Specific ginseng-derived nucleic acid molecule sequences and their use as pdrn

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to specific ginseng-derived nucleic acid molecule sequences and application thereof as PDRN. The ginseng-derived polydeoxyribonucleotide provided by the application is a ginseng-derived nucleic acid molecule with a specific sequence, which is rationally designed and chemically synthesized, and does not need to rely on extraction of natural ginseng tissues, thereby solving the problems of low extraction efficiency and high cost of plant-derived PDRN. Moreover, the PDRN material prepared from the ginseng-derived polydeoxyribonucleotide has low cytotoxicity, can effectively promote and improve skin inflammation, promote vascular formation, and significantly promote collagen synthesis in cells, and has a wide application prospect.

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, specifically involving specific ginseng-derived nucleic acid molecular sequences and their application as PDRN. Background Technology

[0002] Polydeoxyribonucleotides (PDRNs) are small fragments of DNA obtained through degradation, typically ranging in molecular weight from 50 to 1500 kDa. Since the 1950s, research on the pharmacological activity of PDRNs has deepened, and their ability to accelerate DNA synthesis has been gradually confirmed. As a natural skin protectant and repair agent, PDRNs possess various cosmetic and repairing effects, including sun protection, anti-inflammation, promotion of cell regeneration, tissue repair, accelerated wound healing, reduction of scar formation, and wrinkle reduction. They are now widely used in pharmaceuticals and cosmetic products.

[0003] In traditional techniques, PDRN sources primarily include animal-derived materials such as salmon sperm and mammalian cells. In recent years, with the continuous improvement of regulations on marine pollution and wildlife resource protection, the use of wild salmon or trout as PDRN sources has become restricted; while artificial breeding also faces problems such as high costs, technical difficulties, and long cycles. At the same time, animal-derived PDRN carries the potential risk of carrying pathogens, posing certain safety concerns. Therefore, finding safe, efficient, and inexpensive PDRN sources has become an urgent problem to be solved in this field.

[0004] Plant-derived PDRN offers greater safety compared to traditional animal-derived PDRN: it is virtually non-toxic to human skin cells, can be applied at higher concentrations, and offers greater application flexibility. Furthermore, plant-derived PDRN demonstrates outstanding capabilities in anti-inflammation, skin repair, and wound healing. However, the industrialization of plant-derived PDRN faces significant bottlenecks: the extremely low PDRN content in plant tissues leads to complex extraction processes, low extraction efficiency, and poor economic viability; simultaneously, the high sequence randomness and uneven molecular weight distribution of the extracted PDRN products directly affect the reproducibility of their effects in applications, and significant quality differences exist between different batches of products.

[0005] It is evident that, although plant-derived PDRN has advantages over animal-derived PDRN, such as lower toxicity to human skin cells and the ability to be applied at high concentrations, the inherent technical defects of the extraction methods described above severely limit the development and application of high-quality ginseng-derived PDRN.

[0006] Therefore, it is necessary to develop a ginseng PDRN that is different from directly extracted and can be prepared with a specific sequence. Summary of the Invention

[0007] Based on this, one embodiment of this application provides ginseng-derived specific sequence polydeoxyribonucleotides, their preparation methods, and applications.

[0008] This application provides a ginseng-derived polydeoxyribonucleotide, the nucleotide sequence of which is shown in any one of SEQ ID NO.1-SEQ ID NO.12.

[0009] This application also provides a carrier comprising the aforementioned ginseng-derived polydeoxyribonucleotide;

[0010] In some embodiments, the skeleton of the carrier includes pUC18.

[0011] In another aspect, this application provides a cell containing the ginseng-derived polydeoxyribonucleotide or the carrier described above;

[0012] In some of these embodiments, the cells comprise Escherichia coli.

[0013] This application also provides a method for preparing the aforementioned ginseng-derived polydeoxyribonucleotides, comprising:

[0014] Using a recombinant vector containing the ginseng-derived polydeoxyribonucleotide as a template, PCR amplification was performed using primers capable of amplifying the ginseng-derived polydeoxyribonucleotide to obtain the amplification product; and the amplification product was purified.

[0015] In some of these embodiments, the primers used for PCR amplification are shown in SEQ ID NO.13-SEQ ID NO.36.

[0016] This application also provides a method for preparing the aforementioned ginseng-derived polydeoxyribonucleotides.

[0017] SEQ ID NO.13-SEQ ID NO.14 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.1;

[0018] SEQ ID NO.15-SEQ ID NO.16 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.2;

[0019] SEQ ID NO.17-SEQ ID NO.18 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.3;

[0020] SEQ ID NO.19-SEQ ID NO.20 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.4;

[0021] SEQ ID NO.21-SEQ ID NO.22 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.5;

[0022] SEQ ID NO.23-SEQ ID NO.24 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.6;

[0023] SEQ ID NO.25-SEQ ID NO.26 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.7;

[0024] SEQ ID NO.27-SEQ ID NO.28 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.8;

[0025] SEQ ID NO.29-SEQ ID NO.30 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.9;

[0026] SEQ ID NO.31-SEQ ID NO.32 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.10;

[0027] SEQ ID NO.33-SEQ ID NO.34 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.11;

[0028] SEQ ID NO.35-SEQ ID NO.36 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.12.

[0029] This application also provides a method for constructing the aforementioned cells, comprising:

[0030] The step of introducing the ginseng-derived polydeoxyribonucleotide or the carrier into the cells to be modified.

[0031] This application also provides the use of the ginseng-derived polydeoxyribonucleotides, the carrier, and the cells in the preparation of products that promote skin repair, angiogenesis, or collagen synthesis.

[0032] In some embodiments, the product includes cosmetics.

[0033] This application also provides a cosmetic product comprising: the ginseng-derived polydeoxyribonucleotide as an active ingredient; and a cosmetically acceptable carrier.

[0034] In some embodiments, the cosmetically acceptable carrier includes one or more of glycerin, hyaluronic acid, squalane, and shea butter.

[0035] The ginseng-derived polydeoxyribonucleotides provided in this application are ginseng-derived nucleic acid molecules with specific sequences that are rationally designed and chemically synthesized, without relying on extraction from natural ginseng tissue, thus solving the problems of low extraction efficiency and high cost of plant-derived PDRNs. Furthermore, the PDRN materials prepared by the ginseng-derived polydeoxyribonucleotides of this application have low cytotoxicity, can effectively promote the improvement of skin inflammation, promote angiogenesis, and can significantly promote collagen synthesis in cells, thus having broad application prospects. Attached Figure Description

[0036] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 This is a schematic diagram of the structure of the recombinant plasmid pUC-PgPDRN in the embodiments of this application.

[0038] Figure 2 This is an agarose gel electrophoresis image of the recombinant strain in the embodiments of this application, used for PCR verification of the bacterial culture.

[0039] Figure 3 This is an agarose gel electrophoresis image of the PCR product prepared from PDRN material in the embodiments of this application.

[0040] Figure 4 This is a bar chart showing the cytotoxicity test results of PDRN samples against HaCaT cells in the embodiments of this application.

[0041] Figure 5 This is a bar chart showing the efficacy test results of PDRN samples in promoting VEGF production in HaCaT cells in the embodiments of this application.

[0042] Figure 6 This is a bar chart showing the test results of the efficacy of PDRN samples in promoting the synthesis of type I collagen in HSF cells in the embodiments of this application. Detailed Implementation

[0043] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0044] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0045] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0046] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0047] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0048] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0049] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0050] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0051] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0052] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0053] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0054] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0055] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0056] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0057] This application aims to address the problems of random product sequences, non-uniform molecular weights, batch-to-batch quality instability, low production efficiency, high costs, and potential safety risks associated with the preparation of PDRN using traditional extraction methods. To this end, this invention provides a novel technical approach that utilizes genetic engineering methods to produce ginseng-derived recombinant nucleic acid molecules with determined sequences, uniform molecular weights, stable quality, high safety, and clearly defined biological activity.

[0058] This application provides a ginseng-derived polydeoxyribonucleotide, wherein the nucleotide sequence of the ginseng-derived polydeoxyribonucleotide is selected from one or more of SEQ ID NO.1-SEQ ID NO.12.

[0059] This application uses the whole genome sequence information of ginseng (Panax ginseng) published in the NCBI public database (e.g., version number GCA_020205605.1) as the data source and employs bioinformatics analysis methods to scan the genome. To screen for specific DNA sequence fragments with potential PDRN biological activity, specific screening criteria were established, such as prioritizing regions located in the non-coding region of the genome, rich in purine bases, and conforming to the known physicochemical characteristics of active PDRNs. In some embodiments, the screening parameters can be set as follows: fragment length between 250-1500 bp and GC content between 20-40%. This GC content range is close to the GC content levels of the human genome and natural salmon PDRN, which is beneficial for improving the biocompatibility of the obtained nucleic acid molecules.

[0060] Or a sequence that is at least 80% (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9%) identical to any one of SEQ ID NO.1-SEQ ID NO.12.

[0061] "Identity" refers to the sequence similarity between two polynucleotide sequences or two polypeptides. When positions in two compared sequences are occupied by the same base or amino acid monomer subunit—for example, if every position in two DNA molecules is occupied by adenine—then the molecules are homologous at that position. The percentage of identity between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared multiplied by 100. For example, in optimal sequence alignment, if 6 out of 10 positions in two sequences match or are homologous, then the two sequences are 60% homologous; if 95 out of 100 positions in two sequences match or are homologous, then the two sequences are 95% homologous. Typically, comparisons are made when aligning two sequences to give the maximum percentage of identity. For example, comparisons can be performed using the BLAST algorithm, where the algorithm's parameters are chosen to give the maximum match between the sequences over the entire length of each reference sequence. The following references relate to the BLAST algorithm frequently used in sequence analysis: BLAST algorithm (BLAST ALGORITHMS): Altschul, S.F. et al., (1990) J. Mol. Biol. 215:403 410; Gish, W. et al., (1993) Nature Genet. 3:266 272; Madden, T.L. et al., (1996) Meth. Enzymol. 266:131 141; Altschul, S.F. et al., (1997) Nucleic Acids Res. 25:3389 3402; Zhang, J. et al., (1997) Genome Res. 7:649 656. Other common BLAST algorithms, such as those provided by NCBI BLAST, are also well-known to those skilled in the art.

[0062] The biological activity of ginseng-derived polydeoxyribonucleotides is preserved through amino acid substitution (“conservative modification” or “conservative replacement or substitution”). For example, one amino acid may be replaced by another, or one amino acid may be replaced by multiple amino acids (e.g., 2, 3, 4, 5, or 6). Amino acid substitution refers to the replacement of an amino acid with an amino acid of similar or related properties, as shown in Table 1.

[0063] Table A

[0064]

[0065] "Conservative modification" or "conservative substitution" refers to the replacement of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation, and rigidity), allowing for frequent alterations without changing the protein's biological activity. Those skilled in the art will recognize that, in general, the substitution of a single amino acid in a non-essential region of a polypeptide does not substantially alter its biological activity (see, for example, Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th edition)). Furthermore, substitutions of structurally or functionally similar amino acids are unlikely to disrupt biological activity.

[0066] This application also provides a carrier comprising the aforementioned ginseng-derived polydeoxyribonucleotide.

[0067] In some embodiments, the skeleton of the carrier includes pUC18.

[0068] The terms “vector,” “expression vector,” and “recombinant expression vector” refer to linear or circular DNA molecules that contain polynucleotides encoding variants and are operatively linked to a control sequence that provides the means for their expression.

[0069] The recombinant expression vectors involved in this application comprise nucleotides encoding variants of this application, a promoter, and transcription and translation termination signals. Various nucleotides and control sequences can be linked together to produce a recombinant expression vector, which may contain one or more suitable restriction sites to allow the insertion or substitution of polynucleotides encoding variants at such sites. Alternatively, polynucleotides can be expressed by inserting the polynucleotide or a nucleic acid construct containing the polynucleotide into a suitable expression vector. In creating the expression vector, the coding sequence is located within the vector such that the coding sequence is operatively linked to suitable control sequences for expression.

[0070] Recombinant expression vectors can be any vector (e.g., plasmids or viruses) that can readily undergo recombinant DNA processes and enable the expression of polynucleotides. The choice of vector will generally depend on its compatibility with the host cell into which it will be introduced. Vectors can be linear plasmids or closed circular plasmids.

[0071] The vector can be a self-replicating vector (i.e., a vector existing as an extrachromosomal entity) whose replication is independent of chromosome replication, such as a plasmid, extrachromosomal element, small chromosome, or artificial chromosome. The vector may contain any means to ensure self-replication. Alternatively, the vector may be such that, upon introduction into a host cell, it integrates into the genome and replicates along with the chromosome (in which the vector is already integrated). Furthermore, a single vector or plasmid, or two or more vectors or plasmids, may be used, collectively containing a transposon or the entire DNA to be introduced into the host cell genome. Vectors contemplated for use with the methods of this application include integrating and non-integrating vectors.

[0072] In some embodiments, the vector contains one or more optional markers that allow for easy selection of cells for transformation, transfection, transduction, etc. Optional markers are genes whose products provide resistance to biocides or viruses, heavy metal resistance, prototrophic and auxotrophic traits, etc. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Optional markers for filamentous fungal host cells include, but are not limited to, amdS (acetamipase), argB (ornithine carbamoyltransferase), bar (phosphinicotinic acid acetyltransferase), hph (oxytetracycline phosphotransferase), niaD (nitrate reductase), PYRG (guanosine-5′-phosphate decarboxylase), sC (adenosyl sulfate transferase), and trpC (formate synthase), and their equivalents. Preferred genes for Aspergillus cells are the amdS and pyrG genes from *Aspergillus nidus* or *Aspergillus oryzae*, and the bar gene from *Streptomyces* hygroscopic species.

[0073] In some embodiments, the vector includes one or more elements that allow the vector to be integrated into the host cell genome or to replicate autonomously within the cell independently of the genome.

[0074] Regarding integration into the host cell genome, the vector may rely on a polynucleotide sequence encoding a variant or any other element of the vector (for integration into the genome via homologous or non-homologous recombination). Alternatively, the vector may contain additional polynucleotides to guide integration into the host cell genome at one or more precise locations on one or more chromosomes via homologous recombination. To increase the likelihood of integration at precise locations, the integrative element should contain sufficient nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, that have high sequence identity with the corresponding target sequence to enhance the likelihood of homologous recombination. The integrative element can be any sequence homologous to the target sequence in the host cell genome. Furthermore, the integrative element can be a non-coding or coding polynucleotide. On the other hand, the vector may integrate into the host cell genome via non-homologous recombination.

[0075] In another aspect, this application provides a cell comprising the ginseng-derived polydeoxyribonucleotide or the carrier described above;

[0076] In some of these embodiments, the cells comprise Escherichia coli.

[0077] The term "cell," also known as "host cell," refers to a cell into which an expression vector has been introduced. Host cells can include bacterial, microbial, plant, or animal cells. Easily transformable bacteria include members of the Enterobacteriaceae family, such as strains of Escherichia coli or Salmonella; members of the Bacillaceae family, such as Bacillus subtilis; Pneumococcus; Streptococcus; and Haemophilus influenzae. Suitable microorganisms include Saccharomyces cerevisiae and Pichia pastoris. Suitable animal host cell lines include CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, or HEK293 cells.

[0078] The terms “cell,” “cell line,” and “cell culture” used in this application are used interchangeably, and all such names include progeny. Therefore, “transformant” and “transformed cell” include primary test cells and cultures derived therefrom, regardless of passage number. It should also be understood that, due to intentional or unintentional mutations, all progeny may not be exactly identical in DNA content. This includes mutant progeny with the same function or biological activity as those screened from the original transformed cells.

[0079] This application also provides a method for preparing the aforementioned ginseng-derived polydeoxyribonucleotides, comprising:

[0080] Using a recombinant vector containing the aforementioned ginseng-derived polydeoxyribonucleotides as a template, PCR amplification was performed using primers capable of amplifying the aforementioned ginseng-derived polydeoxyribonucleotides to obtain the amplification product; and

[0081] The amplification product was purified;

[0082] In some of these embodiments, the primers used for PCR amplification are shown in SEQ ID NO.13-SEQ ID NO.36.

[0083] SEQ ID NO.13-SEQ ID NO.14 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.1;

[0084] SEQ ID NO.15-SEQ ID NO.16 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.2;

[0085] SEQ ID NO.17-SEQ ID NO.18 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.3;

[0086] SEQ ID NO.19-SEQ ID NO.20 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.4;

[0087] SEQ ID NO.21-SEQ ID NO.22 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.5;

[0088] SEQ ID NO.23-SEQ ID NO.24 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.6;

[0089] SEQ ID NO.25-SEQ ID NO.26 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.7;

[0090] SEQ ID NO.27-SEQ ID NO.28 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.8;

[0091] SEQ ID NO.29-SEQ ID NO.30 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.9;

[0092] SEQ ID NO.31-SEQ ID NO.32 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.10;

[0093] SEQ ID NO.33-SEQ ID NO.34 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.11;

[0094] SEQ ID NO.35-SEQ ID NO.36 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.12.

[0095] In some embodiments, the method for constructing the cells includes the step of introducing the ginseng-derived polydeoxyribonucleotides or the vector into the cells to be modified.

[0096] This application also provides the use of the ginseng-derived polydeoxyribonucleotides, the carrier, and the cells in the preparation of products that promote skin repair, angiogenesis, or collagen synthesis.

[0097] In some embodiments, the product includes cosmetics.

[0098] This application also provides a cosmetic product comprising: the ginseng-derived polydeoxyribonucleotide as an active ingredient; and a cosmetically acceptable carrier.

[0099] In some embodiments, the cosmetically acceptable carrier includes one or more of glycerin, hyaluronic acid, squalane, and shea butter.

[0100] In some embodiments, the product also includes physiologically acceptable excipients.

[0101] In some embodiments, the excipients may be suitable solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, chelating agents, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, release inhibitors, etc.

[0102] In some embodiments, the products of this application can be prepared using general methods, wherein one or more diluents or carriers may be added. The products of this application can be prepared into any formulation commonly prepared in this field. For example, it can be formulated into creams, lotions, masks, foundations, medical devices, hair cosmetics, and other formulations. Specifically, skin lotions, skin softeners, hyaluronic acid injections, skin toners, astringents, lotions, moisturizing lotions, nourishing lotions, massage creams, nourishing creams, moisturizing creams, hand creams, foundations, serums, nourishing essences, masks, soaps, cleansing foams, cleansing milks, cleansing creams, lotions, or shower gels.

[0103] In some embodiments, the product of this application may also contain other ingredients commonly formulated in cosmetics, as needed. These may include, for example, oils, moisturizers, surfactants, organic pigments, inorganic pigments, UV absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, blood circulation enhancers, cooling agents, antiperspirants, or may be mixed with purified water.

[0104] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0105] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0106] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0107] Example 1

[0108] The preparation steps of ginseng-derived polydeoxyribonucleotides provided in this application include:

[0109] I. Sequence Selection

[0110] In this embodiment, ginseng (P. ginseng) genome assembly information (version number: GCA_020205605.1) was downloaded from the public database NCBI (National Center of Biotechnology Information). Genome nucleic acid sequence fragments were randomly selected and extracted, requiring fragment lengths between 250-1500 bp and GC content between 20-40% (close to the GC content levels of human genomes and naturally extracted salmon PDRN). This yielded 12 target sequences, the sequence information of which is shown in SEQ ID NO.1-SEQ ID NO.12.

[0111] >SEQ ID NO:1 PgPDRN1

[0112] GGAGCTATGGTTGCACTTATTCATGAATATTAAAGTTTGCTACTTTAAAAGTAAGTTAATTTACTTTCCATAATGTAGTTGTGGATGTTAAAGCAGACAACTGAATCCTTGAGTGTCTTAATGTAATTGAGTTAAATAACATGGTCAATGGAACAAGTTGAAAACCGTCGACTAAAATATTTACTTTGCTCAAGGATTTGGCTAAAATGTATATTTTTACCACGTCTA TTTTGTTACCCCTTGGTCAAGGAAAAGGGCATCATCAAGGCACAAAGGCGAGGAGGACTTTTCTGGTCTAATAAGTGAGGCAACCTCTTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTGTAGGATTTTATCGCATCTTATTTCATATATTTACATGTAACAAGAGAATCAAAGGCATACCTCTTGAAGTGTG

[0113] >SEQ ID NO:2 PgPDRN2

[0114] GTACTAGATACTTACAAACTCGAAAGTGCTCCAATTGCGTTCACAACCGGAAGAAGAACAACAAAGGCCGAGGATTCGCTTTGCAAACTTTGTAAGCTCAATAGCACAACCACCAAATGCATTCCACCAATCAACTACATTAGATGTAAAAAATAAAAAAAATCAAATATAGTCTTAATTATTAAACTTAAAAGAAAAATTTATAGTTAATGTAATATGCTTACTAGGATTTTTTGTCTTTCGTTCTTTAACCGCCATGTCTTTAGAA

[0115] >SEQ ID NO:3 PgPDRN3

[0116] ATGGTTTTGACATGCCGTGAAAGAGGGCCCTCCCAACAAGGTGAATAAAAACTGAAAATCAAATGGAATTTGGAACCGTTGGGTATTTGTTTTGGGCTGGGCCGAGCCGGTAGCTTGTATCATGTTTTTTTTTTTGCTAAATACAGGATGATATTATTATTTGAAATTATTTTGTATAATATTTTTATAATTATATTGAATTCATACCAACCCATATTAGCTAAAAAATAACATATCAATCCATCATTTAAGATTGTGTTATCTTTCAATCTCAAATAATGTATTATTATTACGTAATCGAATAATATATCTCATAAATATAATTAATTAATTATGTTATTTACGGTCACATCATTTAAGATTTTTTAGTCATGTTTTTAACGTATCTAGATCCTTCCTCAATAGAAGATGGCCACCAATCCATCACCAATTCTCATAAACACCTGGCCCCACCATGTACCTTCAGTGATTGGAACCT GTGGTGGAGTTTTGAGATTTGTCTTTAGGAGTTGTTAAACAGTATGGAGAAAATGAATATGGCCCACCACTATATTAAAACCAAACAAATATAAGTCATGGCAGAAAGTGGGACAATTCCATCCACGATATTAGGGTCAGATGCCCAAAATATCTGCAACTTTCAATTCCTCTTCAGAAAGCTTATAAATCTATTTGTCATTGATGGGGGTATTTGGTTTGGTTATAATATTAGATTGAGAATGAGAATGAATAGAATAGATATTTTTTATTTTTTTGTTTGGTCCTATTGATATTTTTCTTTAAGTTTATCGATCAAAATAAAAATGATCAATCTTTAGAATAAGTATTTTTTTAACTAAATAATTAAACATTCCATTGAAATGTCCCTTTTAAGTAACCAAAAATAAAAGAATAAATATTCCAAAAGATTGCTCATTCCATTCCCCAAAACCAAATAACAGCCCATAACGTTTCCAAGT

[0117] >SEQ ID NO:4 PgPDRN4

[0118] AGATCGTTGGATGTTGAAGCCTAAATTGATTTGAAAGTAGTTGGATGTTGAAGCCTTGGGATTTGAGTCACTCTCTGATTTATATTATAGACTATAGATATATAAAATAAAATAAAATGCCCTTACCCAAGAATTACAATTTTTTAATAATAATAATAAATCCATAAAATCTATCAAAACCAATGATGATCTTAAATTGTAATAACCAATGACGGTTGTTGTTGAGCATTTCTCACGTTGTGTACTTACTGCAGACGGACCCGATAGTAAAAGTCTCTTGCATTTGGTGTATCAAAGA

[0119] >SEQ ID NO:5 PgPDRN5

[0120] TAGTAGCAGCTCAAGATCAACATGAAACACGCAGATTGACAAGATACCAGATTTGGGGGTGTCAATTCTAACTATCTTTACAAAACTATTTAATTTAAATAGAAACCTTGATCAACAGTCAAGGGGAAGTACATTGGAGGGAGATAGAATTACAAGATCAAGAAACCCAGGAGAAACCAGCAGACCATACCATTCAT TTAATAAAATCCATTCATTCAAACATTCACTAAAATAAAATCCAATAACATGGTCAAATAGTCCATAATCAATCCCTATTTATTCATACATATCCACCATGTATAACATAAATAATTTCATCTCATTAAAACATCCATATATATGAGTATCATTTAATGGACAATTTTAATTTGATTGAATTCATTCATTC AAGATTAAAATAAACTCTTTTTTAATTAAAATTATTAAGAATATTATATATATATATATATATAGTGACCATCTATGACAAACGAGATTTGTAATTTGATTTAATTTTATTGAGTTAAATATATTTTTCGATTTGATTGATTGAGTTAATTAATTTGAATTTGATTGATTGTTGTTTATTTAATTTGATTTATTTATTGATTGAATTTGTTTA ATTATATGTGCTATATTGGTTAATTATTGATGGATTTGCAAGTATGTTTTATTGAGCTTATTTGATTGAATTAATTAATAAGAATGATATGTTCTAATTTTAATTAATTAGAGATTTAATTTTAACATAATTAATTAATTTTAATTAATTAATTAGATTTAATTTTAACATATTATAATAATAATTTTAATTTTAATGTGACTATGTGATTGATTGATTGATTGATTGGATTTG

[0121] >SEQ ID NO:6 PgPDRN6

[0122]

[0123] >SEQ ID NO:7 PgPDRN7

[0124] GAAAACTAAACTCAATCTTATGTTTTTGCTGCCACCAACTAAATAAGTAAATGGCACATAAATTACATGTATAGGATAATTAATTAAAGACACATAATTCATGAACAAATTAATTTACAAGCATAGTCCAACACCCTGAAATTGAGTTTCAATCATAAATATCCTCAAAATAAAAGTAGACAACAAAACCGTCAAATCATTCAACCCCAAAATTTAATTTTTCTCACACACATGCACTGCATATCTGAATTCTTAAGGCTGAAATAG

[0125] >SEQ ID NO:8 PgPDRN8

[0126]

[0127] >SEQ ID NO:9 PgPDRN9

[0128] GGTGAGACCGTAACATTTAATTTGAAGAAGGAGACGAAGAACATGAAATGAGATGGCATTTTTTTTTTGTATTGTATGATTGTTTTGATGATTTTTGGCTGCACATCTTGAGGCTAAAATGATTTTTTTAATGATTTTAGATGGTTTTAGAATTTGTTGTTTTTGATTAGTATTACTGTATAATAAAAAGTGGTTTGACAAATTTGCCCTTTCATATATAATAATTGTGTAATTAAATATTAAAATATTCTTTTTTTAGTTACATATCAGCCTACCTTGAGAGCATTTTTGACGTGGCAGGCTCAATTGAATGCAAGTGAAAAAATTAGTAGTTTAATCATCTAATTGACA

[0129] >SEQ ID NO:10 PgPDRN10

[0130] GATGCAATATCAGAAAATGCTTACATCAATTTTATGGAGAAATTGAGTTTTTCATCATTTTTTCTTGAAATCTTGAAAGGTTTTTAACAGTTCGCACACCATAAATAATCTCTTTTTATATATGAAGTTTTCAGTTTTTAAGGTTCAACTTGAATAAACAAATTTTTTAAAAAGTCCCAAATTGATATGTATTGCTTTTCTGCTATTGTAGATGGCAATTTTGGTGTATTTCCTGCTGAAACCTGCCAAACAGTGAGTGTTGCTTCGGCTGTTTATCTTGCACGTTGTACCCTCAACAAGAGAGCCCTTATGAACCAAAATACTGAGTA CTCTCGGAGAATCAACTAAGGTAATATATTCTTTTGTATGGAGTTTCAACTAACCTTAGATATAATTACTAGAATTTGGAGTGTCTCATTTTAGTAAAATGAAATTATTAAATGTGATGATAATAAGAACATTGATGAGGATTTATTTATTTTTCCTGTTAGTAAAATCTCATTATTGTTTTGTTCCTTGGGGTGTGCATCATTTCTTTTAGTAAATGCTGTCCTCTTACTTTGGATTCTTGTATGGGAAAATTGTTGACTTCTGATTCATTTCAGTTCGAAACTTTATAAGAAAGTATTGGATGTTTGTGTTGATTACTGGTAGAAAGTCT

[0131] >SEQ ID NO:11 PgPDRN11

[0132] GATTCATATGATGAGGAAAATATTGATTTTATGTGGATATAGATGGAGAAAATTTTTAATGTGACAATTGTTGAAAATTGAAATTTTATCTTTTTCTGATAAAATAATTCATTTAAATATATTATTATATTTTAATAATATAATAATGATGATATTTTTACGATGAATGTGGGATATATGAGTATATGGAGGATGAGTATTTTTGTTATCAAAAATATTTAAAGCATGTTTTTATGTTTTTGGTGGACCCCATT

[0133] >SEQ ID NO:12 PgPDRN12

[0134]

[0135] II. Construction and Preparation of PCR Template Plasmids for PDRN

[0136] Figure 1 This is a schematic diagram of plasmid design provided in the example. The commercial vector pUC18 was used (including the location of the functional region of pUC18; the sequence map of pUC18, and the design of restriction enzyme sites based on the relevant sequence locations of pUC18; and carrying the target fragment sequences of SEQ ID NO:1-SEQ ID NO:12 respectively).

[0137] This embodiment uses the commercially available plasmid vector pUC18, purchased from Beijing Liuhe BGI Genomics Co., Ltd., according to... Figure 1 The relevant sequence positions were designed using the restriction enzyme sites HindⅢ and EcoRI, SEQ ID No:1 The 12 nucleic acid sequences were artificially synthesized. Each of the 12 synthesized DNA fragments has a restriction endonuclease site at both the 5' and 3' ends, corresponding to HindIII and EcoRI, respectively. The 12 target fragments were inserted between these double restriction sites on pUC18 to obtain PCR template plasmids carrying ginseng-derived PDRN sequences: pUC-PgPDRN1, pUC-PgPDRN2, pUC-PgPDRN3, pUC-PgPDRN4, pUC-PgPDRN5, pUC-PgPDRN6, pUC-PgPDRN7, pUC-PgPDRN8, pUC-PgPDRN9, pUC-PgPDRN10, pUC-PgPDRN11, and pUC-PgPDRN12. The recombinant DNA fragments were synthesized by Beijing Liuhe BGI Genomics Co., Ltd., and the recombinant plasmids were constructed. Sequencing results showed 100% sequence identity with the theoretical sequence.

[0138] 1. Construction and identification of recombinant strains

[0139] (1) Transformation of competent cells

[0140] a) Take 12 E. coli Top10 competent cells from Shanghai Yisheng Biotechnology Co., Ltd. in a -80℃ freezer. Place them in an ice box for about 5 minutes to thaw.

[0141] b) Add 1 μL of pUC-PgPDRN1, pUC-PgPDRN2, pUC-PgPDRN3, pUC-PgPDRN4, pUC-PgPDRN5, pUC-PgPDRN6, pUC-PgPDRN7, pUC-PgPDRN8, pUC-PgPDRN9, pUC-PgPDRN10, pUC-PgPDRN11 and pUC-PgPDRN12 plasmids to 12 E. coli Top10 competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min.

[0142] c) Heat shock in a water bath at 42℃ for 90 s, then quickly return to ice to cool for 2 min.

[0143] d) Resuscitation: Add 400 μL of LB liquid medium and incubate at 37°C and 220 rpm for 30 min.

[0144] e) Spread evenly onto LB solid culture medium plates (containing 100 μg / mL ampicillin).

[0145] f) Incubate overnight in an inverted plate at 37°C.

[0146] (2) Identification of plasmid transformation in recombinant strains

[0147] a) Observe the transformation plates corresponding to the Top10-PgPDRN1, Top10-PgPDRN2, Top10-PgPDRN3, Top10-PgPDRN4, Top10-PgPDRN5, Top10-PgPDRN6, Top10-PgPDRN7, Top10-PgPDRN8, Top10-PgPDRN9, Top10-PgPDRN10, Top10-PgPDRN11 and Top10-PgPDRN12 strains. Several single colonies should be distributed on the plates.

[0148] b) Pick single colonies of the 12 strains described in a) and inoculate them into 100 mL Erlenmeyer flasks (containing 20 mL of liquid LB medium). Add 20 μL of ampicillin (100 μg / mL) to the Erlenmeyer flasks and incubate overnight (16-18 h) at 37°C and 220 rpm.

[0149] c) Take 1 μL of the fresh bacterial culture from b) that has been shaken overnight, and perform validation PCR using Phanta Max Super-Fidelity DNA Polymerase (Novaza, catalog number P505-d1) according to the validation PCR system in Table 1 and the amplification program in Table 2. The upstream primer is M13F (5'-gtaaaacgacggccagt-3'), and the downstream primer is M13R (5'-caggaaacagctatgac-3'). The obtained amplification products are detected by agarose gel electrophoresis.

[0150] The results showed that the PCR products of all 12 bacterial strains exhibited specific bands, and all were consistent with the theoretical molecular weight. Figure 2 ).

[0151] Table 1 Validation PCR system

[0152]

[0153] (3) Preparation of PCR template plasmid for PDRN

[0154] a) Collect the overnight culture solution described in (2), centrifuge at 8,000 × g for 10 min, and collect the bacterial cells.

[0155] b) Following the instructions, use the EasyPure® Plasmid MiniPrep Kit (EM101-02) to extract plasmids from bacterial cells.

[0156] 1.3. Preservation of microbial strains

[0157] a) Pick the single colonies that have completed the validation and transfer them to a shaker tube containing LB medium. Incubate overnight at 37°C and 220 rpm.

[0158] b) Take 300 μL of bacterial culture and 300 μL of 50% glycerol, and mix them thoroughly.

[0159] c) Store the bacterial culture in a -80°C refrigerator.

[0160] III. Preparation of PDRN Materials

[0161] a) Design PCR amplification primers based on the sequences SEQ ID NO:1-SEQ ID NO:12 obtained in step one. The primer sequences are shown in Table 3.

[0162] b) Using the plasmid obtained in step two as a template, the sequences of SEQ ID NO:1-12 were amplified using Phanta Max Super-Fidelity DNA Polymerase (Novazan, catalog number P505-d1). The amplification system and program are shown in Table 4 and Table 2, respectively.

[0163] c) Based on the amplification system and procedure described in b), the corresponding specific sequence PDRN was successfully prepared, and the results are as follows. Figure 3 As shown. Figure 3 The middle lane, from left to right, consists of SEQ ID NO:1-SEQ ID NO:6, Marker (Borez, catalog number DM1002), and SEQ ID NO:7-SEQ ID NO:12.

[0164] d) Each PCR product was purified using the EasyPure® PCR Purification Kit (Truly Gold, catalog number EP101-01).

[0165] e) Each PCR product needs to be further sequenced and verified by Guangzhou Ruibo Biotechnology Co., Ltd. The nucleotide sequence of the obtained ginseng-derived PDRN is consistent with the theoretical design sequence.

[0166] Table 2 Amplification Procedure

[0167]

[0168] Table 3 Amplification Primers

[0169]

[0170] IV. Cytotoxicity Evaluation

[0171] The specific PDRN sequences obtained in step two (SEQ ID NO:1-SEQ ID NO:12) and salmon PDRN (Merck, catalog number 31149-10G-F) were used for cytotoxicity safety testing at a sample concentration of 0.01%. Specifically, HaCat cells were used as the experimental subject, cultured in DMEM medium (with 10% fetal bovine serum), and cultured under CO2 incubator conditions of 37°C and 5% CO2. After 24 h of cell culture, the original medium was discarded, and serum-free DMEM medium containing the sample was added, followed by another 24 h of culture. A blank control was prepared by replacing the sample with an equal volume of serum-free medium. The Enhanced Cell Counting Kit-8 (Beyotime, catalog number C0041) was used to analyze the cytotoxicity safety of the cells using CCK. Eight methods were used to detect the relative cell proliferation rate. The relative proliferation rate data are as follows: Figure 4 As shown.

[0172] Figure 4 The relative cell proliferation rate data showed that after treatment with the prepared specific sequence PDRN, the relative cell proliferation rate was above 95%, indicating that the above samples were not cytotoxic and had high safety.

[0173] V. Efficacy Evaluation

[0174] 1.1. Efficacy test of vascular endothelial growth factor (VEGF)

[0175] a) The VEGF-promoting efficacy was tested using the specific PDRN sequences SEQ ID NO:1-SEQ ID NO:12 obtained in step three and salmon PDRN (Merck, catalog number 31149-10G-F) at a sample concentration of 0.01%.

[0176] b) Specifically, HaCat cells were used as the experimental subject, and the culture system was DMEM medium (with 10% fetal bovine serum added). The culture conditions were a CO2 incubator at 37°C and 5% CO2. The sample processing procedure was as follows: after 24 h of cell culture, the original culture medium was discarded, and serum-free DMEM medium containing the sample was added for another 24 h of culture. An equal volume of serum-free medium was added to the blank control. After the incubation period, the cell supernatant was collected, and the VEGF content was determined using the Human VEGF ELISA Kit (Beyotime, catalog number PV963) according to the manufacturer's instructions.

[0177] Figure 5 The relative VEGF content data showed that all 12 specific sequence PDRN samples prepared in step three had the effect of promoting VEGF expression, indicating that the preparation of specific sequence samples has excellent effects in improving skin inflammation and promoting angiogenesis.

[0178] 1.2 Collagen-promoting efficacy test

[0179] a) The collagen-promoting efficacy was tested using the specific sequence PDRN SEQ ID NO:1-SEQ ID NO12 samples obtained in step three (all sample concentrations were 0.01%).

[0180] b) Specifically, HSF cells were used as the experimental subject, and the culture system was DMEM medium (with 10% fetal bovine serum added). The culture conditions were a carbon dioxide incubator at 37°C and 5% CO2. The sample processing procedure was as follows: after culturing the cells for 24 h, the original culture medium was discarded, and serum-free culture medium containing the sample was added and cultured for another 24 h. The cell supernatant was collected and tested according to the type I collagen (Col I) test kit (Nanjing Jiancheng, catalog number H142-1-1).

[0181] Figure 6The results showed that after 24 h of treatment with the product prepared in this application, the content of type I collagen in cells significantly increased. Therefore, this demonstrates that the specific sequence PDRN sample prepared by the method described in this application can significantly promote collagen synthesis in cells.

[0182] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A ginseng-derived polydeoxyribonucleotide, characterized in that, The nucleotide sequence of the ginseng-derived polydeoxyribonucleotide is shown in any one of SEQ ID NO.1-SEQ ID NO.

12.

2. A carrier, characterized in that, The carrier comprises the ginseng-derived polydeoxyribonucleotide as described in claim 1; Optionally, the skeleton of the carrier includes pUC18.

3. A cell, characterized in that, The cells comprise the ginseng-derived polydeoxyribonucleotide of claim 1 or the carrier of claim 2; Optionally, the cells include Escherichia coli.

4. The method for preparing ginseng-derived polydeoxyribonucleotides according to claim 1, characterized in that, include: Using the recombinant vector containing the ginseng-derived polydeoxyribonucleotides as described in claim 1 as a template, PCR amplification was performed using primers capable of amplifying the ginseng-derived polydeoxyribonucleotides to obtain the amplification product. as well as The amplification product was purified; Optionally, the primers used for PCR amplification are shown in SEQ ID NO.13-SEQ ID NO.

36.

5. The method for preparing ginseng-derived polydeoxyribonucleotides according to claim 4, characterized in that, SEQ ID NO.13-SEQ ID NO.14 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.1; SEQ ID NO.15-SEQ ID NO.16 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.2; SEQ ID NO.17-SEQ ID NO.18 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.3; SEQ ID NO.19-SEQ ID NO.20 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.4; SEQ ID NO.21-SEQ ID NO.22 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.5; SEQ ID NO.23-SEQ ID NO.24 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.6; SEQ ID NO.25-SEQ ID NO.26 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.7; SEQ ID NO.27-SEQ ID NO.28 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.8; SEQ ID NO.29-SEQ ID NO.30 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.9; SEQ ID NO.31-SEQ ID NO.32 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.10; SEQ ID NO.33-SEQ ID NO.34 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.11; SEQ ID NO.35-SEQ ID NO.36 are used to amplify ginseng-derived polydeoxyribonucleotide sequences as shown in SEQ ID NO.

12.

6. The method for constructing cells according to claim 3, characterized in that, include: The step of introducing the ginseng-derived polydeoxyribonucleotide of claim 1 or the vector of claim 2 into the cells to be modified.

7. The use of the ginseng-derived polydeoxyribonucleotide of claim 1, the carrier of claim 2, and the cell of claim 3 in the preparation of products that promote skin repair, angiogenesis, or collagen synthesis.

8. The application according to claim 7, characterized in that, The products include cosmetics.

9. A cosmetic product, characterized in that, It includes: The ginseng-derived polydeoxyribonucleotide of claim 1 is used as an active ingredient; and a cosmetically acceptable carrier.

10. The cosmetic product according to claim 9, characterized in that, The acceptable carriers for the cosmetic include one or more of glycerin, hyaluronic acid, squalane, and shea butter.

Images