A nucleic acid rapid release agent, a preparation method thereof, and a method for rapidly releasing nucleic acid

Abstract

The application discloses a nucleic acid rapid release agent, a preparation method thereof and a nucleic acid rapid release method. The nucleic acid rapid release agent comprises Tris-HCl, EDTA, Triton X-100, Tween-20, other surfactants, DTT, a protein protective agent, other protective agents, KCl, trehalose, glycerol and deionized water. The nucleic acid rapid release agent can be used for rapid release of DNA and / or RNA in an animal sample, and the obtained release product can be directly or simply treated and then used for nucleic acid amplification detection. The nucleic acid rapid release agent can be operated at normal temperature without relying on instruments, and has the advantages of rapid nucleic acid release, small amplification inhibition, good compatibility and wide sample adaptation range. Meanwhile, the nucleic acid release performance of the nucleic acid rapid release agent is superior to that of a commercial nucleic acid release reagent, and the nucleic acid rapid release agent is suitable for rapid sample pretreatment in nucleic acid molecular detection of animal diseases.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to a rapid nucleic acid release agent, its preparation method, and a method for rapidly releasing nucleic acid. Background Technology

[0002] Nucleic acid molecular detection technology, due to its advantages of high sensitivity, strong specificity, and short detection cycle, has been widely used in animal disease diagnosis, pathogen detection, epidemiological monitoring, and related scientific research. In the process of nucleic acid molecular detection, sample pretreatment is a crucial step determining the accuracy and stability of the test results. For animal-derived samples such as nasal swabs, pharyngeal swabs, anal swabs, sputum, saliva, serum, plasma, whole blood, urine, feces, intestinal lavage fluid, and animal tissues, their complex matrix often contains proteins, mucus, lipids, cell debris, nucleases, and other amplification inhibitors. Inadequate pretreatment can adversely affect subsequent nucleic acid amplification and detection.

[0003] Currently, commonly used nucleic acid extraction methods mainly include organic solvent extraction, centrifugation column extraction, and magnetic bead extraction. While these methods can yield nucleic acids with high purity, they generally suffer from drawbacks such as cumbersome operation, long processing time, reliance on equipment, and high cost, making them unsuitable for rapid on-site detection and large-scale sample processing. To simplify the process, existing technologies include rapid lysis or rapid release techniques, but these still have limitations such as significant inhibition of amplification reactions by the lysis products, insufficient adaptability to different animal samples, poor DNA-RNA compatibility, and the continued need for auxiliary equipment.

[0004] Therefore, developing a rapid nucleic acid release agent that is suitable for animal-derived samples, can rapidly release DNA and / or RNA at room temperature, and has good compatibility with subsequent nucleic acid amplification and detection is a problem that this invention urgently needs to solve. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to address the problems existing in the pretreatment of nucleic acid for animal-derived samples, such as cumbersome operation steps, long processing time, dependence on instruments and equipment, significant inhibition of subsequent nucleic acid amplification reactions, insufficient adaptability to different sample types, and poor compatibility between DNA and RNA. Therefore, this invention provides a rapid nucleic acid release agent suitable for animal-derived samples, capable of rapidly releasing DNA and / or RNA under room temperature conditions, and with good compatibility with subsequent nucleic acid amplification detection, as well as its preparation method and method for rapid nucleic acid release.

[0006] To achieve the above objectives, this invention provides a rapid nucleic acid release agent, comprising a buffer module, a nucleic acid protection module, a lysis module, a lysis aid module, an anti-inhibition module, an ion regulation module, a stabilization module, an amplification enhancement module, and a solvent module. The buffer module maintains a suitable pH environment; the nucleic acid protection module reduces the risk of nucleic acid degradation; the lysis module disrupts cell membranes, viral envelopes, and other biological structures to promote nucleic acid release; the lysis aid module further promotes sample lysis and reduces nuclease activity; the anti-inhibition module reduces the adverse effects of inhibitory components in the sample on subsequent nucleic acid amplification reactions; the ion regulation module regulates the ion environment of the system; the stabilization module improves system stability and the preservation performance of released nucleic acid; the amplification enhancement module improves the compatibility of subsequent nucleic acid amplification; and the solvent module provides a liquid dispersion medium.

[0007] Specifically, the buffer module is selected from tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl). The nucleic acid protection module is selected from ethylenediaminetetraacetic acid (EDTA). The pyrolysis module is selected from Triton X-100, Tween-20 and 3-[(3-cholamidopropyl)dimethylammonium]-1-propanesulfonic acid inner salt (CHAPS); The pyrolysis aid module is selected from dithiothreitol (DTT). The anti-inhibition module is selected from bovine serum albumin (BSA) and polyvinylpyrrolidone (PVP). The ion regulation module is selected from potassium chloride (KCl); The stabilizing module is selected from trehalose and glycerol; The amplification enhancement module is selected from betaine; The solvent module is deionized water.

[0008] It should be further noted that CHAPS can be replaced by other surfactants, including but not limited to sodium dodecyl sulfate (SDS) and nonylphenol polyoxyethylene ether (NP-40) surfactants; PVP can be replaced by other protective agents or polymeric additives, including but not limited to polyethylene glycol (PEG) and polyvinyl alcohol (PVA); BSA can be replaced by other protein protective agents, including but not limited to gelatin and casein. In other words, CHAPS is preferred among the other surfactants, PVP is preferred among the other protective agents, and BSA is preferred among the protein protective agents.

[0009] It should be noted that the above description is based on preferred embodiments. In actual operation, the amplification enhancement module (i.e., betaine) can be selectively added or omitted. Regardless of whether the amplification enhancement module is added or not, the prepared nucleic acid rapid release agent can effectively achieve rapid nucleic acid release. Compared with the nucleic acid rapid release agent without betaine, the nucleic acid rapid release agent with the amplification enhancement module can better reflect the detection results in subsequent detection.

[0010] The concentrations of the above reagents can be selected within a wide range. However, to achieve higher nucleic acid release efficiency and avoid significant inhibition, in a preferred embodiment of the present invention, the concentration of tris(hydroxymethyl)aminomethane hydrochloride in the rapid nucleic acid release agent is 10 mmol / L to 50 mmol / L, the concentration of ethylenediaminetetraacetic acid is 0.5 mmol / L to 10 mmol / L, the concentration of Triton X-100 is 0.1 vol% to 2.0 vol%, the concentration of Tween-20 is 0.1 vol% to 2.0 vol%, and the concentration of 3-[(3-cholamidopropyl)dimethyl... The concentration of the inner salt of [-1-propanesulfonic acid] is 0.05 wt% to 1.0 wt%, the concentration of the dithiothreitol is 0.5 mmol / L to 10 mmol / L, the concentration of the bovine serum albumin is 0.05 wt% to 1.0 wt%, the concentration of the polyvinylpyrrolidone is 0.1 wt% to 5.0 wt%, the concentration of the potassium chloride is 10 mmol / L to 200 mmol / L, the concentration of the trehalose is 0.5 wt% to 5.0 wt%, the concentration of the glycerol is 0.5 vol% to 5.0 vol%, and the concentration of the betaine is 0.01 wt% to 2.0 wt%. The balance is deionized water.

[0011] Furthermore, the pH value of the nucleic acid rapid release agent is 7.0–9.0.

[0012] The present invention also provides a method for preparing the rapid nucleic acid release agent as described above. The preparation method includes: mixing a buffer module, a nucleic acid protection module, a lysis module, a lysis aid module, an anti-inhibition module, an ion regulation module, a stabilization module, an amplification enhancement module, and a solvent module, and adjusting the pH value of the system to obtain the rapid nucleic acid release agent.

[0013] Specifically, to further ensure the release effect, the mixing process needs to be carried out in stages, and the mixing process includes: S100. Add the buffer module, nucleic acid protection module, anti-inhibition module, ion regulation module, stabilization module and amplification enhancement module to the solvent module, mix well, and obtain mixture M; S200: Add the pyrolysis module and the pyrolysis aid module to the mixture M in step S100 and continue mixing to obtain mixture N; S300, after adjusting the pH of the mixture N, and bringing the volume to a final volume, a rapid nucleic acid release agent is obtained.

[0014] The present invention also provides a method for rapidly releasing nucleic acid, the method comprising: mixing the nucleic acid rapid release agent as described above with the sample to be tested, thoroughly mixing by pipetting at room temperature, allowing to stand, and then briefly centrifuging to obtain the supernatant as the released nucleic acid solution.

[0015] Preferably, the volume ratio of the rapid nucleic acid release agent to the sample to be tested is 1:1 to 1:10; The settling time should be no less than 3 minutes, preferably 5 minutes.

[0016] In one specific embodiment, the mixing process further includes thoroughly agitating the mixture of the rapid nucleic acid release agent and the test sample at room temperature using a pipette tip at least 20 times.

[0017] The sample to be tested is an animal-derived sample, which is selected from one or more of the following: nasal swabs, pharyngeal swabs, anal swabs, sputum, saliva, serum, plasma, whole blood, urine, feces, intestinal lavage fluid, and animal tissue.

[0018] The above-described method for releasing nucleic acids is used to treat samples before nucleic acid molecular detection. The treated nucleic acid solution can be used directly or after simple treatment for nucleic acid amplification detection. Furthermore, the nucleic acid solution treated with the rapid nucleic acid release agent of the present invention can be used for nucleic acid amplification detection including PCR, RT-PCR, qPCR, RT-qPCR, RAA, and RT-RAA.

[0019] Compared with the prior art, the present invention has the following beneficial effects: 1. The rapid nucleic acid release agent provided by this invention can complete sample processing under normal temperature conditions, without relying on complex instruments and equipment, and is easy to operate, making it suitable for rapid on-site detection and grassroots detection applications; 2. The rapid nucleic acid release agent provided by this invention can achieve rapid release of DNA and / or RNA from animal-derived samples, shorten sample pretreatment time, and improve detection efficiency; 3. This invention, through the synergistic effect of a specially selected buffer module, nucleic acid protection module, lysis module, lysis aid module, anti-inhibition module, ion regulation module, stabilization module, and amplification enhancement module, can reduce the inhibition of the released products on subsequent nucleic acid amplification reactions and improve compatibility with nucleic acid molecular detection technologies such as PCR, RT-PCR, qPCR, RT-qPCR, RAA, and RT-RAA. 4. The rapid nucleic acid release agent provided by this invention is applicable to a wide range of sample types, including swab samples, body fluid samples, excrement samples and tissue samples, and can be widely used for nucleic acid release from animal samples. Attached Figure Description

[0020] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a graph showing the RT-RAA-LFD detection results for Example 1; Figure 2 This is a graph showing the RT-RAA-LFD detection results for Example 2; Figure 3 This is a graph showing the RT-RAA-LFD detection results for example 3; Figure 4 This is a graph showing the RT-RAA-LFD detection results for example 4; Figure 5 This is a graph showing the RT-RAA-LFD detection results for example 5; Figure 6 This is a graph showing the RT-RAA-LFD detection results for example 6. Detailed Implementation

[0021] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0022] Tris-HCl is a commercially available product from Beijing Solarbio Science & Technology Co., Ltd., CAS number 1185-53-1; EDTA is a commercially available product from Beijing Solarbio Science & Technology Co., Ltd., CAS number 6381-92-6; KCl is a commercially available product from Sinopharm Chemical Reagent Co., Ltd., CAS number 7447-40-7; Trehalose is a commercially available product from Sinopharm Chemical Reagent Co., Ltd., CAS number 99-20-7; Glycerin is a commercially available product from Sinopharm Chemical Reagent Co., Ltd., CAS number 56-81-5; Betaine is a commercially available product from Sangon Biotech (Shanghai) Co., Ltd., CAS number 107-43-7; BSA is a commercially available product from Beijing Solarbio Science & Technology Co., Ltd., CAS number 9048-46-8; PVP is a commercially available product from Beijing Solarbio Science & Technology Co., Ltd., CAS number 9003-39-8; Triton... X-100 is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 9002-93-1; Tween-20 is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 9005-64-5; CHAPS is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 75621-03-3; DTT is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 3483-12-3; SDS is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 151-21-3; PEG 8000 is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 25322-68-3; and Gelatin is a commercially available product from Beijing Solarbio Technology Co., Ltd., with CAS number 9000-70-8.

[0023] Positive pharyngeal and anal swab samples for infectious bronchitis virus in chickens were obtained from the laboratory of the School of Veterinary Medicine and Public Health at Jiangsu Vocational College of Agriculture and Animal Husbandry.

[0024] The primer pairs and probes used in this invention were synthesized and provided by Sangon Biotech (Shanghai) Co., Ltd. Example 1

[0025] Add approximately 80% of the final volume of deionized water to the container, then add Tris-HCl, EDTA, KCl, trehalose, glycerol, betaine, BSA, and PVP sequentially, mixing until fully dissolved. Next, add Triton X-100, Tween-20, CHAPS, and DTT, and continue mixing. Adjust the pH to 7.5, then bring the volume to the target level with deionized water, mixing well before use. The final concentrations of Tris-HCl, EDTA, KCl, trehalose, glycerol, betaine, BSA, PVP, Triton X-100, Tween-20, CHAPS, and DTT are shown in Table 1, the concentration table for release agent A. Nucleic acid rapid release agent A is thus prepared. Example 2

[0026] The preparation was carried out according to the method of Example 1, except that the final concentrations of each substance are shown in Table 1 as the concentration table of release agent B. Nucleic acid rapid release agent B was thus obtained. Example 3

[0027] The preparation was carried out according to the method of Example 1, except that the final concentrations of each substance are shown in Table 1 as the concentration table of release agent C. Nucleic acid rapid release agent C was thus obtained. Example 4

[0028] The preparation was carried out according to the method of Example 1, except that the final concentrations of each substance are shown in Table 1 as the concentration table of release agent D. Nucleic acid rapid release agent D was thus obtained. Example 5

[0029] The preparation method of Example 3 was followed, except that the pH of the system was adjusted to 8.0. Nucleic acid rapid release agent E was obtained. Example 6

[0030] The preparation method of Example 3 was followed, except that the pH of the system was adjusted to 8.5. Nucleic acid rapid release agent F was thus obtained.

[0031] Table 1 Components Release agent A Release agent B Release agent C Release agent D Tris-HCl (mM) 10 20 25 50 EDTA (mM) 0.5 1.0 2.0 5.0 Triton X-100 (volume %) 0.2 0.3 0.5 1.0 Tween-20 (volume%) 0.2 0.3 0.5 1.0 CHAPS (by weight%) 0.05 0.1 0.2 0.5 DTT(mM) 0.5 1.0 2.0 5.0 BSA (by weight%) 0.05 0.1 0.2 0.5 PVP (by weight%) 0.2 0.5 1.0 2.0 KCl(mM) 20 35 50 100 Trehalose (by weight) 0.5 1.0 2.0 3.0 Glycerin (volume %) 0.5 1.0 2.0 3.0 Betaine (by weight %) 0.01 0.1 0.5 1.0 Example 7

[0032] The preparation method of Example 5 was followed, except that CHAPS was replaced with sodium dodecyl sulfate (SDS). Nucleic acid rapid release agent G was obtained. Example 8

[0033] The preparation method of Example 5 was followed, except that PVP was replaced with polyethylene glycol (PEG 8000). Nucleic acid rapid release agent H was obtained. Example 9

[0034] The preparation method of Example 5 was followed, except that BSA was replaced with gelatin. Nucleic acid rapid release agent I was obtained. Example 10

[0035] The preparation method of Example 5 was followed, except that betaine was not added, to obtain the rapid nucleic acid release agent J.

[0036] Comparative Example 1 The preparation method of Example 5 was followed, except that betaine and PVP were not added, to obtain nucleic acid release agent D1.

[0037] Comparative Example 2 The preparation method of Example 5 was followed, except that betaine, PVP and DTT were not added, to obtain nucleic acid release agent D2.

[0038] Comparative Example 3 The preparation method of Example 5 was followed, except that betaine, PVP, DTT and CHAPS were not added, to obtain nucleic acid release agent D3.

[0039] Comparative Example 4 Nanjing Wobo Biotechnology Co., Ltd.'s commercially available nucleic acid release agent D4, catalog number BT6008.

[0040] Detection Example 1 Pharyngeal swab samples that have been identified as positive for Infectious Bronchitis Virus (IBV) are collected. The pharyngeal swabs are placed in an EP tube containing 1.0 mL of sterile physiological saline and shaken for 30 seconds to allow the sample to be fully washed. After removing the pharyngeal swabs, they are centrifuged briefly, and the supernatant is used as the sample to be tested.

[0041] The rapid nucleic acid release agent AD prepared in Examples 1-4 above was mixed with the test sample at a volume ratio of 1:4. After thorough mixing by pipetting at room temperature, the mixture was allowed to stand for 5 minutes, followed by brief centrifugation. The supernatant was then used as the released nucleic acid solution. The obtained nucleic acid solution was used for reverse transcription recombinase-mediated isothermal amplification (RT-RAA) of the IBV N gene, and the results were determined using lateral flow chromatography test strips.

[0042] RT-RAA primers and probes were designed based on the IBV whole genome sequence (accession number: MN548289.1) in GenBank, and the primer and probe sequences are shown in Table 2. During the reaction, the final concentration of both primers and probes was 2 μmol / L, and the reaction was carried out in a metal bath at 38℃ for 10 min. 20 μL of the amplification product was mixed with 180 μL of ddH2O, and a lateral flow dipstick (LFD) was inserted into the mixture. Color development was observed after 3 min.

[0043] The results obtained are as follows Figure 1 As shown, test strip A corresponds to nucleic acid rapid release agent A, test strip B corresponds to nucleic acid rapid release agent B, test strip C corresponds to nucleic acid rapid release agent C, and test strip D corresponds to nucleic acid rapid release agent D. Through Figure 1It can be seen that, with the increase of the concentration of each component in the formulation, the T-line color development of LFD detection gradually increased after RT-RAA amplification of samples treated with nucleic acid rapid release agent A, nucleic acid rapid release agent B, and nucleic acid rapid release agent C; while the T-line color development of LFD detection was significantly weakened after RT-RAA amplification of samples treated with nucleic acid rapid release agent D. These results indicate that increasing the concentration of each component within a certain range is beneficial for nucleic acid release, but when the component concentration is too high, it may inhibit the subsequent amplification reaction.

[0044] Table 2 Primer and probe names Sequence (5'-3') RAA-NF1 (SEQ ID No: 1) AACCTTACACCTAGCCCACATGCTTGTCTT RAA-NR1 (SEQ ID No: 2) (Biotin)TTGTAGCAGGTCTTGAACTTGAGCGTGATT RAA-NP1 (SEQ ID No: 3) (FAM)ACTACTGTGGTGCCTAGAGATGACCCCGCAG(THF)TTTGATAATTATGTA(C3 Spacer)

[0045] Detection Example 2 The procedure was performed according to the method in Example 1, except that the nucleic acid release agents used were rapid nucleic acid release agents C, E, and F.

[0046] The results obtained are as follows Figure 2 As shown, test strip A corresponds to nucleic acid rapid release agent C, test strip B corresponds to nucleic acid rapid release agent E, and test strip C corresponds to nucleic acid rapid release agent F. Through... Figure 2 It can be seen that the release effect of the rapid nucleic acid release agent is not significantly different under pH 7.5, 8.0 and 8.5 conditions, and there is no significant difference in the T line color development of LFD detection. Among them, pH 8.0 and 8.5 are slightly better than pH 7.5.

[0047] Detection Example 3 The procedure was performed according to the method in Example 1, except that the nucleic acid rapid release agent E was mixed with the test sample at volume ratios of 1:1, 1:3, 1:4 and 1:9, respectively.

[0048] The results obtained are as follows Figure 3 As shown, test strip A has a volume ratio of 1:1, test strip B has a volume ratio of 1:3, test strip C has a volume ratio of 1:4, and test strip D has a volume ratio of 1:9. (The last sentence appears to be incomplete and possibly refers to a different test strip.) Figure 3 It can be seen that when the volume ratio of the rapid nucleic acid release agent to the test sample in Example 1 is 1:1, 1:3 and 1:4, the T-line color development effect of LFD detection is significantly better than that of 1:9, indicating that too low a dosage of the rapid nucleic acid release agent will affect the nucleic acid release effect.

[0049] Detection Example 4 The procedure was performed according to the method in Example 1, except that the nucleic acid release agents used were the rapid nucleic acid release agent E in Example 5, the rapid nucleic acid release agent G in Example 7, the rapid nucleic acid release agent H in Example 8, and the rapid nucleic acid release agent I in Example 9.

[0050] The results obtained are as follows Figure 4As shown, test strip A corresponds to the test result after treatment with nucleic acid rapid release agent E, test strip B corresponds to the test result after treatment with nucleic acid rapid release agent G, test strip C corresponds to the test result after treatment with nucleic acid rapid release agent H, and test strip D corresponds to the test result after treatment with nucleic acid rapid release agent I.

[0051] pass Figure 4 It can be seen that test strip A exhibits the strongest T-line color development; the T-line color development of test strips B and C is significantly weakened, and their color intensity is similar; the T-line color development of test strip D is weaker than that of test strip A, but stronger than that of test strips B and C. These results indicate that the selection of CHAPS, PVP, and BSA in the rapid nucleic acid release agent E is significantly superior. CHAPS and PVP have a more significant effect on improving nucleic acid release efficiency and subsequent LFD detection signal, while BSA also helps to further enhance the detection effect.

[0052] Case 5 The procedure was performed according to the method in Example 1, except that the nucleic acid release agents used were the rapid nucleic acid release agent E in Example 5, the rapid nucleic acid release agent J prepared in Example 10, the nucleic acid release agent D1 prepared in Comparative Example 1, the nucleic acid release agent D2 prepared in Comparative Example 2, and the nucleic acid release agent D3 prepared in Comparative Example 3.

[0053] The results obtained are as follows Figure 5 As shown, test strip A corresponds to the test result after treatment with nucleic acid rapid release agent E, test strip B corresponds to the test result after treatment with nucleic acid rapid release agent J, test strip C corresponds to the test result after treatment with nucleic acid release agent D1, test strip D corresponds to the test result after treatment with nucleic acid release agent D2, and test strip E corresponds to the test result after treatment with nucleic acid release agent D3.

[0054] pass Figure 5 It can be seen that the T line of test strip A shows the strongest color development; the T line of test strip B shows a significant decrease in color development; the T line of test strip C shows a further decrease in color development; the T line of test strip D shows an even weaker color development; and the T line of test strip E shows almost no color development. These results indicate that in nucleic acid rapid release agent E, PVP, DTT, and CHAPS all play important roles in nucleic acid release and subsequent LFD detection signals, and there is a synergistic effect among these components. As the concentrations of PVP, DTT, and CHAPS decrease sequentially, the color development of the T line on the test strip gradually weakens until it disappears, indicating that the excellent detection effect of nucleic acid rapid release agent E depends on the combined action of these key functional components. Furthermore, comparing bands A and B shows that the preferred embodiment with added betaine exhibits a stronger color reaction than the general embodiment without added betaine, better reflecting the detection results.

[0055] Case 6 The procedure was performed according to the method in Example 1, except that the nucleic acid release agents used were the rapid nucleic acid release agent E in Example 5 and the commercially available nucleic acid release agent D4 in Comparative Example 4, and the samples used for testing included pharyngeal swab samples and anal swab samples identified as IBV.

[0056] The results obtained are as follows Figure 6 As shown, test strip A corresponds to a throat swab sample treated with nucleic acid rapid release agent E; test strip B corresponds to a throat swab sample treated with commercially available nucleic acid release agent D4; test strip C corresponds to an untreated throat swab sample (as a control); test strip D corresponds to an anal swab sample treated with nucleic acid rapid release agent E; test strip F corresponds to an anal swab sample treated with commercially available nucleic acid release agent D4; and test strip F corresponds to an untreated anal swab sample (as a control). Figure 6 It can be seen that, for both pharyngeal swab samples and anal swab samples, the T-line color development of LFD detection after treatment with the nucleic acid rapid release agent of the present invention is significantly better than that of commercial nucleic acid release agent D4, indicating that the nucleic acid rapid release agent of the present invention has a better nucleic acid release effect.

[0057] As can be seen from the above embodiments and comparative examples, the nucleic acid rapid release agent provided by this invention, through the rational combination of various functional modules, achieves rapid release of nucleic acids from animal-derived samples and improves the compatibility of the released samples with subsequent nucleic acid amplification and detection systems. An optimal rapid nucleic acid release system was obtained by optimizing the formulation ratio, pH, and the ratio of the release agent to the sample. The results of the embodiments further verify the application effect of this release agent in IBV-positive pharyngeal swab samples and anal swab samples, indicating that its nucleic acid release performance is superior to commercial nucleic acid release reagents and is suitable for rapid sample pretreatment in the molecular detection of animal diseases.

[0058] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0059] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0060] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A rapid nucleic acid release agent, characterized in that, The rapid nucleic acid release agent comprises a buffer module, a nucleic acid protection module, a lysis module, a lysis aid module, an anti-inhibition module, an ion regulation module, a stabilization module, and a solvent module; wherein, The buffer module includes tris(hydroxymethyl)aminomethane hydrochloride; The nucleic acid protection module includes ethylenediaminetetraacetic acid; The pyrolysis module includes at least Triton X-100, Tween-20, and other surfactants; The pyrolysis aid module includes dithiothreitol; The anti-inhibition module includes protein protectants and other protectants; The ion regulation module includes potassium chloride; The stabilizing module includes trehalose and glycerol; The solvent module is deionized water; and... The other surfactants are selected from one or more of 3-[(3-cholamidopropyl)dimethylammonium]-1-propanesulfonic acid inner salt, sodium dodecyl sulfate, and nonylphenol polyoxyethylene ether; The protein protectant is selected from one or more of bovine serum albumin, gelatin, and casein; The other protective agents are selected from one or more of polyvinylpyrrolidone, polyethylene glycol, and polyvinyl alcohol.

2. The rapid nucleic acid release agent according to claim 1, characterized in that, In the nucleic acid rapid release agent, the concentration of tris(hydroxymethyl)aminomethane hydrochloride is 10 mmol / L to 50 mmol / L, the concentration of ethylenediaminetetraacetic acid is 0.5 mmol / L to 10 mmol / L, the concentration of Triton X-100 is 0.1 vol% to 2.0 vol%, the concentration of Tween-20 is 0.1 vol% to 2.0 vol%, the concentration of other surfactants is 0.05 wt% to 1.0 wt%, the concentration of dithiothreitol is 0.5 mmol / L to 10 mmol / L, the concentration of protein protectant is 0.05 wt% to 1.0 wt%, the concentration of other protectants is 0.1 wt% to 5.0 wt%, the concentration of potassium chloride is 10 mmol / L to 200 mmol / L, the concentration of trehalose is 0.5 wt% to 5.0 wt%, and the concentration of glycerol is 0.5 vol% to 5.0 vol%.

3. The rapid nucleic acid release agent according to claim 1 or 2, characterized in that, The rapid nucleic acid release agent also includes an amplification enhancement module; Preferably, the amplification enhancement module is selected from betaine, and the concentration of betaine in the nucleic acid rapid release agent is 0.01% to 2.0% by weight. More preferably, the other surfactant is selected from 3-[(3-cholamidopropyl)dimethylammonium]-1-propanesulfonic acid inner salt; The protein protectant is selected from bovine serum albumin; The other protective agent is selected from polyvinylpyrrolidone.

4. The rapid nucleic acid release agent according to claim 1 or 2, characterized in that, The pH value of the rapid nucleic acid release agent is 7.0 to 9.

0.

5. A method for preparing a rapid nucleic acid release agent as described in any one of claims 1-4, characterized in that, The preparation method includes: mixing a buffer module, a nucleic acid protection module, a lysis module, a lysis aid module, an anti-inhibition module, an ion regulation module, a stabilization module, and a solvent module, and then adjusting the pH value of the system to obtain the rapid nucleic acid release agent; Preferably, the preparation method further includes mixing with an amplification enhancement module.

6. The preparation method according to claim 5, characterized in that, The mixing process includes: S100. Add the buffer module, nucleic acid protection module, anti-inhibition module, ion regulation module and stabilization module to the solvent module, mix well, and obtain mixture M; S200: Add the pyrolysis module and the pyrolysis aid module to the mixture M in step S100 and continue mixing to obtain mixture N; S300, after adjusting the pH of the mixture N, bring the volume to a final volume to obtain a rapid nucleic acid release agent; Preferably, step S100 further includes adding an amplification enhancement module for mixing.

7. A method for rapidly releasing nucleic acids, characterized in that, The method includes: mixing the rapid nucleic acid release agent as described in any one of claims 1-4 with the sample to be tested, allowing it to stand and then centrifuging briefly, and the resulting supernatant is the released nucleic acid solution.

8. The method according to claim 7, characterized in that, The volume ratio of the rapid nucleic acid release agent to the sample to be tested is 1:1 to 1:

10.

9. The method according to claim 7 or 8, characterized in that, The mixing process also includes thoroughly blowing the mixture of the rapid nucleic acid release agent and the test sample into the liquid at room temperature using a pipette tip at least 20 times; Let it stand for at least 3 minutes.

10. The method according to claim 7 or 8, characterized in that, The test sample is selected from one or more of the following: nasal swab, pharyngeal swab, anal swab, sputum, saliva, serum, plasma, whole blood, urine, feces, intestinal lavage fluid, and animal tissue.

Images