A lethal related gene mu srp54k of scirtothrips dorsalis and application thereof in prevention and treatment of scirtothrips dorsalis
By combining the dsRNA of Serratia marcescens HvSm-1 and the lethal gene MuSrp54k of soybean thrips, the problems of drug resistance and environmental threats in the control of soybean thrips by chemical pesticides were solved, achieving a highly efficient biological control effect and significantly improving the mortality rate of soybean thrips.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-12-20
- Publication Date
- 2026-06-23
AI Technical Summary
Existing chemical pesticides pose problems such as resistance, ecological and environmental threats, and difficulty in degradation when controlling soybean thrips, and there is a lack of effective biological control methods.
By utilizing the dsRNA of Serratia marcescens HvSm-1 and the lethal gene MuSrp54k of soybean thrips, and combining it with Serratia marcescens using RNA interference technology, dsMuSrp54k was constructed and used in combination with Serratia marcescens to achieve highly efficient control of soybean thrips.
Within 7 days, the corrected mortality rate of second instar nymphs of the bean thrips reached 88%, and the corrected mortality rate of adults reached 58%, showing a significant synergistic virulence enhancement effect and providing a safe and efficient control method.
Smart Images

Figure CN122255239A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology, and more specifically, to a lethal gene MuSrp54k of the bean thrips and its application in the control of bean thrips. Background Technology
[0002] Bean thrips (Megalurothrips usitatus) belongs to the family Thripidae in the order Thysanoptera and is a significant pest of leguminous vegetables, distributed throughout China. Currently, chemical pesticides are mainly used to control bean thrips; however, the extensive use of chemical pesticides can lead to pesticide resistance in bean thrips; they may also kill beneficial organisms such as natural enemies and pollinators; moreover, some synthetic chemical pesticides are difficult to degrade, posing a serious threat to the ecological environment. Therefore, it is necessary to develop new environmentally friendly methods for controlling bean thrips.
[0003] Serratia marcescens is a Gram-negative facultative anaerobic bacillus without a capsule. It is widely found in water and soil. It is also known as Serratia marcescens because it produces a red pigment called serratiain (or serratiain).
[0004] Serratia marcescens is effective in biological control of pests and pathogens, and it also enhances plant resistance. Scientists at the University of Alban in the United States discovered that Serratia marcescens can improve the resistance of plants such as tobacco and cucumber, and help them resist the invasion of various pathogens. Scientists at the National Institute for Genetic Engineering and Biotechnology in the United States prepared a recombinant bacterial chitinase from Serratia marcescens B4A and used an active enzyme method to determine its biocontrol characteristics against fungal plant pathogens, showing that the recombinant chitinase has high activity in controlling fungal pathogens. In addition, Serratia marcescens has significant pathogenicity against cotton bollworm (Helicoverpa armigera), cabbage caterpillar (Pieris rapae), and beet armyworm (Spodopteraexigua). Fu Renjie et al. isolated a strain of Serratia marcescens from infected and dead black-winged termites (Odontotermesformosanus), and inoculated it onto healthy black-winged termites, causing the healthy termites to turn red and die. Zhang et al. isolated the strain AZW1 of *Serratia marcescens* from the body cavity of collected hazelnut weevil larvae and confirmed its high pathogenicity against adult hazelnut weevils. However, there are currently no reports on the application of *Serratia marcescens* in the control of thrips pests.
[0005] RNA interference (RNAi) refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). By interfering with key genes involved in pest development or important behaviors, RNAi can hinder normal growth, development, and reproduction, and even directly cause pest death, thereby achieving pest control. dsRNA is readily degraded in the environment, offering environmental advantages. Therefore, using dsRNA to control pests is a novel, green, and environmentally friendly method with broad application prospects.
[0006] In eukaryotes, the targeted transport of newly synthesized exoproteins to the endoplasmic reticulum is the initiation and key to their biosynthesis, relying on a conserved class of signal recognition particles (SRPs) and their receptors (SRP receptors, SRs). Studies show that SRPs are complexes composed of ribosomal proteins that recognize signal sequences on nascent polypeptide chains and mediate the binding of ribosomes to the endoplasmic reticulum membrane. Current technology shows that the emergence rate of Plagiodera versicolora larvae fed with dsRNAs targeting the Srp54k gene is significantly lower than that of the control group; feeding Plagiodera versicolora larvae transgenic poplar trees with plastids expressing dsRNAs targeting the Srp54k gene (dsSrp54k) significantly increases mortality; and feeding second-instar Phaedon cochleariae larvae with dsSrp54k results in a 75% mortality rate.
[0007] A growing body of research indicates that RNAi efficiency is low in Thysanoptera insects. For example, in palm thrips, the lethality of dsTpAPN2 and dsTpAPN3 is less than 15%, with no significant difference compared to the control group dsGFP. Even after being loaded with star polycation (SPc) material, the lethality of dsTpAPN2 and dsTpAPN3 in palm thrips is only 23.3% and 30.0%, respectively. Currently, no studies have reported target genes that can cause high lethality in thrips. Summary of the Invention
[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide a lethal gene MuSrp54k of soybean thrips and its application in the control of soybean thrips.
[0009] The first objective of this invention is to provide a gene MuSrp54k associated with lethality in soybean thrips.
[0010] A second objective of this invention is to provide the application of the inhibitor of the aforementioned gene MuSrp54k in the control of soybean thrips or in the preparation of products for the control of soybean thrips.
[0011] The third objective of this invention is to provide a dsRNA for the prevention and control of bean thrips.
[0012] The fourth object of the present invention is to provide a composition for controlling bean thrips.
[0013] The fifth objective of this invention is to provide a *Serratia marcescens* HvSm-1.
[0014] The sixth object of the present invention is to provide the use of the aforementioned Serratia marcescens in the control of soybean thrips or in the preparation of products for the control of soybean thrips.
[0015] The sixth objective of this invention is to provide a method for controlling bean thrips.
[0016] To achieve the above objectives, the present invention is implemented through the following technical solution:
[0017] This invention utilizes a transcriptome library based on soybean thrips and performs homology comparison analysis between the existing insect Srp54k gene and the soybean thrips transcriptome to obtain the MuSrp54k gene of soybean thrips (nucleotide sequence shown in SEQ ID NO: 2). Furthermore, RNAi treatment of soybean thrips via feeding method demonstrates that the MuSrp54k gene is a highly efficient target gene for the control of soybean thrips.
[0018] Therefore, this invention claims protection for a gene MuSrp54k associated with lethality in soybean thrips, the nucleotide sequence of which is shown in SEQ ID NO: 2.
[0019] And the following applications:
[0020] The application of the inhibitor of the gene MuSrp54k in the prevention and control of soybean thrips.
[0021] The application of the MuSrp54k gene inhibitor in the preparation of products for the prevention and control of soybean thrips.
[0022] The present invention also claims protection for a dsRNA for controlling bean thrips, the nucleotide sequence of the positive strand of which is shown in SEQ ID NO: 4.
[0023] The cDNA of *Thrips lentigines* was amplified using the following primers (5'-3'):
[0024] F: GTGCAGATACATTTCGTGCG; R: CACGAGCTTGTGCTTCACAT.
[0025] Preferably, the 5' end and / or 3' end of the dsRNA also have a promoter sequence.
[0026] More preferably, the promoter sequence is a T7 promoter sequence, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO: 3.
[0027] As a specific implementation, the nucleotide sequence of the dsRNA is shown in SEQ ID NO: 6.
[0028] The cDNA of *Thrips lentigines* was amplified using the following primers (5'-3'):
[0029] F: taatacgactcactatagggGTGCAGATACATTTCGTGCG;
[0030] R: taatacgactcactatagggCACGAGCTTTGTGCTTCACAT.
[0031] The present invention also claims a composition for controlling bean thrips, comprising an inhibitor of the aforementioned gene MuSrp54k.
[0032] Preferably, the inhibitor of the MuSrp54k gene is a dsRNA targeting the MuSrp54k gene.
[0033] More preferably, the nucleotide sequence of the positive strand of the dsRNA is shown in SEQ ID NO: 4.
[0034] Preferably, it also contains *Serratia marcescens*, which was deposited on October 24, 2024, at the Guangdong Provincial Center for Microbial Culture Collection with accession number GDMCC No: 65340.
[0035] This invention also claims a strain of Serratia marcescens HvSm-1, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 24, 2024, with accession number GDMCC No: 65340.
[0036] The application of *Serratia marcescens* in the control of soybean thrips or in the preparation of products for the control of soybean thrips is also within the scope of protection of this invention.
[0037] It also claims protection for a method for controlling bean thrips, using an inhibitor of the said gene MuSrp54k, the said composition, or the said Serratia marcescens. Compared with the prior art, the present invention has the following advantages:
[0038] This invention discloses a *Serratia marcescens* strain, HvSm-1, for the control of bean thrips; and a bean thrips lethality-related gene, MuSrp54k, which was used to construct a dsRNA for bean thrips control—dsMuSrp54k. Further analysis using dsMuSrp54k in combination with *Serratia marcescens* in feeding bean thrips showed a corrected mortality rate of approximately 88% for second-instar nymphs and approximately 58% for adults within 7 days. Co-virulence index analysis indicated that the combined treatment of second-instar nymphs and adults with dsMuSrp54k and HvSm-1 produced a synergistic effect in virulence. This invention provides a safe and efficient method for controlling bean thrips, with promising application prospects. Attached Figure Description
[0039] Figure 1 The colony morphology of strain HvSm-1 is shown.
[0040] Figure 2 This is an electrophoresis image of dsMuSrp54k synthesized in vitro using the kit.
[0041] Figure 3 The combined action of dsMuSrp54k and Serratia marcescens HvSm-1 on the mortality rates of second instar nymphs (a) and adult females (b) of soybean thrips; different letters in the figure indicate significant differences between groups (Tukey, P<0.05).
[0042] Figure 4 The effect of dsMuSrp54k feeding on the silencing efficiency of MuSrp54k in second instar nymphs (a) and adult females (b) of the bean thrips was investigated. Different letters in the figure indicate significant differences between groups (Tukey, P<0.05). Detailed Implementation
[0043] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0044] The laboratory population of soybean thrips was collected in Sanya City, Hainan Province in 2018 and subsequently reared at the Engineering Research Center for Biological Control of the Ministry of Education. The rearing medium was cowpea. Both soybean thrips and cowpeas were placed in glass bottles lined with kitchen paper and cultured in an artificial climate chamber (temperature 27±1℃, humidity 60%~70%, photoperiod 12L:12D).
[0045] Sauce dish: Top diameter 37mm, bottom diameter 29mm, height 29mm.
[0046] Example 1: Obtaining and Identifying Serratia marcescens (HvSm-1)
[0047] I. Experimental Methods
[0048] 1. Screening of strains
[0049] Under aseptic conditions, infected ladybugs were picked and placed in 1.5 mL centrifuge tubes. 100 μL of PBS buffer was added, and the mixture was ground for 1 min. After grinding, 500 μL of LB liquid medium was added and cultured at 30°C and 200 rpm for 2 h on a shaker. 100 μL of the culture was then transferred to LB solid medium for plating and incubated at 30°C for 24 h. After incubation, single red colonies from the LB solid medium were picked and streaked onto fresh LB solid medium. This process was repeated until a purified strain, designated HvSm-1, was obtained. The slant culture medium can be stored at 4°C for one month, and the 20% glycerol culture can be stored long-term at -80°C.
[0050] 2. Identification of strains
[0051] (1) Traditional biological identification:
[0052] The isolated strain was identified as a Gram-negative bacterium with rod-shaped cells and a glossy colony surface. Initially, it was a milky-white colony under 30°C incubation conditions, later turning red due to the production of styraxin. At higher temperatures, it produced little or no styraxin. The colony morphology was as follows: Figure 1 As shown.
[0053] (2) Molecular biological identification:
[0054] Genomic DNA of the preserved monoclonal strain was extracted using the TIANamp Bacteria DNA Kit from Tiangen Biotech. The extracted DNA was then used as a template, and the bacterial 16S rDNA was amplified using the universal 16S rDNA primers 27F (5'-AGTTTGATCMTGGCTCAG-3') and 1492R (5'-GGTTACC TTGTTACGACTT-3') as upstream and downstream primers.
[0055] PCR reaction system: 25 μL I5 Mix (Tsingke), 22 μL ddH2O, 1 μL 27F (10 μM), 1 μL 1492R (10 μM), 1 μL Genomic DNA. After the system is prepared, mix gently, centrifuge briefly, and place on a PCR instrument for PCR reaction.
[0056] The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; 72℃ for 5 min; 4℃ to terminate the reaction. The PCR products were detected by 1% agarose gel extraction, purified by gel extraction, and sent to Qingke Biotechnology Co., Ltd. (Guangzhou) for sequencing.
[0057] II. Experimental Results
[0058] The nucleotide sequence of the 16S rDNA of strain HvSm-1 is shown in SEQ ID NO: 1. Based on sequence alignment and phylogenetic tree, it is identified as Serratia marcescens.
[0059] SEQ ID NO: 1
[0060]
[0061] Serratia marcescens HvSm-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 24, 2024, with accession number GDMCC No: 65340.
[0062] Example 2: In vitro synthesis of dsRNA
[0063] I. Experimental Methods
[0064] 1. Obtaining the MuSrp54k gene sequence of soybean thrips
[0065] Based on the transcriptome of the soybean thrips determined by the inventors, the genome of the soybean thrips was compared with that of existing insects using homology comparison to obtain the MuSrp54k gene sequence of the soybean thrips (nucleotide sequence as shown in SEQ ID NO: 2).
[0066] 2. Design of dsRNA sequence and specific primers targeting the MuSrp54k gene
[0067] Based on the MuSrp54k gene sequence shown in SEQ ID NO: 2, specific primers targeting the dsRNA sequence of the MuSrp54k gene were designed, with a T7 promoter sequence (shown in SEQ ID NO: 3: taatacgactcactataggg) added to the 5' end of each primer. Specific primers targeting the dsRNA sequence of the GFP plasmid were designed using the same method as a negative control. The nucleotide sequences of the specific primers for dsMuSrp54k and dsGFP are shown in Table 1.
[0068] SEQ ID NO: 2
[0069]
[0070] Table 1. Nucleotide sequences of specific primers for dsMuSrp54k and dsGFP.
[0071]
[0072] 3. cDNA Synthesis
[0073] RNA was extracted from samples of *Thrips lentigines* at different developmental stages using the TRIzol method. RNA quality was assessed by 1% agarose gel electrophoresis and analyzed using NanoDrop One. C RNA concentration was measured using a spectrophotometer, and the OD values of RNA in all samples were [data missing]. 260 / OD 230 Between 1.8 and 2.2. Using the PrimeScript kit. TM The RT reagent kit with gDNA Eraser was used to reverse transcribe total RNA into the first strand of cDNA according to the instructions. All cDNA was diluted 10-fold for subsequent experiments.
[0074] 4. PCR amplification
[0075] The synthesized cDNA and GFP plasmid were amplified by PCR using the specific primers for dsMuSrp54k and dsGFP in Table 1, respectively. The amplification products were used to synthesize dsRNA.
[0076] PCR reaction system: ddH2O 35μL, 2×PCR Taq Master Mix 50μL, cDNA / GFP plasmid 5μL, upstream primer (10μM) 5μL, downstream primer (10μM) 5μL.
[0077] PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.
[0078] After the PCR reaction was completed, the two PCR products were detected by 1% agarose gel electrophoresis and then recovered using a DNA purification and recovery kit to obtain two PCR recovery products, which were used as templates for the synthesis of dsRNA (dsMuSrp54k and dsGFP).
[0079] 5. In vitro transcription to synthesize dsRNA
[0080] Two PCR products were recovered using MEGAscript. TM Using the T7 kit, synthesize dsRNA according to the instructions. The specific method is as follows:
[0081] The dsRNA synthesis system consisted of: 10×Reaction Buffer 5μL, ATP Solution 5μL, GTP Solution 5μL, CTP Solution 5μL, UTP Solution 5μL, PCR product 1μg, Enzyme mix 5μL, and RNase-Free Water to make up to 50μL.
[0082] After mixing the above system, it was incubated at 37°C for 2 hours. After the reaction, 2.5 μL of TURBO DNase was added to remove residual template DNA, and then the reaction was carried out according to MEGAscript. TM The T7 kit instructions purified dsRNA. After dissolving the dsRNA in 30 μL of ddH2O, it was stored at -80°C to obtain dsMuSrp54k and dsGFP, respectively. dsRNA quality was assessed using 1.5% agarose gel electrophoresis with NanoDrop One. C The concentrations of dsMuSrp54k and dsGFP were detected using a spectrophotometer.
[0083] II. Experimental Results
[0084] Figure 2 The image shows an electrophoresis diagram of dsMuSrp54k synthesized in vitro using the kit. The dsRNA designed for MuSrp54k is shown in SEQ ID NO: 4, and the dsRNA designed for GFP is shown in SEQ ID NO: 5. Because a T7 promoter sequence was added to the 5' end of both the upstream and downstream primers for dsMuSrp54k and dsGFP, the amplified products have a T7 promoter sequence at both the 5' and 3' ends, consisting of a sense strand and an antisense strand. The nucleotide sequences of the sense strand are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively, and the nucleotide sequences of the antisense strand are shown as the reverse complementary sequences of SEQ ID NO: 6 and SEQ ID NO: 7, respectively.
[0085] SEQ ID NO: 4
[0086] 5’-GTGCAGATACATTTCGTGCGGGTGCTTTTGATCAATTAAAACAAAACGCAACAAAAGCAAGAATTCCTTTTTATGGCAGTTATACAGAAGTAGATCCAGTAGTGATTGCATCTAACGGTGTTGAAAAACTTAAAAACGAAGGTTTTGAAATAATAATTGTCGATACGTCTGGTCGTCATAAACAAGAAAGTTCTTTATTTGAAGAAATGTTGCAAGTATCAAATGCAATTAAACCTGATAATGTAATTTTTGTGATGGATGCATCAATAGGTCAAGCATGTGAAGCACAAGCTCGTG-3’
[0087] SEQ ID NO:5
[0088] 5’-AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAG CTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA-3’
[0089] SEQ ID NO:6
[0090] 5’-taatacgactcactatagggGTGCAGATACATTTCGTGCGGGTGCTTTTGATCAATTA AAACAAAACGCAACAAAAGCAAGAATTCCTTTTTATGGCAGTTATACAGAAGTAGATCCAGTAGTGATTGCATCTAACGGTGTTGAAAAACTTAAAAACGAAGGTTTTGAAATAATAATTGTCGATACGTCTGGTCGTCATAAACAAGAAAGTT CTTTATTTGAAGAAATGTTGCAAGTATCAAATGCAATTAAACCTGATAATGTAATTTTTGTGATGGATGCATCAATAGGTCAAGCATGTGAAGCACAAGCTCGTGccctatagtgagtcgtatta-3’
[0091] SEQ ID NO: 7
[0092] 5’-taatacgactcactatagggAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCC ACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAccctatagtgagtcgtatta-3’
[0093] Example 3 Effect of dsRNA and Serratia marcescens on the mortality of Megalurothrips usitatus
[0094] I. Experimental method
[0095] Second-instar nymphs of the soybean thrips from the laboratory population were fed with dsMuSrp54k and dsGFP obtained in Example 2, and were also treated with Serratia marcescens (HvSm-1) obtained in Example 1.
[0096] Second-instar nymphs of the bean thrips were fed in sauce dishes containing kitchen paper. Each treatment consisted of 10 nymphs per sauce dish as one replicate, with 5 replicates.
[0097] Cowpeas treated with dsMuSrp54k: Cowpeas were soaked in a 500 ng / μL dsMuSrp54k solution for 30 min and then air-dried.
[0098] HvSm-1 treated cowpeas: with concentration OD 600 Soak cowpeas in HvSm-1 bacterial solution (1.0) for 2 minutes, then air dry;
[0099] Treatment group A (dsMusrp54k): 2nd instar nymphs were fed cowpeas treated with dsMuSrp54k, and the cowpeas were replaced every 24 hours. After 2 days of feeding, they were fed daily with untreated cowpeas.
[0100] Treatment group B (HvSm-1): with concentration OD 600 After applying HvSm-1 bacterial solution of 1.0 to the inner wall of the sauce dish and letting it dry, the cowpeas treated with HvSm-1 were fed to the second instar nymphs. The cowpeas were replaced every 24 hours. After feeding for 2 days, the cowpeas were fed daily with untreated cowpeas.
[0101] Treatment group C (dsMuSrp54k+HvSm-1): Second-instar nymphs of cowpea treated with dsMuSrp54k were fed for 1 day; afterwards, the nymphs were transferred to a treatment group treated with OD400 at a concentration of 1000 kJ / kg. 600 After coating and drying the sauce dish with a 1.0 HvSm-1 solution, feed the cowpeas treated with HvSm-1 for 1 day; then continue feeding with untreated cowpeas daily.
[0102] Replace dsMuSrp54k with dsGFP and treat the second instar nymphs with the same concentration and method as treatment group A, as a control group (dsGFP).
[0103] The sauce dishes were placed in an artificial climate chamber (temperature 26±1℃, humidity 70%~80%, photoperiod 14L:10D) for incubation. The number of dead bean thrips in each dish was counted every 24 hours, and the mortality rate was calculated.
[0104] The corrected mortality rate for each treatment and the synergistic toxicity index of the combined treatment of dsMuSrp54k and HvSm-1 were calculated according to the following formula.
[0105] Corrected mortality rate (%) = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%,
[0106] The theoretical mortality rate of combined treatment (Pm) = 1 - (1 - Pa) × (1 - Pb),
[0107] Pa and Pb are the actual mortality rates of each single agent used respectively,
[0108] Synergistic toxicity index (c.f) = (actual mortality rate - theoretical mortality rate) / theoretical mortality rate × 100,
[0109] When c.f ≥ 20, it is a synergistic effect; -20 < c.f < 20 is an additive effect; c.f ≤ -20 is an antagonistic effect.
[0110] The toxicity experiment and analysis method for female adults of Megalurothrips usitatus are the same as above.
[0111] II. Experimental results
[0112] The results are shown in Figure 3 , for the nymphs of Megalurothrips usitatus, the mortality rate was counted after 7 days. The corrected mortality rate of treatment group A was about 20%; the corrected mortality rate of treatment group B was about 65%; the corrected mortality rate of treatment group C was about 88%.
[0113] For the adults of Megalurothrips usitatus, the mortality rate was counted after 7 days. The corrected mortality rate of treatment group A reached 22%; the corrected mortality rate of treatment group B reached 30%; the corrected mortality rate of treatment group C reached 58%.
[0114] Judged by the synergistic toxicity index c.f, the combined treatment of dsMuSrp54k and HvSm-1 had a synergistic effect on both the nymphs and female adults of Megalurothrips usitatus (Table 2).
[0115] Table 2 Synergistic toxicity index of dsMuSrp54k + HvSm-One treatment on Megalurothrips usitatus
[0116]
[0117] Example 4 Influence of dsMusrp54k on the silencing efficiency of Megalurothrips usitatus
[0118] I. Experimental method
[0119] Experiments were conducted using dsMuSrp54k and dsGFP obtained in Example 2. 500 ng / μL solutions of dsMuSrp54k and dsGFP were prepared, and cowpea seeds were soaked for 30 min and then air-dried. Second-instar nymphs of the bean thrips were then fed the nymphs, with the seeds replaced every 24 h. Samples were collected after 48 h of feeding, and then flash-frozen in liquid nitrogen and stored at -80℃. Sixty second-instar nymphs constituted one biological replicate, and four biological replicates were set up for each treatment.
[0120] Total RNA was extracted from the collected samples and reverse transcribed into cDNA according to the method in Example 2. The silencing efficiency of dsMuSrp54k against soybean thrips was analyzed by RT-qPCR.
[0121] MuGAPDH from soybean thrips was selected as an internal reference gene. The RT-qPCR primers for the MuGAPDH and MuSrp54k genes are shown in Table 3.
[0122] Table 3. Nucleotide sequences of primers for quantitative real-time PCR of MuSrp54k and MuGAPDH
[0123]
[0124] RT-qPCR reaction system: 2.5 μL cDNA template, 2.5 μL each of primers F and R (10 μM), 25 μL TB Green, and 17.5 μL ddH2O.
[0125] The RT-qPCR reaction program consisted of three stages: denaturation stage (95℃: 30s); quantitative analysis stage (95℃: 5s, 60℃: 30s) for 40 cycles; and melting curve (95℃: 5s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ (0.11℃ / s, 5 photos taken for every 1℃ increase).
[0126] The experimental and analytical methods for female adult soybean thrips are the same as above.
[0127] The final result calculation uses 2 -ΔΔCt The calculation is performed using the method (Ct represents the cycle number).
[0128] II. Experimental Results
[0129] RT-qPCR analysis results ( Figure 4 The results showed that feeding second-instar nymphs and adult females with dsMuSrp54k for 2 days significantly suppressed the expression level of the MuSrp54k gene compared to the control group. This indicates that feeding dsMuSrp54k can induce a strong RNAi effect in soybean thrips, leading to a significant decrease in the expression level of the MuSrp54k gene and ultimately causing death in soybean thrips.
[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A gene MuSrp54k associated with lethality in bean thrips, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:
2.
2. The use of the MuSrp54k gene inhibitor as described in claim 1 in the control of soybean thrips or in the preparation of products for the control of soybean thrips.
3. A dsRNA for controlling bean thrips, characterized in that, Its positive strand nucleotide sequence is shown in SEQ ID NO:
4.
4. A composition for controlling bean thrips, characterized in that, An inhibitor containing the gene MuSrp54k as described in claim 1.
5. The composition according to claim 4, characterized in that, The inhibitor of the MuSrp54k gene is a dsRNA targeting the MuSrp54k gene.
6. The composition according to claim 5, characterized in that, The dsRNA is the dsRNA described in claim 3.
7. The composition according to any one of claims 4 to 6, characterized in that, It also contains Serratia marcescens, which was deposited on October 24, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 65340.
8. A strain of Serratia marcescens HvSm-1, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 24, 2024, with accession number GDMCC No: 65340.
9. The use of Serratia marcescens as described in claim 8 in the control of soybean thrips or in the preparation of products for the control of soybean thrips.
10. A method for controlling bean thrips, characterized in that, Use the inhibitor of gene MuSrp54k as described in claim 1, the composition as described in claim 4, or Serratia marcescens as described in claim 8.