Rhodotorula mucilaginosa I7Y2 and application thereof

By screening and analyzing Rhodotorula glutinis I7Y2, the shortcomings of serum-free culture medium in cell growth regulation were overcome. This study achieved the promotion of Vero cell proliferation and inhibition of apoptosis in a serum-free environment, providing a highly efficient and safe cell nutrient supplement with broad application prospects.

CN122256155APending Publication Date: 2026-06-23GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610333808.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-18
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing serum-free culture media suffer from low throughput, high cost, complex data analysis, and difficulty in accurately locating targets in experimental screening. Furthermore, the role of microbial resources in regulating mammalian cell growth has not been fully explored, and the application value of Rhodotorula glutinis has not been fully demonstrated.

Method used

A strain of Rhodotorula mucilaginosa I7Y2 was screened and systematically analyzed. It was used as a cell nutrient supplement in serum-free culture medium to promote the viability, density, proliferation rate and migration rate of Vero cells, and inhibit cell apoptosis.

Benefits of technology

Rhodotorula glutinis I7Y2 significantly improved the viability, density, and proliferation rate of Vero cells in a serum-free environment, while reducing the apoptosis rate. It provides an efficient, safe, and economical alternative to serum-free culture media and has broad application prospects in biopharmaceutical and vaccine production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256155A_ABST
    Figure CN122256155A_ABST
Patent Text Reader

Abstract

This invention discloses a strain of Rhodotorula glutinis I7Y2 that promotes cell proliferation in a serum-free environment and its applications. Rhodotorula glutinis ( Rhodotorula mucilaginosa The yeast strain I7Y2 was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on March 13, 2026, with accession number GDMCC No: 67951. This invention has a good effect on promoting Vero cell proliferation, specifically manifested in: (1) the yeast involved in this invention can produce various active substances such as amino acids, polypeptides, sanshool, and inositol to meet the nutritional needs of cell growth; (2) it can effectively improve the viability and density of Vero cells in the basal culture medium; (3) it can effectively improve the proliferation rate and migration rate of Vero cells in the basal culture medium; and (4) it can effectively reduce the apoptosis rate of Vero cells and the expression of apoptosis-related genes in the basal culture medium. Therefore, Rhodotorula glutinis I7Y2 has great application potential in promoting cell proliferation, especially in serum-free culture products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of microbial technology and pharmaceutical technology, specifically relating to a strain of Rhodotorula glutinis I7Y2 that has cell nutrition function, can promote cell proliferation and reduce cell apoptosis, and its applications. Background Technology

[0002] With the development of modern biotechnology, animal cell culture technology has been widely applied in research fields such as biology, medicine, and food, including the production of antibodies or genetically engineered drugs, human and veterinary vaccines, and cultured meat. Cell culture technology has become a core element in ensuring production efficiency and product quality. In vitro animal cell culture began in 1885 when Roux cultured chicken embryos using physiological saline. Today, cell culture media have evolved from early natural media to classic synthetic media composed of fetal bovine serum and basal medium. These media can meet the proliferation needs of various tissues and cells, including primary cells and human biopsy tissues, and are currently the most relied-upon and widely used culture medium in scientific research and production applications. However, ethical concerns regarding the source of fetal bovine serum, the unknown composition, batch-to-batch variability, the safety of using it as bovine-derived material, and the heterologous nature of human biological products have all led to significant limitations in serum-based cell culture systems, thus driving the development of serum-free cell culture.

[0003] The earliest research on serum-free cell culture originated in 1950 when Parker's team developed CMRL199 medium, pioneering the use of low-molecular-weight compounds such as amino acids, vitamins, and nucleic acid precursors in conjunction with embryonic extracts to achieve serum-free culture of chicken embryonic cells. Subsequently, between 1980 and 1976, various researchers discovered effective alternatives to serum, including serum protein components (albumin, fetal globulin), linoleic acid and putrescine, and combinations of hormones and growth factors (insulin, transferrin), thus promoting the systematization of serum-free medium design. From 1980 to the present, serum-free mediums have been continuously optimized, with increasingly more specific compositions to meet the needs of specific cell lines. Currently, there are related studies and commercially available products with unknown formulations for various cell types, such as mammalian cells, insect cells, immunological cells, and stem cells.

[0004] However, the main strategies for developing serum-free culture media focus on optimizing medium formulations through experimental design and machine learning, or using systems biology techniques to analyze cellular metabolic networks for precise nutrient supplementation. However, these methods often face challenges such as low experimental screening throughput, high costs, complex data analysis, and difficulty in precisely locating targets, limiting their universality and application efficiency. Therefore, it is necessary to break away from existing fixed components and explore new serum-free resources. Currently, various non-animal serum substitutes have been widely explored for serum-free culture, such as soybean, cottonseed, flaxseed, Chlorella extract, thermophilic sulfur algae natural proteins, Saccharomyces cerevisiae lysate, and Vibrio lysate. Compared to plant and algae-derived components, microbial-derived active ingredients exhibit unique advantages such as controllable and sustainable production and ease of engineering modification. However, commercial applications are almost entirely concentrated on Saccharomyces cerevisiae extract, while a vast amount of microbial resources remain, and their ability to regulate mammalian cell growth has not been fully explored.

[0005] Rhodotorula glutinis is a promising microbial resource awaiting development. Previous studies have shown that its extracellular polysaccharides possess good biocompatibility and antioxidant activity, effectively promoting cell adhesion and proliferation, and have been explored for application in the field of biomaterials. Furthermore, its hydrolysates, as feed additives, have been shown to improve animal growth performance and gut health, thus confirming its potential to promote cell health. However, no studies have yet confirmed Rhodotorula glutinis and its lysates as highly efficient, safe, and mechanistically defined cell nutrients, nor have studies demonstrated their application value and feasibility in serum-free culture systems.

[0006] Based on this, this patent screened a strain of Rhodotorula glutinis ( ). Rhodotorula mucilaginosa The study investigated the effects of strain I7Y2 on the cellular nutrition of animal cells, particularly Vero cells. The results confirmed that this strain significantly promoted the viability, density, proliferation rate, and migration rate of Vero cells in a serum-free culture environment, while simultaneously inhibiting apoptosis caused by nutrient deficiency. Due to its highly efficient growth-promoting effect, this strain represents a viable alternative to serum, providing an important microbial resource for developing a new generation of efficient, economical, and safe serum-free culture media, and holds broad application prospects in biopharmaceuticals, cell therapy, and vaccine production. Summary of the Invention

[0007] The purpose of this invention is to provide a strain of Rhodotorula glutinis ( ). Rhodotorula mucilaginos a) I7Y2 and its application as a cell nutrient supplement in cell culture media, especially serum-free culture media products. Rhodotorula glutinis I7Y2 can achieve serum-free proliferation of Vero cells by increasing cell viability, density, migration, and proliferation rate while reducing apoptosis rate.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] The first objective of this invention is to provide a strain of Rhodotorula glutinis ( ). Rhodotorula mucilaginosa )I7Y2, which was deposited on March 13, 2026 at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No: 67951.

[0010] The second objective of this invention is to provide the above-mentioned red yeast ( Rhodotorula mucilaginosa Applications of I7Y2 in any of the following:

[0011] Used as a cell nutrition supplement, especially to improve cell survival in low serum or serum-free conditions;

[0012] It is used as a cell proliferation promoter, especially to promote cell proliferation in low serum or serum-free conditions;

[0013] It is used as an anti-apoptotic agent, especially to inhibit apoptosis in low serum or serum-free conditions;

[0014] Products for preparing cell culture media, especially serum-free culture media.

[0015] A third objective of this invention is to provide a serum-free culture medium for Vero cells, which contains the aforementioned Rhodotorula glutinis I7Y2, or its fermentation broth, or the supernatant of the fermentation broth, or Rhodotorula glutinis I7Y2 lysate as an active ingredient.

[0016] This includes using Rhodotorula glutinis I7Y2 as a cell nutrient supplement to promote cell proliferation and delay cell apoptosis, or preparing cell culture media, especially serum-free culture media.

[0017] The Rhodotorula glutinis I7Y2 described in this invention can be used as a cell nutrition supplement to improve the viability and density of Vero cells in basal or serum-free culture media.

[0018] The Rhodotorula glutinis I7Y2 described in this invention can be used as a cell proliferation promoter to promote cell proliferation and migration in basal or serum-free culture media.

[0019] The Rhodotorula glutinis I7Y2 described in this invention can be used as an anti-apoptotic agent to inhibit cell apoptosis in basal culture medium or serum-free culture medium.

[0020] The fourth objective of this invention is to provide a target nucleotide sequence for identifying the above-mentioned Rhodotorula glutinis I7Y2, the nucleotide sequence of which is shown in SEQ ID NO. 2.

[0021] The target is characterized by its ability to specifically distinguish the strain from other yeast isolates when operated according to the implementation plan.

[0022] The fifth objective of this invention is to provide a primer set for identifying the above-mentioned Rhodotorula glutinis I7Y2, comprising: 5'-AAACAGCATGATTCTTGCCAAC-3' and 5'-GTTCAACGGAGAACGTTACCTTC-3'.

[0023] The sixth objective of this invention is to provide a method for identifying the above-mentioned Rhodotorula glutinis I7Y2, which involves using the above-mentioned primer set as amplification primers to perform a PCR reaction amplification of the test bacteria. If a 363bp product is amplified, it is Rhodotorula glutinis I7Y2; if no 363bp product is amplified, it is not Rhodotorula glutinis I7Y2.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] 1. The Rhodotorula glutinis in this invention is a superior strain of local origin.

[0026] 2. Compared with animal-derived and plant-derived serum substitutes, this invention has no toxic side effects on the ecological environment, no residual risk, is green and safe, and the production process is controllable and sustainable.

[0027] 3. Compared with commercial yeast extracts, the present invention has a better effect on promoting serum-free cell proliferation.

[0028] 4. This invention has a good effect on promoting Vero cell proliferation, specifically manifested in:

[0029] (1) The yeast involved in this invention can produce a variety of active substances such as amino acids, polypeptides, sanshool, and inositol to meet the nutritional needs of cell growth.

[0030] (2) It can effectively improve the viability and density of Vero cells in the basal culture medium;

[0031] (3) It can effectively improve the proliferation rate and migration rate of Vero cells in the basal culture medium;

[0032] (4) It can effectively reduce the apoptosis rate of Vero cells and the expression of apoptosis-related genes in the basal culture medium.

[0033] Therefore, Rhodotorula glutinis I7Y2 has great application potential in promoting cell proliferation, especially in serum-free culture products.

[0034] Rhodotorula mucilaginosaI7Y2 was deposited on March 13, 2026 at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No: 67951. Attached Figure Description

[0035] Figure 1 This involves screening for cell proliferation-promoting strains. Figure captions: (A) Screening of proliferative strains; (B) Effect of different modes of action of strains on cell density; (C) Effect of different amounts of I7Y2 lysate on cell density; (D) Effect of different lysis methods of I7Y2 on cell viability; (E) Protein content after lysis of I7Y2 using different methods; (F) Effect of different enzyme treatments of I7Y2 on cell viability; (G) Peptide content of I7Y2 after different enzyme treatments. ns represents... p > 0.05, * indicates p <0.05, ** indicates p <0.01, *** indicates p <0.001, **** indicates p <0.0001.

[0036] Figure 2 This study investigated cell morphology, cell density, and cell viability after adding *Rhodotorula glutinis* I7Y2 to DMEM basal medium. Figure captions: (A) Optical microscope showing the effect of *Rhodotorula glutinis* I7Y2 addition on cell morphology; (B) Cell counting method to detect the effect of I7Y2 lysate on cell density; (C) CCK-8 assay to detect the effect of I7Y2 lysate on cell viability. *** indicates... p <0.001, **** indicates p <0.0001.

[0037] Figure 3 This figure shows the proliferation and healing rate of Vero cells after adding Rhodotorula glutinis I7Y2 to DMEM basal medium. Figure captions: (A) Scratch assay to detect the difference in cell migration ability between DMEM and DMEM-I7Y2 (left) and quantitative analysis (right); (B) EdU assay to detect cell proliferation ability between DMEM and DMEM-I7Y2 (left) and quantitative results (right). * indicates... p <0.05, ** indicates p <0.01, *** indicates p <0.001, **** indicates p <0.0001.

[0038] Figure 4This study investigated the apoptosis rate and expression of apoptosis-related genes in Vero cells after adding Rhodotorula glutinis I7Y2 to DMEM basal medium. Figure captions: (A) Non-targeted metabolomics detection of differential cell metabolism in DMEM vs 10% FBS media (cationic mode); (B) Non-targeted metabolomics detection of differential cell metabolism in DMEM vs DMEM-I7Y2 media (cationic mode); (C) LC-MS detection of intracellular LPC content at different serum concentrations; (D) CCK8 assay detection of the effect of exogenous LPC addition on cell viability; (E) Cell counting assay detection of the effect of exogenous LPC addition on cell density; (F) LC-MS quantitative detection of changes in intracellular LPC content over time in DMEM and DMEM-I7Y2 media; (G) Flow cytometry detection of the effect of LPC on cell apoptosis (left) and quantitative results (right); (H) Flow cytometry detection of the effect of I7Y2 lysate on cell apoptosis (left) and quantitative analysis (right); (I) RT-qPCR showing the effect of LPC on key factors of Vero cell apoptosis pathway at the mRNA level compared to the 10% FBS group; (J) RT-qPCR showed the effect of I7Y2 lysate on the mRNA levels of key factors in the Vero cell apoptosis pathway compared to DMEM. ns represents... p > 0.05, ** indicates p <0.01, *** indicates p <0.001, **** indicates p <0.0001.

[0039] Figure 5 This figure shows the effect of serum-free medium OMPB11-I7Y2 supplemented with Rhodotorula glutinis I7Y2 on Vero cells. Figure captions: (A) Cell growth promotion effect of I7Y2 lysate compared to commercial yeast extract; (B) Cell density growth curve in OMPB11-I7Y2 compared to commercial serum-free medium; (C) Cell passage stability in OMPB11-I7Y2 compared to commercial serum-free medium; (D) Poliovirus proliferation; (E) Cell cycle changes in OMPB11-I7Y2 compared to commercial serum-free medium; (F) Changes in apoptosis in OMPB11-I7Y2 compared to commercial serum-free medium. ns represents... p > 0.05, * indicates p <0.05, ** indicates p <0.01, *** indicates p <0.001, **** indicates p<0.0001.

[0040] Figure 6This is the molecular target verification of Rhodotorula glutinis I7Y2. Figure caption: M is DNA marker, 1 is the electrophoresis image of the PCR product of Rhodotorula glutinis I7Y2 molecular target sequence (SEQ ID No.2) amplified by specific primer sets X6-F and X6-R, and 2-45 are the electrophoresis images of PCR products of other yeasts amplified by molecular target sequences.

[0041] Figure 7 A schematic diagram of real-time Ct values ​​for qPCR in the quantitative detection of the molecular target I7Y2 of Rhodotorula glutinis and a standard curve of I7Y2 extracted DNA concentration. Detailed Implementation

[0042] The present invention will be further described below with reference to specific embodiments.

[0043] The culture media involved in the following examples are as follows:

[0044] MRS agar plates (g / L): peptone 10.0 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 20.0 g / L, Tween 80 1.0 ml / L, K2PO4·3H2O 2.0 g / L, sodium acetate 5.0 g / L, triamine citrate 2.0 g / L, MgSO4·7H2O 0.2 g / L, MnSO4·4H2O 0.05 g / L, agar 20 g / L, with water as the solvent. The preparation method is to mix all the components evenly and sterilize at 115℃ for 20 min.

[0045] MRS broth medium (g / L): peptone 10.0 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 20.0 g / L, Tween 80 1.0 ml / L, K2PO4·3H2O 2.0 g / L, sodium acetate 5.0 g / L, triamine citrate 2.0 g / L, MgSO4·7H2O 0.2 g / L, MnSO4·4H2O 0.05 g / L, with water as the solvent. The preparation method is to mix all the components evenly and sterilize at 115℃ for 20 min.

[0046] Malt extract agar plates (g / L): 130 g / L malt extract powder, 0.1 g / L chloramphenicol, 20 g / L agar, with water as the solvent. The preparation method is to mix all the components evenly and sterilize at 115℃ for 20 min.

[0047] Malt extract culture medium (g / L): 130 g / L malt extract powder, 0.1 g / L chloramphenicol, water as solvent. The preparation method is to mix all the components evenly and sterilize at 115℃ for 20 min.

[0048] DMEM cell culture medium (mg / L): Calcium chloride dihydrate 265.00 mg / L, ferric nitrate nonahydrate 0.10 mg / L, potassium chloride 400.00 mg / L, anhydrous magnesium sulfate 97.67 mg / L, sodium chloride 6400.00 mg / L, anhydrous sodium dihydrogen phosphate 109.00 mg / L, succinic acid 75.00 mg / L, sodium succinate 100.00 mg / L, L-arginine hydrochloride 84.00 mg / L, L-cysteine ​​hydrochloride 63.00 mg / L, glycine 30.00 mg / L, L-histidine hydrochloride 42.00 mg / L, L-isoleucine 105.00 mg / L, L-leucine 105.00 mg / L, L-lysine hydrochloride 146.00 mg / L, L-methionine 30.00 mg / L. The following ingredients were prepared: 0 mg / L L-phenylalanine 66.00 mg / L L-serine 42.00 mg / L L-threonine 95.00 mg / L L-tryptophan 16.00 mg / L L-tyrosine 72.00 mg / L L-valine 94.00 mg / L D-calcium pantothenate 4.00 mg / L Choline tartrate 7.20 mg / L Folic acid 4.00 mg / L Inositol 7.20 mg / L Nicotinamide 4.00 mg / L Riboflavin 0.40 mg / L Thiamine hydrochloride 4.00 mg / L Pyridoxine hydrochloride 4.00 mg / L Glucose 1000.00 mg / L Sodium pyruvate 110.00 mg / L Phenol red 15.00 mg / L. The solvent was water. The preparation method was to mix all the ingredients evenly and sterilize them.

[0049] Complete culture medium: DMEM cell culture medium with 10% (v / v) fetal bovine serum and 1% penicillin-streptomycin antibiotics, 10000 U / mL.

[0050] Example 1: Isolation, Identification and Culture of Strains

[0051] 1.1 Isolation and Preservation of Strains

[0052] Probiotics: Fermented foods and feces from the Tibet Autonomous Region were collected as samples. Under aseptic conditions, 0.1g of the sample was added to 10 mL of MRS broth medium, shaken to mix, and then enriched under anaerobic conditions at 37℃ for 24 h. 0.5 mL of the bacterial solution was then incubated in physiological saline for 10 h. -1 Up to 10 -8 Gradient dilution. Select 10 -6 10 -7 10 -8Three gradient bacterial suspensions were each aspirated at 100 μL and spread evenly onto MRS agar plates, then incubated anaerobically at 37 ℃ for 48 h. Morphologically typical colonies from the plates were streaked onto MRS agar medium for purification. After purification, single colonies were inoculated into MRS liquid medium and incubated anaerobically at 37 ℃ for 48 h. The culture was then stored in 50% glycerol at -80 ℃.

[0053] Yeast: Fermented foods and feces from the Tibet Autonomous Region were collected as samples. Under aseptic conditions, 0.1 g of sample was added to 10 mL of malt extract culture medium, shaken to mix, and then enriched under anaerobic conditions at 37 ℃ for 24 h. 0.5 mL of the bacterial solution was then incubated in physiological saline for 10 h. -1 Up to 10 -5 Gradient dilution. Select 10 -3 10 -4 10 -5 Three gradient bacterial suspensions were prepared, with 100 μL of each being transferred to malt extract agar plates and spread evenly. The plates were then incubated at 30 °C for 48 h. Morphologically typical colonies were picked from the plates and streaked onto malt extract agar for purification. After purification, single colonies were inoculated into malt extract liquid medium and incubated at 30 °C for 48 h. The culture was then stored in 50% glycerol at -80 °C.

[0054] 1.2 Taxonomic identification of strains

[0055] Probiotics: Bacterial DNA was extracted using a bacterial DNA extraction kit (HuanKai, Guangzhou, China), and then amplified by PCR using a 2×PCR mix (Yeasen, Shanghai, China). The PCR primers used were... 16S rRNA Universal primers were used for the gene sequencing. The upstream primer sequence was 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'; the downstream primer sequence was 1492R: 5'-CTACGGCTACCTTGTTACGA-3'. PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; 35 cycles of 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 1 min 30 s; followed by annealing and extension at 72℃ for 10 min. The PCR products were gel-cleaved and recovered, and then subjected to Sanger sequencing. 16S rRNA The strain was identified by comparing its gene sequence with the NCBI database (https: / / blast.ncbi.nlm.nih.gov).

[0056] Yeast: Yeast DNA was extracted using a yeast DNA extraction kit (HuanKai, Guangzhou, China), and then amplified by PCR using a 2×PCR mix (Yeasen, Shanghai, China). The PCR primers used were... 26S rRNA Universal primers were used for the gene. The upstream primer sequence was NL-1: 5'-GCATATCAATAAGCGGAAAAG-3'; the downstream primer sequence was NL-4: 5'-GGTCCGTGTTTCAAGACGG-3'. PCR reaction conditions were: pre-denaturation at 95 ℃ for 5 min; 35 cycles of 94 ℃ for 45 s, 55 ℃ for 45 s, and 72 ℃ for 60 s; followed by annealing and extension at 72 ℃ for 10 min. The PCR products were recovered by gel extraction and then sequenced using Sanger sequencing. 26S rRNA The gene sequence was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov) to identify the strain, thus obtaining strain I7Y2.

[0057] strain I7Y2 26S rRNA The gene sequence is shown in SEQ ID No. 1. Alignment of this sequence with the NCBI database (https: / / blast.ncbi.nlm.nih.gov) showed that it had the highest homology with *Rhodotorula glutinis*, and it was named *Rhodotorula glutinis*. Rhodotorula mucilaginosa )I7Y2, which was deposited on March 13, 2026 at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No: 67951.

[0058] Example 2: Preparation of microbial culture and fermentation broth and lysate.

[0059] 2.1 Resuscitation and Culture of Strains

[0060] Sixty-five probiotic strains (Lactobacillus and Bifidobacterium) were streaked on MRS agar and anaerobically cultured at 37 °C for 48 h; thirteen yeast strains were cultured on malt extract agar at 30 °C and 200 r / min for 48 h, and their colony morphology was observed. The Rhodotorula glutinis I7Y2 strain claimed in this patent exhibited medium-sized, round, raised, moist colonies with neat edges and uniform color, ranging from orange to dark orange or crimson.

[0061] 2.2 Preparation of fermentation broth and lysates of the strain

[0062] The preparation method of probiotic fermentation supernatant is as follows: single colonies are picked from the activated plate and inoculated into 10 mL of MRS medium under aseptic conditions, followed by anaerobic culture at 37 ℃ for 48 h. The supernatant is centrifuged at 10,000 × g for 10 min at 4 °C to precipitate the bacterial cells. The supernatant is collected, and the pH is adjusted to 7.0-7.2 with 1 mol / L NaOH. The supernatant is then sterilized using a 0.22 μm filter to obtain cell-free supernatant, which is stored at -80 ℃ for later use.

[0063] The preparation method of yeast fermentation supernatant is as follows: Single colonies are picked from activated agar plates and inoculated into 10 mL of malt extract medium under aseptic conditions. The medium is then incubated at 30 °C and 200 r / min for 48 h. The supernatant is centrifuged at 10,000 × g for 10 min at 4 °C to precipitate the cells. The supernatant is collected, and the pH is adjusted to 7.0-7.2 with 1 mol / L NaOH. The supernatant is then sterilized using a 0.22 μm filter to obtain cell-free supernatant, which is stored at -80 °C for later use.

[0064] Preparation of lysate: 1 g of precipitated bacterial cells were resuspended in 10 mL of deionized water at 10% (m / v) wet weight. 0.01 g of proteinase K was added for enzymatic hydrolysis. The reaction conditions were pH 7.5, reaction time 9 h, and hydrolysis temperature 55 °C. After hydrolysis, the enzyme was inactivated at 95 °C for 10 min. The lysate was centrifuged at 10000 × g for 10 min at 4 °C. The supernatant was collected, filtered, and stored at -80 °C for later use.

[0065] Example 3: Screening of serum-free strains that promote Vero cell proliferation

[0066] 3.1 CCK-8 assay for initial screening of strains promoting cell growth activity

[0067] Digested Vero cells were resuspended in DMEM at a concentration of 1 × 10⁻⁶. 5 Cells / mL were seeded in 96-well plates, and 10 μL of the strain's fermentation supernatant diluted 10-fold was added to each well. The plates were incubated at 37 °C in a 5% CO2 incubator for 48 h. The ability of the strain to promote cell proliferation with cell-free supernatant was evaluated using a CCK-8 assay kit (GLPBIO, Montclair, CA, USA) according to the manufacturer's instructions. A secondary CCK-8 screening was performed to prevent experimental error.

[0068] 3.2 Cell counting method for secondary screening of strains to promote cell growth density

[0069] Combining the results of two CCK-8 tests, strains with cell viability exceeding 120% were screened for cell density rescreening. Vero cells were seeded at the same density in 24-well plates, and 10 μL of cell-free supernatant from strains that improved cell viability in both screenings was added. Cell counting was performed using Counterstar. Due to differences in screening batches, the density was normalized using the sample density / control density, and this was named relative viable cell density (relative VCD).

[0070] Using CCK-8 assay and cell counting, the top three microorganisms that could efficiently and stably promote cell growth were identified: *Lactobacillus foodoidensis* (…). Lactobacillus paralimentarius G5-2, Kluyveromycin ( Kluyveromyces marxianus F9Y3 and Rhodotorula glutinis ( Rhodotorula mucilaginosa ) I7Y2 ( Figure 1 A. Table 1).

[0071] Table 1. Evaluation of the ability of 78 strains to promote Vero cell growth. ; ; ;

[0072] 3.3 Effects of different strains and their dosage on cell proliferation promotion

[0073] The effects of different forms of the strain (fermentation broth, cell lysate) on the proliferation of Vero cells were further compared. Figure 1 B). The results showed that both the fermentation broth and the cell lysate effectively promoted cell proliferation, with similar effects. Given the superior controllability of the cell lysate in terms of preparation and storage stability, subsequent experiments selected the lysate for dose-effect studies. By comparing the proliferation-promoting effects of different addition amounts, it was determined that the Rhodotorula glutinis I7Y2 cell lysate at a concentration of 4% (v / v) had the best proliferation-promoting effect on Vero cells. Figure 1 C).

[0074] 3.4 Effects of different lysis modes and enzyme treatments on the proliferation-promoting effect of strains

[0075] Based on the confirmed significant proliferation-promoting effect of Rhodotorula mucilaginosa I7Y2 lysate, this study further investigated the influence of different lysis methods (ultrasound, autoclaving, enzymatic hydrolysis, and autolysis) on this activity. The specific methods are as follows: Ultrasound treatment involved resuspending the bacterial suspension (1 g of precipitated cells resuspended in 10 mL of deionized water at 10% (m / v) wet weight) and sonicating at 600 W for 30 min (5 s working, 5 s rest); autoclaving treatment involved three cycles of high-pressure treatment at 20 kpsi; autolysis treatment involved adjusting the pH of the resuspended bacterial suspension to 5.5 and stirring at 55 °C and 150 r / min for 36 h, followed by boiling for 10 min to terminate the reaction; enzymatic hydrolysis was performed according to the steps described in Example 2.2. All lysates were centrifuged and filtered before use.

[0076] The results showed that the lysate obtained by enzymatic hydrolysis had the best proliferation-promoting effect and the highest protein content. Figure 1 DE. Subsequently, the effects of different enzymes on lysis were screened. Considering both peptide content and cell growth density, it was confirmed that the lysate obtained by treatment with proteinase K exhibited the best activity. Figure 1 FG), used in the experiments of the following embodiments.

[0077] Example 4: Rhodotorula glutinis I7Y2 as a cell nutrition supplement to maintain cell state in DMEM basal medium

[0078] 4.1 Changes in cell morphology

[0079] The digested Vero cells were resuspended in DMEM and DMEM-I7Y2 (serum-free DMEM medium supplemented with 4% (v / v) I7Y2 lysate (Example 2, 2.2)) at 2.5 × 10⁻⁶. 5 Cells / mL were seeded in six-well plates and cultured at 37 °C with 5% CO2 for 48 h. Morphological observation was performed under an optical microscope (Olympus, Tokyo, Japan). Results showed that while the addition of 4% (v / v) I7Y2 lysate to serum-free DMEM medium did not result in a complete monolayer, cell density was higher than the DMEM control group, and cell shedding was significantly reduced. Furthermore, the cell population showed filamentous outward extension at the edges, suggesting that the lysate may support cell growth to some extent, but the lack of nutrients could not support the formation of typical epithelial cell morphology. Figure 2 A).

[0080] 4.2 Cell viability and cell density

[0081] Digested Vero cells were resuspended in DMEM at a concentration of 1 × 10⁻⁶. 5Cells / mL were seeded in 96-well plates with 4% (v / v) I7Y2 lysate per well (Example 2, section 2.2) and cultured at 37 °C in a 5% CO2 incubator for 96 h. DMEM without I7Y2 lysate and 10% FBS (i.e., DMEM supplemented with 10% v / v fetal bovine serum, hereinafter the same) were used as controls. Cell viability was assessed every 24 h using a CCK-8 assay kit (GLPBIO, Montclair, CA, USA) according to the manufacturer's instructions. Vero cells were seeded at the same density in 24-well plates with 4% (v / v) I7Y2 lysate, and cell density was assessed using Counterstar for cell counting. Further assays showed that the addition of I7Y2 lysate significantly improved cell viability and density under serum-free conditions. Figure 2 (B&C). The above results indicate that Rhodotorula glutinis lysate has the ability to promote cell growth in a serum-free environment.

[0082] Example 5: Rhodotorula glutinis I7Y2 as a cell proliferation promoter to enhance cell migration and proliferation in DMEM basal medium.

[0083] 5.1 Cell migration ability

[0084] Cell migration ability was determined by scratch assay. Vero cells were resuspended in 10% FBS serum medium, DMEM basal medium, and DMEM containing I7Y2 lysate (4% v / v) (same as DMEM-I7Y2 in Example 4), respectively, at 3 × 10⁻⁶. 5 / mL was seeded into 6-well culture plates and cultured at 37 °C in the presence of 5% CO2. When the cells reached 90% confluence, the culture medium was removed, and the surface of the seeded cells was scraped with the tip of a 20 μL pipette, followed by gentle washing with PBS. 2 mL of the corresponding fresh culture medium was added and cultured further. Finally, scratch images were taken at 0 h and 24 h, and the healing rate was calculated using ImageJ software. The results showed that, compared with the DMEM group, the addition of I7Y2 lysate significantly improved cell migration and healing ability. Figure 3 A).

[0085] 5.2 Cell proliferation capacity

[0086] Cell proliferation capacity was determined by EdU staining. Vero cells were resuspended in 10% FBS serum medium, DMEM basal medium, and DMEM containing I7Y2 lysate (4% v / v) (same as DMEM-I7Y2 in Example 4), respectively, with a concentration of 1×10⁻⁶. 5Cells were seeded at 1 / mL in 96-well plates and cultured at 37 °C in a 5% CO2 incubator for 48 h. Cell proliferation was measured using the Click-iT EdU Cell Proliferation Detection Kit (UElandy, Jiangsu, Suzhou, China) according to the manufacturer's instructions. Fluorescence images were acquired using a Cytation5 Imager reader (Biotek). The percentage of EdU-positive cells was quantified using ImageJ software. The results showed that I7Y2 treatment significantly increased the proportion of EdU-positive cells in DMEM, demonstrating its effective promotion of cell proliferation. Figure 3 B).

[0087] Example 6: Rhodotorula glutinis reduces lysophosphatidylcholine (LPC) accumulation, thereby inhibiting the Bcl-2 / Bax / Caspase3 pathway and improving cell apoptosis in DMEM basal medium.

[0088] 6.1 Non-targeted metabolomics detection of Vero cell metabolic changes in different culture media

[0089] Cells were resuspended in DMEM and DMEM medium containing I7Y2 (same as DMEM-I7Y2 in Example 4) at 3.5 × 10⁻⁶. 5 Cells were seeded at 1 / mL density in six-well plates and cultured for 48 h. The cells were then quenched by contacting the bottom with liquid nitrogen. 800 μL of 80% methanol aqueous solution was added, and the cells were transferred to 1.5 mL centrifuge tubes using a scraper. The cells were sonicated (6 min, 480 W, 5 s on, 9 s off), centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected and dried with liquid nitrogen. The supernatant was reconstituted with 200 μL of 50% acetonitrile aqueous solution, sonicated in an ice-water bath for 10 min, and centrifuged at 12000 rpm for 10 min at 4°C. The sample was collected into vials for LC-MS / MS analysis. 10 μL of supernatant from each sample was precisely mixed with the quality control sample to assess the reproducibility and stability of the LC-MS analysis procedure.

[0090] Liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used to analyze changes in cell metabolism in different culture media. LC conditions: Thermo Scientific™ Accucore™ C18 column (100 × 2.1 mm, 2.6 μm); in positive ion mode, mobile phase A was acetonitrile with 1 / 1000 formic acid aqueous solution, and mobile phase B was acetonitrile solution; in negative ion mode, mobile phase A was 5 mM ammonium formate, and mobile phase B was acetonitrile solution; flow rate: 0.3 mL / min; column temperature: 35℃; injection volume: 2 μL. Elution conditions: 0–1.0 min, 1% B; 1.0–8.0 min, 1–99% B; 8.0–10.0 min, 99% B; 10.0–10.1 min, 99–1% B; 10.1–12 min, 1% B. Capillary temperature: 320°C; scan range: 70–1050 m / z.

[0091] Raw data acquired by LC-MS was imported into Compound Discoverer 3.1 (Thermo Fisher Scientific, USA) for data processing. Metabolite identification was performed using multiple databases, including mzVault, mzCloud (https: / / www.mzcloud.org / ), and ChemSpider (HMDB, KEGG, and LipidMaps). The obtained metabolites were then statistically analyzed using the online software MetaboAnalyst 6.0 (https: / / www.metaboanalyst.ca / ).

[0092] The results showed that, compared with the 10% FBS group and the I7Y2 group, the level of lysophosphatidylcholine (LPC), a metabolite closely related to apoptosis, was significantly upregulated in the DMEM group. Based on this, it is speculated that the accumulation of intracellular LPC under DMEM culture conditions may be one of the key factors inducing apoptosis in a serum-free environment, while I7Y2 may inhibit the accumulation of this substance. Figure 4 AB).

[0093] 6.2 Detection of LPC content in different culture media

[0094] LPC content in cells was detected using UPLC-MS / MS. Sample pretreatment was the same as for non-targeted metabolomics. HPLC conditions: Thermo Scientific™ Accucore™ C18 Column (100 × 2.1 mm, 2.6 μm); mobile phase A: 0.1% formic acid aqueous solution; mobile phase B: methanol solution; flow rate: 0.3 mL / min; column temperature: 45℃; injection volume: 2 μL. Mass spectrometry conditions: ion source: electrospray ionization; scanning mode: positive ion (ESI+); detection mode: multiple reaction monitoring (MRM); ion source temperature: 550℃; spray voltage: 5500 V; ion source GS1: 55 psi; ion source GS2: 60 psi; curtain gas: 30 psi.

[0095] The results showed that as the serum concentration in the culture medium gradually decreased, the intracellular LPC content gradually increased. Figure 4 C). To verify the apoptosis-inducing effect of LPC, different concentrations of LPC were exogenously added to complete culture medium. The results showed that even in the presence of serum, a certain concentration of LPC could still significantly reduce cell viability and density. Figure 4 DE). In summary, in a nutrient-deficient environment, the accumulation of LPC in Vero cells may be one of the important reasons for apoptosis. However, in the I7Y2-added group, the LPC level in the actively proliferating S phase (36-48h) of Vero cells was significantly lower than that in the DMEM group, indicating that I7Y2 can alleviate LPC accumulation. Figure 4 F).

[0096] 6.3 Apoptosis rate in different culture media

[0097] Vero cells were resuspended in 10% FBS serum medium, 10% FBS + LPC medium (10% FBS serum medium with 50 μg / mL LPC added), DMEM basal medium, and DMEM containing I7Y2 lysate (same as DMEM-I7Y2 in Example 4) at 3 × 10⁻⁶ ppm. 5 Cells were seeded at 2 × 10⁶ mL / mL into 6-well plates and cultured at 37 °C in a 5% CO₂ incubator for 48 h. Apoptosis was detected using Annexin V-FITC. 5 Cells / mL were seeded in six-well plates and cultured for 60 h. 3 × 10⁻⁶ cells / mL were collected. 5 Cells were incubated with Annexin V-FITC binding solution, followed by 5 µL of Annexin V-FITC and 10 μL of propidium iodide staining solution in the dark for 15 min. Apoptosis was detected by flow cytometry within 30 min. The results showed that LPC significantly induced apoptosis, while I7Y2 significantly inhibited apoptosis induced by a serum-free environment. Figure 4 GH).

[0098] 6.4 Expression of apoptosis factors in different culture media

[0099] The intrinsic apoptosis pathway is a key pathway for cells to respond to various stress signals. This pathway modulates mitochondrial outer membrane permeability by regulating the expression balance between the pro-apoptotic protein Bax and the anti-apoptotic protein Bcl-2, releasing cytochrome C, and activating the caspase cascade, ultimately executing the apoptosis program. Caspase-3 is the most common apoptosis executor. Therefore, this study verified whether I7Y2 could improve Bcl-2 / Bax / Caspase 3-induced apoptosis by reducing LPC accumulation.

[0100] Vero cells were resuspended in 10% FBS serum medium, 10% FBS + LPC medium, DMEM basal medium, and DMEM containing I7Y2 lysate, respectively, at 3 × 10⁻⁶. 5 Cells / mL were seeded into 6-well plates and cultured for 60 h. Total RNA was extracted from the cells according to the HiPureTotal RNA Mini Kit (Magen, Guangzhou, Guangdong, China) instructions. Reverse transcription and gDNA removal were performed using the PrimeScript™ FAST RT reagent Kit with gDNA Eraser (Takara, Beijing, China). Subsequently, the RNA was extracted according to the TB Green® Premix Ex Taq™ II kit (Takara) instructions. bcl-2 , bax , caspase3 Primers for gene expression level determination are shown in Table 2. The relative expression level of the target gene was determined using 2... –ΔΔCt calculate.

[0101] RT-qPCR analysis showed that, compared with the 10% FBS group, the DMEM and LPC treatment groups had significantly lower levels of... bcl-2 / bax Expression was significantly downregulated. caspase-3 The expression of was significantly upregulated ( Figure 4 I). Compared to the DMEM group, the I7Y2 treatment significantly upregulated [the condition / effect]. bcl-2 / bax And lowered caspase-3 The expression ( Figure 4 J). I7Y2 lysate may alleviate Vero cell apoptosis under nutrient-deprived conditions by reducing LPC accumulation in cells in a serum-free environment, thereby inhibiting the activation of the Bcl-2 / Bax / Caspase-3 signaling pathway.

[0102] Table 2 Primers for qPCR detection of apoptosis factors

[0103] Example 7: Effect of serum-free medium OMPB11-I7Y2 on Vero cells

[0104] 7.1 Growth-promoting effect of I7Y2 compared to commercial yeast extract

[0105] Based on previous research findings that Rhodotorula glutinis I7Y2 lysate can significantly promote Vero cell proliferation in basal DMEM medium, in order to further explore its application potential, I7Y2 lysate was added to the serum-free medium OMPB11 (Huankai Biotechnology, Guangdong, China) developed in-house to evaluate its effect on Vero cells.

[0106] The growth-promoting effects of two commercially available lysates, Brand 1 (Y8020, Solarbio), Brand 2 (V900886, Sigma-Aldrich), and I7Y2, were assessed using a cell counting method. Vero cells were seeded at 80,000 cells / mL in 24-well plates, and different lysates were added at 3% (v / v). Cells were incubated at 37 °C in a 5% CO2 incubator for 48 h before cell counting. The results showed that I7Y2 had a stronger growth-promoting effect than the commercial yeast extract. Figure 5 A).

[0107] 7.2 Growth curve of Vero cells cultured in serum-free medium OMPB11-I7Y2

[0108] Vero cells were resuspended in 10% FBS, OMPB11-I7Y2 (serum-free medium OMPB11 with 3% (v / v) I7Y2 lysate), and a commercial serum-free medium (AM146, Optimum Biotech). Cells were seeded at a density of 5000 cells per well in 24-well plates, and cell density was measured every 24 h using a cell counter. Growth curves were plotted after 7 consecutive days of measurements. The medium was changed every 72 h during the measurement period.

[0109] The results showed that adding I7Y2 to OMPB11 significantly increased cell density. Growth curve analysis indicated that the cell proliferation rate in this group was relatively slow, but the highest cell density reached was comparable to that of the 10% FBS group and a commercial serum-free culture medium. Figure 5 B).

[0110] 7.3 Passage stability of Vero cells cultured in serum-free medium OMPB11-I7Y2

[0111] Vero cells were loaded at 4 × 105 Cells / mL were seeded in 10% FBS, OMPB11-I7Y2, and a commercially available culture medium (AM146, OPMA), and cultured at 37°C in a 5% CO2 incubator for 48 h. Serum-containing and serum-free media were digested with trypsin and recombinant trypsin, respectively, and then passaged to determine passage stability.

[0112] The results are as follows Figure 5 As shown in C, cells in OMPB11-I7Y2 medium do not require acclimatization and can be stably passaged after three generations. The passage effect is better than that of a certain commercial medium, but still slightly worse than that of 10% FBS medium. This is likely due to the slower cell proliferation in serum-free medium under the same culture time.

[0113] 7.4 Application of serum-free medium OMPB11-I7Y2 for culturing Vero cells

[0114] Vero cells are widely used for various virus cultures. Therefore, the ability of Vero cells to culture poliovirus (vaccine strain) in different culture media was tested by determining the half-maximal tissue culture infectious dose (TCID50). The viral titers obtained from 10% FBS, OMPB11-I7Y2, and a commercially available brand of culture medium were 6.34, 6.73, and 6.27 Log10 TCID50 / mL, respectively, indicating that there was no significant difference in the ability of Vero cells to culture the virus between OMPB11-I7Y2 and 10% FBS media. Figure 5 D).

[0115] 7.5 Cell cycle changes in Vero cells cultured in serum-free medium OMPB11-I7Y2

[0116] Cell cycle changes were detected using the PI single staining method. Vero cells were resuspended in 10% FBS, OMPB11-I7Y2, and a commercially available culture medium (AM146, OPMI). Cells were then cultured at a concentration of 2 × 10⁶ cells / mL. 5 Cells / mL were seeded in six-well plates and cultured for 36 h. 3×10⁶ cells / mL were collected. 5Centrifuge each cell at 1000 rpm for 5 min, discard the supernatant, wash with pre-chilled PBS, and then add 1 mL of PBS and gently pipette to disperse the cells. Take 4 mL of pre-chilled 95% ethanol and add the cell suspension (placed on ice) dropwise to the ethanol solution, tapping or vortexing after each drop to mix thoroughly. Fix at 4 °C for 2 h or longer. Centrifuge the fixed cell suspension at 1500 rpm for 5 min, resuspend in 3-5 mL of pre-chilled PBS, wash, centrifuge again, and carefully aspirate the supernatant. Prepare propidium iodide (PI) staining solution according to the kit instructions, adding 15 μL of propidium iodide (25×) and 1 μL of RNase A to each 0.4 mL of buffer. Before flow cytometry analysis, add 0.4 mL of staining solution to each tube of cells, incubate at 37 °C in the dark for half an hour, then store at 4 °C. Perform flow cytometry analysis within 24 h.

[0117] The results are as follows Figure 5 As shown in E, in OMPB11-I7Y2 medium, the proportion of cells in the G0 / G1 phase (pre-DNA synthesis phase) is similar to that in 10% FBS, both shorter than that in a certain commercial medium; the proportion of cells in the S phase (DNA synthesis phase) is higher than that in 10% FBS and a certain commercial medium. That is, OMPB11-I7Y2 medium is conducive to cell DNA synthesis, which further promotes cell growth and proliferation.

[0118] 7.6 Apoptosis of Vero cells cultured in serum-free medium OMPB11-I7Y2

[0119] Cell apoptosis was detected using Annexin V-FITC. Cells were resuspended in 10% FBS, OMPB11-I7Y2, and a commercial serum-free medium at a concentration of 2 × 10⁻⁶. 5 Cells / mL were seeded in six-well plates and cultured for 60 h. 3 × 10⁻⁶ cells / mL were collected. 5 Cells were incubated with Annexin V-FITC binding solution, followed by 5 µL of Annexin V-FITC and 10 μL of propidium iodide staining solution in the dark for 15 min. Apoptosis was detected by flow cytometry within 30 min. The results showed that the apoptosis rate of the OMPB11-I7Y2 group was not significantly different from that of the 10% FBS group, but was significantly lower than that of the DMEM group and the above-mentioned commercial serum-free culture medium ( ). Figure 5 F).

[0120] Example 8: Specific molecular target recognition of Rhodotorula glutinis I7Y2

[0121] 8.1. Discovery of Specific Molecular Targets for I7Y2

[0122] Using blast+ 2.12.0 for... Rhodotorula mucilaginosaSpecific sequence searches were performed on the whole genomes of all isolates in the I7Y2 and NT databases, as well as three other Rhodotorula glutinis isolates from our team. Based on the results obtained from the analysis... Rhodotorula mucilaginosa I7Y2 has a unique sequence that distinguishes it from other yeasts. Primers were designed using Snapgene software to target this specific sequence, yielding the specific molecular target sequence SEQ ID No. 2 for recognizing this bacterium.

[0123] 8.2. Validation of the effectiveness of I7Y2 specific molecule in recognizing targets

[0124] The effectiveness of the specific molecular recognition target sequence of *Rhodotorula glutinis* I7Y2 was verified using polymerase chain reaction (PCR) and agarose gel electrophoresis. Multiple yeast DNAs were used as templates for detection; DNA extraction methods were the same as before. The amplification primer sequences were: X6-F: 5'-AAACAGCATGATTCTTGCCAAC -3' and X6-R: 5'-GTTCAACGGAGAACGTTACCTTC -3'.

[0125] PCR reaction system preparation: 2×PCR Mix, 12.5 μL; X6-F (10 μmol / L), 1 μL; X6-R (10 μmol / L), 1 μL; template DNA (2.5 ng / μL), 1 μL; ddH2O, 9.5 μL;

[0126] PCR reaction conditions: 95℃ for 3 min; 95℃ for 15 s, 53℃ for 20 s, 72℃ for 5 s, for a total of 30 cycles; 72℃ for 5 min; 4℃, ∞.

[0127] After PCR, 5-10 μl of the PCR product was subjected to 1.5% agarose gel electrophoresis. If Rhodotorula glutinis I7Y2 could form a single specific band at 363 bp, while other yeasts could not form a single band at 363 bp, it indicates that the target has good recognition. Rhodotorula mucilaginosa The performance of I7Y2.

[0128] As attached Figure 6 As shown in Table 2, except Rhodotorula mucilaginosa DNA from I7Y2 was amplified using primers X6-F (5'-AAACAGCATGATTCTTGCCAAC -3') and X6-R (5'-GTTCAACGGAGAACGTTACCTTC -3'). A specific 363bp amplification product was formed after amplification, while no specific amplification products were observed in other yeast isolates. This result suggests that the molecular target sequence can be amplified and detected using primers X6-F and X6-R, yielding a single band that can specifically identify the target. Rhodotorula mucilaginosaI7Y2 and other yeasts ( Figure 6 (Table 3).

[0129] Table 3. Amplification results of the I7Y2 detection target on different strains.

[0130] 8.3 Detection of the effectiveness of I7Y2 specific molecule in recognizing targets by real-time quantitative PCR

[0131] The effectiveness and specificity of primers X6-F and X6-R were further verified using quantitative real-time PCR. First, *Rhodotorula glutinis* I7Y2 was cultured in malt extract medium, and DNA was extracted and serially diluted to obtain DNA concentrations of 300, 30, 3, 0.3, 0.03, 0.003, and 0.0003 ng / μL, which served as qPCR standards. Each template was tested in triplicate.

[0132] qPCR reaction system preparation: 2×SYBR Green Premix, 10 μL; X6-F (10 μmol / L), 0.8 μL; X6-R (10 μmol / L), 0.8 μL; template DNA, 2 μL; ddH2O, 6.4 μL.

[0133] qPCR amplification program: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s (40 cycles).

[0134] Figure 7 This is a schematic diagram of the real-time Ct values ​​for qPCR using primers X6-F and X6-R for quantitative detection. Figure 7 A indicates that the concentration of DNA extracted from Rhodotorula glutinis I7Y2 ranges from 0.0003 to 300 ng / μL. The results show that when the concentration of DNA extracted from Rhodotorula glutinis I7Y2 is ≥0.003 ng / μL, the Ct fluorescence curve is relatively stable; therefore, the detection limit of this primer is 0.003 ng / μL.

[0135] Figure 7 B represents the standard curve for this primer. Plotting Ct in qPCR on the ordinate and the logarithm of the bacterial DNA concentration of the standard on the abscissa, the fitted standard curve is y = -3.2386x + 18.547, with R² = 0.9935. Therefore, these two target primers have good specificity and can be used specifically for the detection of Rhodotorula glutinis I7Y2.

[0136] sequence list

[0137] 1. 26S rRNA gene sequence of Rhodotorula glutinis I7Y2

[0138] SEQ ID No.1 AGTCTGCAGGATCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTTGAACCC

[0139] 2. Specific molecular target sequence of Rhodotorula mucilaginosa I7Y2

[0140] SEQ.ID No.2 AAACAGCATGATTCTTGCCAACACTCTAAACATCAAGCAGATGAGCAGTTTCGCAACAAACATTTCGTGAGCTTCCCCTCATCACCTCCCATCAAGTCCTGTTGTTGACAGCTTATACCTGCAGGGAGAGTGGCGTTCTTCAACACCGGTGCATCACGCAAGTCCCGTGGCGGACCAGGACTGCACCGTCATGGATCTCGGATCAGGGCACAGGATGCATCAGCTCGGCTTGCGTCAGTGGCGCATCTACGCGACATGCCCGCATCAGAGGTTGTTTGACGTGTAGCGTTGACCGGGTAAAGGATCTGGACTACAAGCTACGGTTGGCAGGACTCGTTGAGAAGGTAACGTTCTCCGTTGAAC。

Claims

1. A strain of Rhodotorula glutinis ( Rhodotorula mucilaginosa )I7Y2, with accession number GDMCC No:67951.

2. The Rhodotorula glutinis described in claim 1 ( Rhodotorula mucilaginosa Applications of I7Y2 in any of the following: Used as a cell nutrition supplement, it is preferred to improve cell survival in low serum or serum-free conditions; It is used as a cell proliferation promoter, preferably to promote cell proliferation in a low serum or serum-free state; It is used as an anti-apoptotic agent, preferably inhibiting apoptosis in low serum or serum-free conditions; The cell culture medium is preferably a serum-free product.

3. A cell nutrition supplement, cell proliferation promoter, or cell apoptosis inhibitor, characterized in that, It contains the Rhodotorula glutinis I7Y2 as described in claim 1, or its fermentation broth, or the supernatant of the fermentation broth, or Rhodotorula glutinis I7Y2 lysate as active ingredients.

4. A serum-free culture medium for Vero cells, characterized in that, The active ingredient is a yeast strain I7Y2 as described in claim 1, or its fermentation broth, or the supernatant of the fermentation broth, or a lysate of yeast I7Y2.

5. A target nucleotide sequence for identifying the Rhodotorula glutinis I7Y2 as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

2.

6. A primer set for identifying the Rhodotorula glutinis I7Y2 as described in claim 1, characterized in that, include: 5'-AAACAGCATGATTCTTGCCAAC-3' and 5'-GTTCAACGGAGAACGTTACCTTC-3'.

7. A method for identifying the Rhodotorula glutinis I7Y2 according to claim 1, characterized in that, The primer set described in claim 6 is used as the amplification primers to perform PCR amplification of the test bacteria. If a 363bp product is amplified, it is Rhodotorula glutinis I7Y2; if no 363bp product is amplified, it is not Rhodotorula glutinis I7Y2.