in that, The base plasmid includes the pHW2000 plasmid.
4. The recombinant plasmid according to claim 3, characterized in that, The expression cassette is located between two BsmBI restriction sites on the pHW2000 plasmid.
5. A plasmid genome for preparing an attenuated influenza vaccine, characterized in that, It includes plasmids 1-7 and the recombinant plasmids according to any one of claims 2-4; wherein plasmids 1-7 are recombinant plasmids expressing the HA, NA, PA, PB1, PB2, NP and M proteins of H1N1 virus, respectively.
6. The plasmid array according to claim 5, characterized in that, The accession numbers of the genes encoding the HA, NA, PA, PB1, PB2, NP, and M proteins in the NCBI database are as follows: PB2: AB671295.1, PB1: MZ310487.1, PA: MZ310488.1, HA: AB671289.1, NA: MZ310491.1, NP: CY047401.1, M: OM488265.
1.
7. An attenuated influenza virus, characterized in that, It is obtained by viral packaging of the plasmid group as described in claim 5 or 6.
8. The attenuated influenza virus according to claim 7, characterized in that, The transfected cells used for viral packaging include 293T cells.
9. The use of the expression cassette of claim 1, the recombinant plasmid of any one of claims 2-4, the plasmid set of claim 5 or 6, or the attenuated influenza virus of claim 7 or 8 in the preparation of an influenza vaccine.
10. An influenza vaccine, characterized in that, It is prepared from the attenuated influenza virus as described in claim 7 or 8.