An application method of using CDH6 gene as a molecular marker of superovulation trait of cattle

CN122235281APending Publication Date: 2026-06-19ANIMAL HUSBANDRY RES INST OF XINJIANG ACAD OF ANIMAL HUSBANDRY SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ANIMAL HUSBANDRY RES INST OF XINJIANG ACAD OF ANIMAL HUSBANDRY SCI
Filing Date
2026-04-09
Publication Date
2026-06-19

Smart Images

  • Figure CN122235281A_ABST
    Figure CN122235281A_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology and discloses a method for using the CDH6 gene as a molecular marker for the superovulation trait in cattle. The method includes extracting bovine genomic DNA template from a blood sample of a target cattle individual; amplifying the PCR product using forward primer CDH6-fwd and reverse primer CDH6-rev; detecting the single nucleotide polymorphism (SNP) caused by the A-to-C base mutation at position 192 of the PCR product's DNA sequence to obtain the target genotype; performing association analysis between the target genotype and the bovine superovulation trait; and selecting the target cattle individual when the target genotype is CC. This invention, by amplifying the PCR product and detecting its SNP, and selecting the target cattle individual when the target genotype is CC, achieves the effect of early prediction and screening of individuals with the desired superovulation trait, providing a stable molecular marker and ensuring the reliability of polymorphism detection and individual acquisition.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a method for using the CDH6 gene as a molecular marker for bovine superovulation traits. Background Technology

[0002] Superovulation and embryo transfer techniques play a crucial role in cattle breeding and production in livestock farming. Genetic basis is one of the factors determining animal traits, and the regulatory role of single nucleotide polymorphisms (SNPs) on livestock reproductive performance and superovulation effects is receiving increasing attention. CDH6, an important member of the cadherin family, is a highly conserved transmembrane glycoprotein that mediates cell adhesion, maintaining epithelial cell polarity and stabilizing tissue integrity. In reproductive biology, CDH6 exhibits corresponding biological functions in regulating endometrial receptivity and embryo implantation. Its expression status in the apical membrane domain of endometrial epithelial cells affects epithelial structural integrity and embryo attachment stability, thus influencing individual reproductive efficiency.

[0003] Currently, the evaluation of superovulation in cattle mainly relies on phenotypic data such as the total number of embryos per head and the number of usable embryos per head. This traditional evaluation system is a post-hoc test, resulting in a long selection cycle and limited efficiency, making it difficult to predict and screen in the early stages of cattle breeding. Although the development of genetic engineering technology has promoted the application of molecular marker-assisted breeding, research on the association between CDH6 gene polymorphism and the superovulation trait in cattle is still incomplete. In actual breeding production, the lack of stable auxiliary molecular markers based on this makes it impossible to objectively assess the superovulation potential of individual cattle through molecular-level genotypic characteristics in the early stages.

[0004] At the implementation level of molecular detection technology, existing detection methods for such polymorphisms have shortcomings in system construction and judgment criteria. On the one hand, the lack of specific primers optimized for the target fragment of the bovine CDH6 gene and matching polymerase chain reaction parameters limits the stability of amplification products, thus affecting the accuracy of subsequent sequencing. On the other hand, during polymorphism analysis, the lack of objective benchmarks for standardized classification of base mutations by combining agarose gel electrophoresis quality control and sequencing results results makes it difficult to define the target genotype uniformly, reducing the reliability of obtaining individuals with the desired reproductive performance. Therefore, developing an auxiliary detection and evaluation method that can accurately predict and screen bovine individuals for superovulation performance based on gene polymorphism at an early stage is a problem that needs to be solved in this field. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for using the CDH6 gene as a molecular marker for superovulation traits in cattle. This method solves the problems of difficulty in predicting the superovulation effect in the early stages of cattle breeding, lack of stable auxiliary breeding molecular markers, and lack of objective definition methods for determining polymorphic target genotypes.

[0006] To address the above problems, the present invention provides the following technical solution:

[0007] This invention provides a method for using the CDH6 gene as a molecular marker for bovine superovulation, comprising the following steps:

[0008] Bovine genomic DNA was extracted from blood samples of the cattle to be tested, and a bovine genomic DNA template was obtained.

[0009] Using the forward primer CDH6-fwd and the reverse primer CDH6-rev, PCR amplification was performed on the bovine genomic DNA template to obtain a 432bp PCR product with the sequence SEQ ID NO:1.

[0010] The PCR product was sequenced, and the single nucleotide polymorphism caused by the base mutation from A to C at position 192 of the DNA sequence of the PCR product was detected to obtain the target genotype.

[0011] Association analysis was performed between the target genotype and the bovine superovulation trait. When the target genotype was CC, the bovine individuals with the CC genotype were selected to obtain the target individuals.

[0012] The PCR amplification includes sequential pre-denaturation, cyclic denaturation, annealing and extension, and final extension; the sequence of the forward primer CDH6-fwd is SEQ ID NO:2, and the sequence of the reverse primer CDH6-rev is SEQ ID NO:3.

[0013] By adopting the above technical solution, the PCR product is obtained by extracting DNA from the blood sample of the individual cattle to be tested and amplifying it. Then, the single nucleotide polymorphism at position 192 of the DNA sequence of the PCR product is identified, and the specific target genotype is used as the breeding selection criterion. Therefore, the effect of predicting and screening individuals with the desired superovulation performance at an early stage is achieved.

[0014] The specific mechanism lies in the fact that the transmembrane glycoprotein encoded by the CDH6 gene plays a major role in maintaining epithelial cell polarity and stable tissue integrity. The regulation of bovine endometrial receptivity and embryo implantation depends on the expression of this protein. A mutation from A to C bases at position 192 of the PCR product's DNA sequence alters the encoded product, resulting in individuals possessing the CC genotype acquiring a more suitable CDH6 expression pattern or a more stable protein spatial conformation in the apical membrane domain of endometrial epithelial cells. This molecular-level conformational optimization enhances the integrity of the epithelial structure and improves the microenvironmental stability during embryo attachment. Therefore, phenotypically, cows possessing the CC genotype are able to implant and survive significantly more usable embryos after superovulation, with significantly higher average usable embryos per head and higher average total embryos per head compared to individuals with other genotypes. This invention, by detecting the polymorphism at position 192 of the DNA sequence and selecting target individuals possessing the CC genotype, can improve herd reproductive productivity and provide an auxiliary breeding method for bovine embryo production and breed expansion.

[0015] Preferably, before performing the PCR amplification using the bovine genomic DNA template, the forward primer CDH6-fwd and the reverse primer CDH6-rev are designed and synthesized targeting a partial DNA sequence of the bovine CDH6 gene.

[0016] By adopting the above technical solution, the forward primer CDH6-fwd and the reverse primer CDH6-rev, designed for the sequences at both ends of a specific target fragment, achieve the effect of specifically matching the target sequence, avoid interference from non-target sequences, and ensure the purity of the PCR product obtained subsequently.

[0017] Preferably, the forward primer CDH6-fwd and the reverse primer CDH6-rev are prepared separately, and the concentrations of the forward primer CDH6-fwd and the reverse primer CDH6-rev are both controlled to be 10 pmol / μL.

[0018] By adopting the above technical solution, and by controlling the primer concentration at 10 pmol / μL, a suitable primer binding kinetic effect is obtained. This not only provides the required primer molecules to drive the amplification of the target sequence, but also avoids the problems of primer dimer formation or amplification of non-target sequences caused by improper primer concentration.

[0019] Preferably, when performing the PCR amplification using the bovine genomic DNA template, 10.0 μL of 2×TaqPCR Mix, 0.5 μL of the forward primer CDH6-fwd, 0.5 μL of the reverse primer CDH6-rev, 0.5 μL of the bovine genomic DNA template, and 8.5 μL of ddH2O are mixed for the PCR amplification; wherein the 0.5 μL of the bovine genomic DNA template contains 10 ng to 50 ng of the bovine genomic DNA.

[0020] By employing the above technical solution, and by using a reaction system with a specific volume ratio and limiting the content of the bovine genomic DNA template to 10 ng to 50 ng, a suitable microenvironment for the enzymatic reaction is obtained. The aforementioned content of bovine genomic DNA template ensures the presence of the required starting target sequence while avoiding interference from extraneous proteins or nucleic acids with polymerase activity, thus guaranteeing the stable amplification of the PCR product.

[0021] Preferably, during the pre-denaturation process, the temperature is controlled at 94°C and the time is 1 minute.

[0022] By adopting the above technical solution, and by using a pre-denaturation condition of 94℃ for 1 min, the bovine genomic DNA template was destranded into a single strand, thus providing a structural basis for the subsequent denaturation cycle and primer annealing.

[0023] Preferably, during the denaturation process, the temperature is controlled at 94°C and the time is 45 seconds; during the annealing process, the temperature is controlled at 60°C and the time is 45 seconds; during the extension process, the temperature is controlled at 72°C and the time is 45 seconds; the denaturation, annealing, and extension processes are performed for a total of 35 cycles.

[0024] By adopting the above technical solution, and using 35 thermal cycles with specific parameters, especially an annealing temperature of 60°C that matches the forward primer CDH6-fwd and the reverse primer CDH6-rev, the directional enrichment of the PCR product is achieved, so that the concentration of the final PCR product meets the requirements of subsequent agarose gel electrophoresis and sequencing.

[0025] Preferably, during the final extension, the temperature is controlled at 72°C and the time is 5 minutes.

[0026] By adopting the above technical solution, and by maintaining the final extension at 72℃ for 5 minutes, the single-stranded product that was not fully synthesized in the cycle was extended into a double-stranded molecule, thereby improving the integrity of the obtained PCR product.

[0027] Preferably, after obtaining the PCR product, the PCR product is subjected to 1.5% agarose gel electrophoresis to confirm that the PCR product has an electrophoretic band at the 432bp position.

[0028] By adopting the above technical solution and verifying it with 1.5% agarose gel electrophoresis, the molecular weight and uniformity of the PCR products can be controlled, the interference of primer dimers and non-target amplification bands can be eliminated, and the quality of samples used for sequencing can be ensured.

[0029] Preferably, when the target genotype is obtained, the target genotype is determined to be AA, AC or CC.

[0030] By adopting the above technical solution, and by using a clear genotyping standard, the population polymorphism can be standardized and classified, thus providing a data foundation for subsequent correlation analysis between the detected single nucleotide polymorphism data and the bovine superovulation trait.

[0031] Preferably, if a homozygous A base is detected at position 192 of the DNA sequence of the PCR product, the target genotype is determined to be the AA type; if a heterozygous A and C base is detected at position 192 of the DNA sequence of the PCR product, the target genotype is determined to be the AC type; if a homozygous C base is detected at position 192 of the DNA sequence of the PCR product, the target genotype is determined to be the CC type.

[0032] By adopting the above technical solution, and by defining the mutation from A base to C base at position 192 of the DNA sequence, the polymorphism identification results are objective and reproducible, thus ensuring the stability of selecting individuals with the CC type.

[0033] This invention provides a method for using the CDH6 gene as a molecular marker for bovine superovulation. It offers the following advantages:

[0034] 1. This invention obtains a bovine genomic DNA template by extracting bovine genomic DNA from blood samples of individual cattle to be tested. PCR amplification is then performed using the bovine genomic DNA template to obtain PCR products. The single nucleotide polymorphism (SNP) caused by a base mutation from A to C in the DNA sequence of the PCR products is then detected. The obtained target genotype is then correlated with the bovine superovulation trait. When the target genotype is CC, bovine individuals with the CC genotype are selected. This invention achieves the effect of early prediction and screening of individuals with the desired bovine superovulation trait, providing a stable molecular marker for the bovine superovulation trait.

[0035] 2. This invention designs and synthesizes forward primer CDH6-fwd and reverse primer CDH6-rev targeting a partial DNA sequence of the bovine CDH6 gene. The concentrations of forward primer CDH6-fwd and reverse primer CDH6-rev are prepared and controlled respectively. Combined with bovine genomic DNA template, pre-denaturation is performed sequentially, followed by cyclic denaturation, annealing, extension, and final extension PCR amplification. This achieves stable amplification of PCR products, ensuring the accuracy of subsequent sequencing and single nucleotide polymorphism detection.

[0036] 3. This invention confirms the presence of electrophoretic bands in PCR products by performing agarose gel electrophoresis. When the DNA sequence of the PCR product is detected by sequencing as a homozygous A base, a heterozygous A and C base, or a homozygous C base, the target genotype is determined as AA, AC, or CC, respectively. This achieves the effect of objectively defining single nucleotide polymorphisms and standardizing the classification of target genotypes, ensuring the reliability of the final target individuals. Attached Figure Description

[0037] Figure 1 The image shows the results of 1.5% agarose gel electrophoresis of the CDH6 gene amplification product in one embodiment of the present invention.

[0038] Figure 2 This is a sequencing peak diagram of PCR products from three genotype individuals in one embodiment of the present invention;

[0039] Figure 3 The image shows the results of 1.5% agarose gel electrophoresis of the CDH6 gene amplification product in the test example of this invention.

[0040] Figure 4 The images show the sequencing peaks of PCR products from three genotypes in the test examples of this invention. Detailed Implementation

[0041] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Example 1:

[0043] This embodiment provides a method for using the CDH6 gene as a molecular marker for bovine superovulation, including the following steps:

[0044] S1. Design and synthesize a pair of specific primers for cloning a partial DNA sequence of the bovine CDH6 gene, wherein the sequence of the forward primer CDH6-fwd is shown in SEQ ID NO:2 and the sequence of the reverse primer CDH6-rev is shown in SEQ ID NO:3.

[0045] S2. Collect blood samples from the individual cattle to be tested and extract bovine genomic DNA from the blood samples;

[0046] S3. Using the extracted bovine genomic DNA as a template, PCR amplification was performed using forward and reverse primers. The specific PCR reaction system included 10.0 μL of 2×Taq PCR Mix, 0.5 μL of forward primer at a concentration of 10 pmol / μL, 0.5 μL of reverse primer at a concentration of 10 pmol / μL, 0.5 μL of genomic DNA containing 10 to 50 ng of DNA, and 8.5 μL of ddH2O.

[0047] S4. The PCR reaction conditions were controlled as follows: pre-denaturation at 94℃ for 1 min, followed by 35 cycles. Each cycle consisted of denaturation at 94℃ for 45 s, annealing at 60℃ for 45 s, and extension at 72℃ for 45 s, with a final extension at 72℃ for 5 min, resulting in a specific amplified fragment of 432 bp, the sequence of which is shown in SEQ ID NO:1. Figure 1 The results of 1.5% agarose gel electrophoresis of the CDH6 gene amplification products are shown. Lane M is the DL2000 standard molecular weight marker, and lanes 1 to 4 are four randomly detected PCR products, all of which have obvious and specific bands at the 432bp position.

[0048] S5. Sequencing of the PCR product fragments, based on the single nucleotide polymorphism resulting from the A-to-C base mutation at position 192 of the DNA sequence, combined with... Figure 2 The sequencing peak diagrams of the PCR products of the three genotype individuals clearly identify the specific genotype: the positions indicated by the arrows in the diagram are mutation sites. When the 192nd site is homozygous for A bases, it is determined to be an AA type individual; when the site is heterozygous for A and C bases, it is determined to be an AC type individual; and when the site is homozygous for C bases, it is determined to be a CC type individual.

[0049] S6. The different genotypes detected were correlated with the superovulation trait in cattle, and individuals with the CC genotype were selected to obtain better superovulation results.

[0050] Test Example 1:

[0051] Experimental description:

[0052] This test case verifies the association between the specific single nucleotide polymorphism site identified in Example 1 and the superovulation trait in cattle. By statistically analyzing the detected different genotypes and the actual superovulation phenotype data, the effectiveness and feasibility of the CDH6 gene mutation site as a molecular marker for auxiliary selection of bovine reproductive performance are determined.

[0053] Experimental steps:

[0054] Fifty-three bovine individuals were selected as the subjects of the study. Based on the superovulation records of these 53 individuals, two evaluation indicators were obtained: the number of usable embryos per head and the total number of embryos per head.

[0055] The amplification and sequencing methods described in Example 1 were used to identify the genotypes of bovine genomic DNA from all 53 experimental subjects. The amplification products were detected by 1.5% agarose gel electrophoresis. After confirming the target fragment, the specific amplification products were recovered and sequenced. Based on the mutation status of A to C bases at position 192 of the DNA sequence, the specific genotype of each experimental individual was clearly defined.

[0056] Genotyping results and corresponding superovulation phenotype data of all individuals were collected. SPSS software was used to establish a statistical analysis model for phenotypic association analysis, with the statistical analysis model set as Yp. ij =μ+G i +e j , where Y ij G represents the phenotypic value of the observed individual's productive performance, μ represents the least squares mean of productive performance, and G represents the phenotypic value of the observed individual's productive performance. i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.

[0057] Experimental data:

[0058] Table 1. Results of analysis on significant differences in superovulation traits among individuals with different genotypes

[0059] Superovulation traits AA type individuals AC type individuals CC type individuals Number of usable embryos per head <![CDATA[2.26±0.41 a ]]> <![CDATA[5.94±0.79 b ]]> <![CDATA[9.31±0.98 c ]]> Total number of embryos per head <![CDATA[5.16±0.62 a ]]> <![CDATA[11.33±0.76 b ]]> <![CDATA[17.63±0.56 c ]]>

[0060] Note: Different letters on the shoulder labels of different groups of data indicate significant differences, with a p-value < 0.05.

[0061] Experimental conclusion:

[0062] like Figure 3 The agarose gel electrophoresis results show that lane M is the DL2000 standard molecular weight marker, and lanes 1 to 5 contain five randomly detected PCR products. All five products exhibit a clear and specific band at the 432 bp position, indicating that this method can accurately amplify the target fragment in population detection. Figure 4As shown in the sequencing peak diagram, the arrows indicate the mutation sites. AA-type individuals show a single A base peak at this site, AC-type individuals show a double peak of A and C bases at this site, and CC-type individuals show a single C base peak at this site. This indicates that the applied method can accurately identify the single nucleotide polymorphism at site 192 in the CDH6 gene fragment and clearly distinguish AA-type, AC-type, and CC-type individuals in the population.

[0063] The statistical data in Table 1 show that different genotypes at this locus have a significant regulatory effect on the superovulation trait in cattle. CC-type individuals achieved 9.31 and 17.63 per head in terms of both usable embryos and total embryos per head, respectively, significantly better than AC-type individuals (5.94 and 11.33), and higher than AA-type individuals (2.26 and 5.16). These data confirm that the presence of the C allele has a positive promoting effect on superovulation in cattle, with the best effect observed in the homozygous state.

[0064] The transmembrane glycoprotein encoded by the CDH6 gene plays a central role in maintaining epithelial cell polarity and stabilizing tissue integrity. In the bovine reproductive cycle, the regulation of endometrial receptivity and embryo implantation depend on the expression of this protein. Following a base mutation from A to C at position 192 of the DNA sequence, individuals with the CC genotype exhibit a superior CDH6 expression pattern or a more stable protein spatial conformation in the apical membrane domain of endometrial epithelial cells. This enhances the integrity of the epithelial structure, improves the microenvironmental stability during embryo attachment, and enables CC-type cows to implant and produce more viable embryos after superovulation.

[0065] Therefore, using mutations at position 192 (A to C) of the CDH6 gene as molecular markers has application and transformation value in breeding production. When selecting superovulatory donor cattle, detecting and prioritizing individuals with the CC genotype while avoiding AA individuals can accurately predict and improve the reproductive output efficiency of the herd, providing a marker-assisted breeding method for in vivo embryo production and accelerated propagation of superior breeds.

[0066] Appendix: CDH6 gene nucleotide sequence:

[0067] SEQ ID NO:1:

[0068] TCCCTGAATGTAACGTGCTGGTGTGGAGCCTGAAAATGCAGCAGCTATTTTGTGATCTTGGCAATGCCAGTCCGAGGGCAAAGCTGAATAGGACAAAATTACAGAGAAATAGCTAGAATCCAAATCAAACTATGTTCAAAGTCCACTTTGCTTTTAGACTTAATGTGACCAATAAACACTTTCATTGTTTACAGTAATTTGAACTGGGTTTTCTGTTACTTATAAATAAAAGCATCTAGGTGATAAATCTATCTGATAGAATATAAGATGTTGAATGACCTTCTCTTGAACCTTAAGAGAAGTAGTTTTGGATTAAGTAAAGAATTAATTGGAATAGTGGAGAATACACATCCTGAATTTATAATCCCCAAAGATGATTACAATTAAATGTACAAATTAAGCTATGTTGTTTCAGATTGGCATTCTTATTGT。

[0069] Forward primer CDH6-fwd nucleotide sequence:

[0070] SEQ ID NO:2:

[0071] TCCCTGAATGTAACGTGC。

[0072] Reverse primer CDH6-rev nucleotide sequence:

[0073] SEQ ID NO:3:

[0074] ACAATAAGAATGCCAATCTGA。

Claims

1. A method for using the CDH6 gene as a molecular marker for bovine superovulation, characterized in that, Includes the following steps: Bovine genomic DNA was extracted from blood samples of the cattle to be tested, and a bovine genomic DNA template was obtained. Using the forward primer CDH6-fwd and the reverse primer CDH6-rev, PCR amplification was performed on the bovine genomic DNA template to obtain a 432bp PCR product with the sequence shown in SEQ ID NO:

1. The PCR product was sequenced, and the single nucleotide polymorphism caused by the base mutation from A to C at position 192 of the DNA sequence of the PCR product was detected to obtain the target genotype. Association analysis was performed between the target genotype and the bovine superovulation trait. When the target genotype was CC, the bovine individuals with the CC genotype were selected to obtain the target individuals. The PCR amplification includes sequential pre-denaturation, cyclic denaturation, annealing and extension, and final extension; the sequence of the forward primer CDH6-fwd is shown in SEQ ID NO:2, and the sequence of the reverse primer CDH6-rev is shown in SEQ ID NO:

3.

2. The application method according to claim 1, characterized in that, Before performing the PCR amplification using the bovine genomic DNA template, the forward primer CDH6-fwd and the reverse primer CDH6-rev were designed and synthesized targeting a partial DNA sequence of the bovine CDH6 gene.

3. The application method according to claim 2, characterized in that, The forward primer CDH6-fwd and the reverse primer CDH6-rev were prepared separately, and the concentrations of both the forward primer CDH6-fwd and the reverse primer CDH6-rev were controlled to be 10 pmol / μL.

4. The application method according to claim 3, characterized in that, When performing the PCR amplification using the bovine genomic DNA template, 10.0 μL of 2×Taq PCR Mix, 0.5 μL of the forward primer CDH6-fwd, 0.5 μL of the reverse primer CDH6-rev, 0.5 μL of the bovine genomic DNA template, and 8.5 μL of ddH2O are mixed for the PCR amplification. The 0.5 μL of bovine genomic DNA template contains 10 ng to 50 ng of bovine genomic DNA.

5. The application method according to claim 1, characterized in that, During the pre-denaturation process, the temperature was controlled at 94°C and the time was 1 minute.

6. The application method according to claim 5, characterized in that, During the denaturation process, the temperature was controlled at 94°C and the time was 45 seconds. During the annealing process, the temperature is controlled at 60°C and the time is 45 seconds. During the extension process, the temperature is controlled at 72°C and the time is 45 seconds. The modification, annealing, and extension are controlled for a total of 35 cycles.

7. The application method according to claim 6, characterized in that, During the final extension, the temperature is controlled at 72°C and the time is 5 minutes.

8. The application method according to claim 1, characterized in that, After obtaining the PCR product, the PCR product was detected by 1.5% agarose gel electrophoresis, which confirmed that the PCR product had an electrophoretic band at the 432bp position.

9. The application method according to claim 1, characterized in that, Upon obtaining the target genotype, the target genotype is determined to be AA, AC, or CC.

10. The application method according to claim 9, characterized in that, If a homozygous PCR product is detected with an A base at position 192 in its DNA sequence, then the target genotype is determined to be the AA type. If the DNA sequence of the PCR product is detected to be a hybrid of A and C bases at position 192, then the target genotype is determined to be the AC type. If a homozygous C base is detected at position 192 of the DNA sequence of the PCR product, the target genotype is determined to be the CC type.