All-in-one PCR reagent kit and its taq DNA polymerase variant
By replacing the 5'–3' exonuclease domain of Taq DNA polymerase with endonuclease 1 from Thermococcus barophilus Ch5 and performing amino acid mutations, a Taq DNA polymerase variant, Tb-Taq, was developed. This solved the problem of probe cleavage and degradation in fully premixed PCR kits, improved detection sensitivity and resistance to inhibition, and ensured the stability and detection effect of the kit.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING BAILIGE BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-05-22
- Publication Date
- 2026-08-04
AI Technical Summary
During long-term storage, existing fully premixed PCR kits suffer from a lack of selectivity in the 5'→3' exonuclease domain of Taq DNA polymerase, leading to probe cleavage or degradation. This results in increased fluorescence background, decreased fluorescence intensity in the amplification curve, delayed Ct values, and reduced detection sensitivity.
The 5'–3' exonuclease domain of Taq DNA polymerase was replaced by the endonuclease 1 domain of Thermococcus barophilus Ch5, and a mutation was made at a specific amino acid site to form the Taq DNA polymerase variant Tb-Taq, which endows it with selective 5'→3' exonuclease activity, avoiding the cleavage of blunt-terminated dsDNA, while maintaining the ability to recognize and hydrolyze single-stranded pendulous structures.
The Taq DNA polymerase variant Tb-Taq maintains its ability to hydrolyze TaqMan probes during PCR amplification, solving the problem of probe cleavage and degradation, improving detection sensitivity and resistance to inhibition, and ensuring the stability and detection effect of the fully premixed kit during long-term storage.
Smart Images

Figure CN122235282B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and more specifically, relates to a fully premixed PCR kit and its Taq DNA polymerase variant. Background Technology
[0002] Polymerase chain reaction (PCR), a revolutionary technology in molecular biology, relies on temperature cycling to achieve exponential amplification of DNA fragments. Its core advantages lie in its high sensitivity, strong specificity, and rapid detection capabilities. This technology has been widely applied in key areas such as pathogen detection, genetic disease diagnosis, and forensic identification, becoming a core tool in modern biomedical research.
[0003] Traditional testing procedures require operators to thaw, mix, dispense, and dilute multiple reagents such as primers, probes, enzymes, and buffers one by one, a process that is cumbersome and time-consuming. In contrast, the fully premixed system premixes the reaction components into a "one-tube" reagent, typically requiring only the addition of template DNA / RNA for direct sample addition and amplification, thus significantly shortening sample preparation time and reducing the risk of operational errors. This system adapts to high-throughput demands, increasing detection throughput, while simultaneously optimizing overall costs by reducing manpower training, reagent waste, and quality control costs, thereby enhancing product competitiveness and user-friendliness. Ultimately, the fully premixed system reshapes molecular detection processes with its comprehensive advantages of "accuracy, efficiency, safety, and economy," providing core support for the standardization and intelligent upgrading of the in vitro diagnostics (IVD) industry.
[0004] However, current fully premixed systems still face significant limitations in terms of uniformity, stability, and long-term storage. Especially during long-term storage at 4°C or room temperature, primers and probes are prone to interaction, leading to probe cleavage or degradation. This results in increased fluorescence background, decreased fluorescence intensity in the amplification curve, delayed Ct values, and a significant decrease in detection sensitivity. The root cause is that Taq DNA polymerase, the core component of the fully premixed system, lacks selectivity in its 5'→3' exonuclease domain. This domain indiscriminately degrades probes that form double-stranded DNA (dsDNA) at the 5' end, directly causing probe cleavage or degradation in fully premixed systems.
[0005] Therefore, there is an urgent need to develop a Taq DNA polymerase with a selective 5'→3' exonuclease domain and strong polymerization activity to meet the growing demand for fully premixed systems. Summary of the Invention
[0006] Taq DNA polymerase is a thermostable DNA polymerase isolated from thermophilic aquatic bacteria. Its main structure consists of three functional domains: from the N-terminus to the C-terminus, a 5'–3' exonuclease domain, a 3'–5' exonuclease domain, and a 5'–3' polymerase domain. The 5'–3' exonuclease domain, located in the amino acid range from 1 to 291, recognizes blunt-end structures (the ends of double-stranded DNA molecules where the 5' and 3' ends of the two strands are perfectly aligned, forming complete complementary base pairs without any single-strand protrusions) and single-strand dangling structures (where a single-stranded nucleotide fragment, not paired with its complementary strand, appears as a "hanging" or "protruding" fragment in a specific region of the double-stranded DNA molecule, resembling a flag or petal) and removes the nucleotide fragment from the 5' end of the nucleic acid strand. The lack of substrate selectivity in this exonuclease domain limits the application of Taq DNA polymerase in fully premixed systems.
[0007] The main objective of this invention is to overcome the defects and deficiencies of the existing technology and provide a fully premixed PCR kit. The kit includes primers for PCR amplification, PCR amplification buffer, and a Taq DNA polymerase mutant. The Taq DNA polymerase mutant is obtained by replacing the amino acid sequence of the 5'–3' exonuclease domain of wild-type Taq DNA polymerase with SEQ ID NO.2.
[0008] In one embodiment, the kit further includes a TaqMan probe.
[0009] In one embodiment, the amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO.3.
[0010] In one embodiment, the present invention provides a Taq DNA polymerase mutant, which is a Taq DNA polymerase obtained by replacing the amino acid sequence of the 5'–3' exonuclease domain of wild-type Taq DNA polymerase with SEQ ID NO.2.
[0011] In one embodiment, the amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO.3.
[0012] In one embodiment, a polynucleotide encoding the above-described Taq DNA polymerase mutant is provided.
[0013] In one embodiment, the polynucleotide sequence is as shown in SEQ ID NO.4.
[0014] In one embodiment, a recombinant vector comprising the aforementioned polynucleotides is provided.
[0015] In one embodiment, a recombinant cell comprising the above-described polynucleotide or the above-described recombinant vector is provided.
[0016] In one embodiment, the above-described Taq DNA polymerase mutant, and / or the above-described polynucleotide, and / or the above-described recombinant vector, and / or the above-described recombinant cell are provided for use in a reverse transcription reaction.
[0017] In one embodiment, a reverse transcription premix kit is provided, the kit comprising the Taq DNA polymerase mutant described above.
[0018] In this invention, the amino acid sequence of the Taq DNA polymerase variant of this invention is modified compared to the wild-type Taq DNA polymerase as follows: the 5'–3' exonuclease domain of the wild-type Taq DNA polymerase is deleted at positions 1 to 291, and replaced with *Thermophilic cocci*. Thermococcus barophilus Ch5 The endonuclease 1 domain is present in this variant; in addition, this variant has four point mutations: alanine at position 608 is mutated to valine, lysine at position 702 is mutated to arginine, isoleucine at position 707 is mutated to leucine, and lysine at position 762 is mutated to arginine.
[0019] Compared to wild-type Taq DNA polymerase, the one mentioned in this study is fused with thermophilic bacteria. Thermococcus barophilus Ch The Taq DNA polymerase variant with the 5'-endonuclease-1 domain possesses 5'→3' exonuclease activity, and this activity exhibits substrate selectivity: this variant cannot recognize double-stranded DNA with blunt 5' ends, and therefore has no cleavage activity for such double-stranded DNA; however, this variant can still effectively recognize single-stranded overhang structures, so it does not affect its ability to hydrolyze TaqMan probes during PCR amplification.
[0020] The aforementioned thermophilic cocci Thermococcus barophilus Ch5 The endonuclease 1 domain of the modified Taq DNA polymerase is linked to the N-terminus of the modified Taq DNA polymerase via the linker GGGSGGGS.
[0021] In one embodiment, a fully premixed kit is provided, comprising: enzyme-free water, reaction buffer, dNTPs, primers and TaqMan probes designed for a target nucleic acid sequence, and the aforementioned Taq DNA polymerase variant. The target nucleic acid sequence can be either DNA or RNA. The Taq DNA polymerase variant has an enzyme activity of 1.25–2.5 U / μL; the dNTPs have a concentration of 100–300 μM; the primers have a concentration of 0.2–0.4 μM; and the probe has a concentration of 0.3–0.4 μM.
[0022] Compared with existing technologies, the present invention has the following advantages: a. The Taq DNA polymerase variant (Tb-Taq) described in this invention exhibits greater resistance to inhibitors compared to wild-type Taq DNA polymerase; furthermore, by fusing thermophilic bacteria (Tb-Taq) at its N-terminus... Thermococcus barophilus Ch5 The 5'→3' exonuclease activity of the endonuclease 1 domain of Taq DNA polymerase is significantly enhanced compared to wild-type Taq DNA polymerase.
[0023] b. The Taq DNA polymerase variant (Tb-Taq) described in this invention integrates thermophilic cocci ( Thermococcus barophilus Ch5 The Tb-Taq assay incorporates the endonuclease 1 domain, endowing it with selective 5'→3' exonuclease activity. It exhibits no cleavage activity at the 5' end of blunt-ended double-stranded DNA (dsDNA) and does not affect its hydrolytic ability to TaqMan probes during PCR amplification. This effectively solves the problem of probe degradation during long-term storage of the fully premixed kit, thus avoiding phenomena such as increased fluorescence background, decreased fluorescence intensity in the amplification curve, lag in Ct values, and a significant decrease in detection sensitivity.
[0024] c. The Taq DNA polymerase variant (Tb-Taq) of this invention alters the conformation of the polymerase by replacing amino acids at sites A608, K702, I707, and K762 of the wild-type Taq DNA polymerase. Compared with the wild-type Taq DNA polymerase, its detection sensitivity is significantly improved under the same conditions. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 This is a graph showing the solubility analysis results of the Taq DNA polymerase variant of this invention; Figure 2 This is a diagram showing the purification results of the Taq DNA polymerase variant of this invention; Figure 3 The figures show the RT-qPCR amplification curves of the Taq DNA polymerase variant of the present invention under different signal channels; wherein, Figure A is the FAM signal, Figure B is the VIC signal, and Figure C is the ROX signal. Figure 4 The images show a comparison of fluorescence background and amplification curves after 3 days of thermal acceleration for RT-qPCR fully premixed systems prepared with the Taq DNA polymerase variant and wild-type Taq DNA polymerase of this invention; Figure A shows the original amplification curve, and Figure B shows the amplification curve. Figure 5 This is a graph showing the comparison of the anti-inhibition ability of the Taq DNA polymerase variant and wild-type Taq DNA polymerase under different concentrations of guanidine hydrochloride. Figure 6 This is a graph showing the comparison of the sensitivity of the Taq DNA polymerase variant of this invention with that of the wild-type Taq DNA polymerase. Detailed Implementation
[0027] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are merely some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application. Unless otherwise specified, the following embodiments are all conventional methods in the art.
[0028] Example 1: Taq DNA polymerase variant of the present invention The main body of Taq DNA polymerase consists of three functional domains: from the N-terminus to the C-terminus, a 5'–3' exonuclease domain (amino acids 1-291), a 3'–5' exonuclease domain (amino acids 292-423), and a 5'–3' polymerase domain (amino acids 424-832). The amino acid sequence of the wild-type Taq DNA polymerase is shown below.
[0029] .
[0030] This invention uses thermophilic cocci. Thermococcus barophilus Ch5The endonuclease 1 domain was replaced with the 5'–3' exonuclease domain of Taq DNA polymerase to obtain a Taq DNA polymerase variant (Tb-Taq). This variant has 5'→3' exonuclease activity, but this activity is substrate-selective: this variant cannot recognize double-stranded DNA with blunt 5' ends, and therefore has no cleavage activity for such double-stranded DNA; however, this variant can still effectively recognize single-stranded overhang structures, so it does not affect its ability to hydrolyze TaqMan probes during PCR amplification.
[0031] The thermophilic cocci Thermococcus barophilus Ch5 The amino acid sequence of the endonuclease 1 domain is shown below.
[0032] .
[0033] The aforementioned thermophilic cocci Thermococcus barophilus Ch5 The endonuclease 1 domain of the modified Taq DNA polymerase is linked to the N-terminal amino acid sequence of the modified Taq DNA polymerase via the linker GGGSGGGS.
[0034] The amino acid sequence of the Taq DNA polymerase variant described above is modified compared to the wild-type Taq DNA polymerase as follows: the 5'–3' exonuclease domain of the wild-type Taq DNA polymerase is deleted at positions 1 to 291, and replaced with the endonuclease 1 domain of *Thermococcus barophilus* Ch5. To increase the anti-inhibition ability and sensitivity of the Taq DNA polymerase variant of this invention, based on existing research, mutations were made at four sites in the wild-type Taq DNA polymerase: alanine at position 608 was mutated to valine, lysine at position 702 was mutated to arginine, isoleucine at position 707 was mutated to leucine, and lysine at position 762 was mutated to arginine. The resulting Taq DNA polymerase variant, named Tb-Taq, has the following amino acid sequence. This invention regulates the spatial conformation of the polymerase by replacing amino acids at positions A608, K702, I707, and K762 of the wild-type Taq DNA polymerase. Compared to wild-type Taq DNA polymerase, the modified polymerase exhibits higher detection sensitivity and stronger resistance to inhibition under the same reaction conditions.
[0035] .
[0036] The DNA molecule encoding the aforementioned Taq DNA polymerase variant has the nucleotide sequence shown below. This sequence was obtained through codon optimization based on the characteristics of the E. coli expression system, and can significantly improve the expression efficiency of the heterologous gene in the host bacterium.
[0037]
[0038] Example 2: Expression of a Taq DNA polymerase variant (Tb-Taq) Step 1: Transform recombinant plasmid into E. coli BL21(DE3) Take 1 μL of correctly sequenced plasmid and add it to 100 μL of competent E. coli BL21(DE3) cells under ice bath conditions. Incubate on ice for 30 minutes, then heat shock in a 42°C metal bath for 90 seconds, immediately place on ice for 3 minutes, add 700 μL of antibiotic-free LB medium, and incubate at 37°C with shaking at 200 rpm for 60 minutes. Spread 200 μL of the bacterial culture evenly onto LB agar plates containing 100 μg / mL kanamycin and incubate overnight at 37°C.
[0039] Step 2: Expression of the target protein Single clones from step 1 were aseptically inoculated into LB medium containing 100 μg / mL antibiotic and cultured at 37°C with shaking at 200 rpm until the OD 600 was between 0.6 and 0.8. Induction with IPTG (final concentration 0.5 mM) was then performed, followed by overnight culture at 20°C with shaking. A control group without IPTG was used. Samples were then sonicated and analyzed by SDS-PAGE. Results are shown below. Figure 1 .according to Figure 1 At 20℃, it can be expressed in large quantities in the supernatant of LB medium, with the amount of soluble protein accounting for more than 90% of the total amount of target protein.
[0040] Example 3: Purification of Taq DNA polymerase variant (Tb-Taq) 2 L of bacterial culture was cultured in LB medium in shake flasks under the same expression conditions as the target protein in Example 1. The bacterial cells were collected by centrifugation, with a wet weight of approximately 15 g. Approximately 10 g of bacterial cells were weighed and resuspended in 100 ml of Lysis Buffer on ice. The cells were homogenized and centrifuged at 12000 g for 45 minutes at 4°C. The supernatant was filtered through a 0.45 μm vacuum filter to obtain the pretreated sample. The sample was subjected to Ni column affinity chromatography, equilibrated and washed with Buffer A, washed with 5% Buffer B, and eluted with 50% Buffer B. The main elution peak was dialyzed with Dialysis Buffer at a ratio of sample:buffer = 1:50. After three buffer changes, the protein concentration was measured using Nanodrop and stored. The results are as follows: Figure 2 As shown. The target Tb-Taq protein content was calculated after dialysis; the purity was greater than 90%, and the total mass was approximately 100 mg. The concentrations of the solutions used are shown below: Lysis Buffer: 20 mM Tris-HCl, 500 mM NaCl, 5% Glycerol, pH 8.0; Buffer A: 20 mM Tris-HCl, 500 mM NaCl, 25 mM Imidazole, 5% Glycerol, pH 8.0 Buffer B: 20mM Tris-HCl, 500mM NaCl, 500mM Imidazole, 5%Glycerol, pH 8.0 Dialysis Buffer: 20mM Tris-HCl, 100mM KCl, 1mM EDTA, 0.1mM DTT, 50% Glycerol, pH 8.0.
[0041] Example 4: Triple RT-qPCR amplification effect of Taq DNA polymerase variant (Tb-Taq) This embodiment uses a triple RT-qPCR method to test the amplification effect of the Taq DNA polymerase variant (Tb-Taq) of this invention. Triple RT-qPCR includes detection of influenza A (InfA), influenza B (InfB), and endogenous RNase P as an internal standard (IC). The fluorescent reporter group for influenza A is FAM, and the quencher group is BHQ1; the fluorescent reporter group for RNase P is VIC, and the quencher group is BHQ1; the fluorescent reporter group for influenza B is ROX, and the quencher group is BHQ2. The primer and probe sequences are shown in Table 1 below.
[0042] Table 1: Primer and probe sequence information InfA-F GACCRATCCTGTCACCTCTGAC(SEQ ID NO.5) InfA-R AGGGCATTCTGGACAAAKCGTCTA(SEQ ID NO.6) InfA-P FAM-TGCAGTCCTCGCTCACTGGGCACG-BHQ1(SEQ ID NO.7) InfB-F TCCTCAACTCACTCTTCGAGCG(SEQ ID NO.8) InfB-R CGGTGCTCTTGACCAAATTGG(SEQ ID NO.9) InfB-P ROX-CCAATTCGAGCAGCTGAAACTGCGGTG-BHQ2(SEQ ID NO.10) RNase-F GCGGTGTTTGCAGATTTGGA(SEQ ID NO.11) RNase-R TGAATAGCCAAGGTGAGCGG(SEQ ID NO.12) RNase-P VIC-GCTCTGCGCGGACTTGTGGA-BHQ1(SEQ ID NO.13) .
[0043] The RT-qPCR reaction reagents for the preparation examples are shown in Table 2, and the experiments are conducted according to the reaction procedures in Table 3. Table 2: Components and concentrations of RT-qPCR mixture Tb-Taq 0.5 U / μL reverse transcriptase 4 U / μL Thermosensitive UNG enzyme 0.01 U / μL 5×RT-qPCR buffer 2× dNTP Mix 0.25 mM InfA-F 250 nM InfA-R 250 nM InfA-P 125 nM InfB-F 250 nM InfB-R 250 nM InfB-P 125 nM RNase-F 250 nM RNase-R 250 nM RNase-P 125 nM <![CDATA[ddH2O]]> Add 20 μL .
[0044] Table 3: Quantitative RT-qPCR amplification program for the examples
[0045] The quality control samples of fluids A and B were serially diluted to obtain samples with concentrations of 50,000 copies / μL, 5,000 copies / μL, 500 copies / μL, and 50 copies / μL, respectively. These samples were then detected using the Taq DNA polymerase variant (Tb-Taq) of this invention. Each concentration was tested three times. The experimental results are shown below. Figure 3 As shown.
[0046] Table 4: Experimental Ct values of the Taq DNA polymerase variant (Tb-Taq) of this invention .
[0047] Experimental results show that the RT-qPCR kit formulated using the Taq DNA polymerase variant (Tb-Taq) of this invention exhibits a typical "S"-shaped amplification curve. This indicates that after replacing the 5'–3' exonuclease domain of Taq DNA polymerase with the endonuclease 1 domain of *Thermococcus barophilus* Ch5, this variant can still effectively hydrolyze the TaqMan probe during PCR amplification. The detection sensitivity prepared based on this variant can reach 50 copies / μL.
[0048] Example 5: Application and Effect of Taq DNA Polymerase Variant (Tb-Taq) and Wild-type Taq DNA Polymerase in an RT-qPCR Fully Premixed Detection Kit The influenza A detection kits prepared using the Taq DNA polymerase variant (Tb-Taq) of this invention and the influenza A detection kits prepared using wild-type Taq DNA polymerase were stored at 37°C in the dark for 3 days. 10 μL of each kit was aliquoted, and 10 μL of 2000 copies / μL, 200 copies / μL, and 20 copies / μL of quality control samples were added as templates. Amplification and detection were performed using the above detection method (Table 3). The fluorescence background and amplification curves after fully premixed thermal acceleration were compared. Primer and probe information is shown in Table 1, and the components and concentrations of the mixture are shown in Table 5. Table 5: Components and concentrations of the H1N1 RT-qPCR mixture Tb-Taq / Wild-type Taq DNA Polymerase 0.5 U / μL reverse transcriptase 4 U / μL Thermosensitive UNG enzyme 0.01 U / μL 5×RT-qPCR buffer 2× dNTP Mix 0.25 mM InfA-F 250 nM InfA-R 250 nM InfA-P 125 nM <![CDATA[ddH2O]]> Add 20 μL Experimental results are as follows Figure 4As shown, A is the original amplification curve, and B is the amplification curve. The influenza A detection kit prepared using wild-type Taq DNA polymerase showed a significant increase in fluorescence background after being stored at 37°C in the dark for 3 days. This indicates that the FAM fluorescent group at the 5' end of the probe was cleaved during the heat-accelerated storage process, resulting in a low amplification curve and delayed Ct. Conversely, the influenza A detection kit prepared using the Taq DNA polymerase variant (Tb-Taq) of this invention showed no significant change in fluorescence background after being stored at 37°C in the dark for 3 days. This proves that under the same primer and probe reaction system conditions, the FAM fluorescent group at the 5' end of the probe was not cleaved. This indicates that the 5'→3' exonuclease activity of the Taq DNA polymerase variant (Tb-Taq) of this invention is selective, and it has no cleavage activity against dsDNA with blunt 5' ends. Furthermore, the amplification curve exhibits a standard "S" shape, indicating that the Taq DNA polymerase variant (Tb-Taq) of this invention does not affect the hydrolysis of the TaqMan probe during qPCR amplification.
[0049] In summary, the Taq DNA polymerase variant (Tb-Taq) of the present invention effectively solves the problems that occur during long-term storage of fully premixed kits, such as probe cleavage and degradation, leading to increased fluorescence background, decreased fluorescence intensity of amplification curves, Ct value lag, and significant decrease in detection sensitivity.
[0050] Example 6: Anti-inhibition ability test of Taq DNA polymerase variant (Tb-Taq) To verify the anti-inhibition ability of the Taq DNA polymerase variant (Tb-Taq), guanidine hydrochloride, a common component in cell lysate, was selected as an inhibitor. PCR was performed using λDNA as a template and wild-type Taq DNA polymerase as a control. The reaction system is shown in Table 6, the reaction conditions are shown in Table 7, and the primer sequence information is shown in Table 8.
[0051] Guanidine hydrochloride: Purchased from Shanghai Maclean Biochemical Technology Co., Ltd., product number G6166, 99% biotechnology grade, white solid powder, diluted with water to the concentration to be used.
[0052] λDNA: Purchased from New England Biolabs, catalog number N3011, stock solution 500 ng / ul, diluted with water to the working concentration.
[0053] Table 6. Anti-inhibitor detection reaction system 2× reaction buffer 10 μL dNTPs (10 mM) 1 μL Primer-F (10 μM) 0.5 μL Primer-R (10 μM) 0.5 μL Guanidine hydrochloride (0 M 1 M 2 M 4 M 6 M 8 M 10 M 1 2M) 1 μL λdna (1ng / ul) 1 μL Wild-type Taq enzyme / Tb-Taq 0.5 μL <![CDATA[ddH2O]]> Add 20 μL .
[0054] Table 7 Reaction conditions for anti-inhibitor detection .
[0055] Table 8 Primer Sequence Information Primer F1 TGATGTATGAGCAGAGTCAC(SEQ ID NO.14) Primer R1 ATGAGTTGCCCATCGATATG(SEQ ID NO.15) .
[0056] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 5 As shown, the amplification of wild-type Taq DNA polymerase was significantly inhibited with increasing guanidine hydrochloride concentration; however, the Taq DNA polymerase variant (Tb-Taq) could still achieve effective amplification under high guanidine hydrochloride conditions.
[0057] This demonstrates that, compared to wild-type Taq DNA polymerase, the Taq DNA polymerase variant (Tb-Taq) exhibits stronger resistance to inhibitors, higher enzyme activity, and enables direct and rapid PCR amplification.
[0058] Example 7: Sensitivity Test of Taq DNA Polymerase Variant (Tb-Taq) Amplification To verify the sensitivity of the Taq DNA polymerase variant (Tb-Taq), PCR was performed using rat tail lysate as a template and wild-type Taq DNA polymerase as a control. The reaction system is shown in Table 9, and the reaction conditions are shown in Table 10.
[0059] Table 9 Sensitivity Detection Reaction System 2× reaction buffer 10 μL dNTPs (10 mM) 1 μL Primer-F2 (10 μM) 0.5 μL Primer-R2 (10 μM) 0.5 μL Primer-C2 (10 μM) 1 μL Rat tail lysis buffer (2-fold dilution in 8 gradients) 1 μL Wild-type Taq enzyme / Tb-Taq 0.5 μL <![CDATA[ddH2O]]> Add 20 μL .
[0060] Table 10 Sensitivity Detection Reaction Conditions .
[0061] Table 11 Primer Sequence Information Primer F2 ACTCATTAGTGAAATATGTGAGTG(SEQ ID NO.16) Primer R2 CTGCTTAGTTCAATGCCAACC(SEQ ID NO.17) Primer C2 ACACAGAGAAAAGGGTACGTGAA(SEQ ID NO.18) .
[0062] The PCR products were detected by agarose gel electrophoresis, and the results are as follows: Figure 6 As shown, the amplification efficiency of wild-type Taq DNA polymerase gradually decreased with decreasing template concentration in the rat tail lysis buffer, and its amplification ability was significantly inhibited by the lysis buffer; while the Taq DNA polymerase variant (Tb-Taq) could still achieve effective amplification under low template concentration conditions, and was less affected by the inhibition of the lysis buffer.
[0063] This demonstrates that, compared with wild-type Taq DNA polymerase, the Taq DNA polymerase variant (Tb-Taq) exhibits significant advantages in amplifying mouse-derived samples, with higher detection sensitivity and the ability to achieve direct and rapid PCR amplification at low template concentrations.
[0064] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.
[0065] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.
Claims
1. The application of a Taq DNA polymerase mutant in the preparation of a fully premixed PCR kit, characterized in that, The kit includes primers for PCR amplification, PCR amplification buffer, and a Taq DNA polymerase mutant, which is a Taq DNA polymerase obtained by replacing the amino acid sequence of the 5'–3' exonuclease domain of wild-type Taq DNA polymerase with SEQ ID NO.
2. The amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO.
3.
2. The application according to claim 1, characterized in that, The kit also includes TaqMan probes.
3. The application according to claim 1, characterized in that, The polynucleotide encoding the Taq DNA polymerase mutant is shown in SEQ ID NO.4.