A kasp molecular marker related to cassava cyanogenic content and application thereof

By developing the SNP site Chr16_1071557 (G/A) of the KASP molecular marker, and combining it with allele-specific PCR and fluorescence signal reading, the problems of cumbersome and costly traditional detection methods have been solved, and efficient screening of low-cyanogenic cassava germplasm and acceleration of the breeding process have been achieved.

CN122256566BActive Publication Date: 2026-07-21TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610716250.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-22
Publication Date
2026-07-21
Estimated Expiration
2046-05-22

Smart Images

  • Figure CN122256566B_ABST
    Figure CN122256566B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker related to cassava cyanogenic glycoside content and an application thereof, and relates to the technical field of plant molecular breeding. The KASP molecular marker is located on chromosome 16 of cassava, and contains one SNP site Chr16_1071557 (G / A) on the KASP molecular marker. The SNP site Chr16_1071557 (G / A) is located at the 1071557th base of chromosome 16 of cassava, and the polymorphic site is G / A. Through the KASP molecular marker of the application, high-throughput, low-cost, rapid and accurate screening of cassava low-cyanogenic glycoside germplasm can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, specifically to a KASP molecular marker related to cassava cyanogenic glycoside content and its application. Background Technology

[0002] Cassava ( Manihot esculenta Crantz is one of the most important food and economic crops in tropical and subtropical regions of the world, widely distributed in more than 130 countries and regions. It is also an important raw material for starch, bioenergy and feed processing.

[0003] However, cassava tubers are rich in cyanogenic glycosides, mainly linamarin and lotusustralin, with linamarin accounting for over 90%. While cyanogenic glycosides themselves are not toxic, they can release highly toxic hydrogen cyanide (HCN) after hydrolysis by β-glucosidase, seriously threatening the safety of cassava consumption. Based on the cyanide formation capacity of the tubers, cassava with a cyanogenic glycoside content below 50 mg / kg is classified as sweet cassava, which can be eaten directly or used as animal feed; cassava with a content above this threshold is classified as bitter cassava, which requires detoxification processing before use. Traditional detoxification processes such as soaking and fermentation take 3 to 5 days, increasing processing costs by more than 30%, thus hindering the large-scale development of the cassava industry.

[0004] In the cassava cyanogenic glycoside biosynthesis pathway, cytochrome P450 monooxygenase (CYP450) is a key enzyme in the initial stage, among which... CYP79D1 and CYP79D2 The coordinated expression of genes plays a decisive role in the synthesis of cyanogenic glycosides. Studies have shown that inhibiting... CYP79D1 and CYP79D2 Gene expression can significantly reduce the cyanogenic glycoside content in cassava, providing an important molecular basis for toxicity regulation.

[0005] Currently, breeding low-cyanide cassava varieties is the fundamental way to solve the safety problem at its source. Traditional breeding methods mainly rely on HPLC to detect cyanide content in tubers, which is cumbersome, time-consuming, costly, and greatly affected by environmental factors, making it difficult to meet the needs of large-scale germplasm screening. Molecular marker-assisted selection (MAS) technology can overcome these shortcomings and has been widely used in the breeding of crops such as wheat, rice, and soybeans. Regarding molecular markers related to cassava cyanide, existing research has targeted… MeMATE SNAP functional markers were developed based on single-base mutations in genes, targeting MeCYP79D1 Gene has developed CAPS combinatorial markers, but these markers have drawbacks such as low detection throughput, numerous operation steps, or insufficient sensitivity, and cannot fully meet the needs of large-scale cassava breeding.

[0006] KASP (Kompetitive Allele Specific PCR) is a novel SNP genotyping technique developed based on the fluorescence energy resonance transfer (FRET) principle. It boasts advantages such as high throughput, low cost, ease of operation, intuitive results, and high sensitivity, and has become one of the mainstream SNP genotyping techniques in crop breeding. However, currently, no KASP markers targeting SNP loci associated with cassava cyanogenic glycoside content have been developed and applied in production practice.

[0007] Therefore, there is an urgent need to develop a simple, low-cost, accurate and reliable KASP molecular marker for high-throughput screening of cassava germplasm with low cyanogenic glycosides, so as to accelerate the breeding process of new cassava varieties with low cyanogenic glycosides and ensure the food and feed security of the cassava industry. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a KASP molecular marker related to cassava cyanogenic glycoside content and its application. The SNP site of this invention is the 1071557th base on cassava chromosome 16, with a polymorphism of G / A. This SNP site can be used to achieve high-throughput, low-cost, rapid, and accurate screening of cassava germplasm with low cyanogenic glycoside content.

[0009] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a KASP molecular marker related to cassava cyanogenic glycoside content, wherein the KASP molecular marker contains a SNP site Chr16_1071557 (G / A). The SNP site is located at base 1071557 on cassava chromosome 16, and the polymorphic site is G / A; The KASP molecular marker is based on the cassava reference genome M. esculenta v7.1.

[0010] This invention also provides the application of the KASP molecular marker described above in identifying the cyanogenic glycoside content trait in cassava, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content.

[0011] The present invention also provides primers for obtaining the KASP molecular marker, wherein the primers for obtaining the sequence xl-KASP containing the SNP site Chr16_1071557 (G / A) are allele-specific forward primer F1, allele-specific forward primer F2 and reverse universal primer R; The nucleotide sequence of the allele-specific forward primer F1 is shown in SEQ ID NO: 2, the nucleotide sequence of the allele-specific forward primer F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse universal primer R is shown in SEQ ID NO: 4. The allele-specific forward primer F1 contains a FAM fluorescent tag, and the allele-specific forward primer F2 contains a HEX fluorescent tag.

[0012] Furthermore, the nucleotide sequence of the xl-KASP sequence obtained by primer amplification is shown in SEQ ID NO: 1, and the SNP site Chr16_1071557 (G / A) is located at the 22nd base of the xl-KASP gene sequence.

[0013] This invention also provides the application of the primers described above in identifying the cyanogenic glycoside content trait in cassava, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content.

[0014] The present invention also provides a method for detecting the KASP molecular marker, wherein the primers are used to amplify cassava DNA and genotyping is completed by detecting fluorescence signals; The specific steps are as follows: S1. Extract DNA from the cassava to be tested; S2. PCR amplification of cassava DNA was performed using the primers described above; S3. Read the fluorescence signals of the FAM and HEX dual channels. If only the FAM channel fluorescence signal is present, the SNP site Chr16_1071557 (G / A) genotype is GG genotype. Alternatively, only HEX channel fluorescence signal is present, and the SNP site Chr16_1071557 (G / A) genotype is AA. Alternatively, both FAM and HEX dual-channel fluorescence signals are present, and the SNP site Chr16_1071557 (G / A) has the GA genotype. When the SNP site Chr16_1071557 (G / A) has the genotype GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

[0015] The present invention also provides a kit for detecting KASP molecular markers, the kit comprising the primers described above.

[0016] The present invention also provides the application of the kit described herein in identifying the cyanogenic glycoside content trait of cassava, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content trait.

[0017] The beneficial effects of this invention are: Compared with the prior art, the present invention has the following beneficial effects: (1) Reliable target: This invention identified the SNP site Chr16_1071557 (G / A) that was significantly associated with the cyanogenic glycoside content of cassava tubers at the P≤0.0001 level by whole-genome resequencing and whole-genome association analysis of 288 cassava germplasm resources. The genetic basis is solid and the marker is highly reliable.

[0018] (2) High accuracy: The KASP molecular marker of the present invention was used to verify 48 germplasms (24 low cyanogenic glycosides and 24 high cyanogenic glycosides). The accuracy of the GG genotype was 81.48%, and the accuracy of the GA / AA genotype for predicting high cyanogenic glycosides was 90.48%. Further screening and verification of 93 germplasms showed that the screening efficiency for low cyanogenic glycosides reached 83.05%, demonstrating good predictive accuracy.

[0019] (3) Simple operation: KASP technology uses competitive allele-specific PCR combined with fluorescence signal reading. Genotyping can be completed in a single PCR reaction. There are few operation steps, the results are intuitive, and there is no need for cumbersome steps such as gel electrophoresis and enzyme digestion. It is significantly better than traditional CAPS, dCAPS and other technologies.

[0020] (4) High throughput and low cost: The KASP molecular marker of the present invention can be detected in high throughput in 96-well or 384-well plate format, which is suitable for rapid screening of large-scale breeding populations. The detection cost per sample is low and it is suitable for widespread application.

[0021] (5) High value in breeding applications: The KASP molecular marker of this invention can be used to quickly and accurately identify individuals with low cyanogenic glycosides in the early generation of breeding, avoid waste of resources, effectively shorten the breeding process of new low cyanogenic glycoside cassava varieties, and have important practical significance for promoting the edible and feed production of cassava. Attached Figure Description

[0022] Figure 1 Frequency distribution and box plot of cyanogenic glycoside content in tuber of 288 cassava germplasm resources; In the figure, A is the frequency distribution of cyanogenic glycoside content, and B is the box plot of cyanogenic glycoside content. Figure 2 This is a graph showing the CV error values ​​obtained from the ADMIXTURE software analysis. Figure 3 Heatmap of the population structure analysis results of natural cassava populations; Figure 4 A linkage disequilibrium decay analysis diagram of a natural cassava population; Figure 5 This is a graph showing the results of a genome-wide association analysis of cyanogenic glycoside content in cassava tubers; In the diagram, A is the Manhattan plot and B is the QQ plot; Figure 6 Scatter plot showing the genotyping of 24 cassava germplasms with high and low cyanogenic glycoside content using KASP molecular markers; Figure 7 Box plots showing the cyanogenic glycoside content in cassava tubers for different genotypes (AA, GA, GG); Figure 8 Genotyping scatter plot for screening low-cyanogenic glycoside germplasm from 93 cassava germplasm accessions using KASP molecular markers. Detailed Implementation

[0023] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0024] Example 1: Identification of cyanogenic glycoside content in natural populations of cassava germplasm resources 1. Test materials The genome-wide association study (GWAS) population consisted of 288 cassava germplasm resources from both domestic and international sources. These resources were field-grown at the Shidui base in Danzhou City, Hainan Province, from 2020 to 2021, with five plants per accession and a spacing of 0.8 m × 0.1 m. Field management was conducted according to standard methods. Cassava was harvested at harvest time, and after peeling, 50 g samples were collected, flash-frozen in liquid nitrogen, and then stored at -80°C for long-term preservation for cyanogenic glycoside content detection.

[0025] 2. Detection of cyanogenic glycoside content The cyanogenic glycoside content of 288 cassava germplasm resources in tuberous roots was detected by high performance liquid chromatography (HPLC). Statistical analysis of the cyanogenic glycoside content data was performed using R software to calculate the mean, median, standard deviation, and coefficient of variation, and the frequency distribution characteristics of the cyanogenic glycoside content were examined.

[0026] 3. Results The results are as follows Figure 1 As shown, the cyanogenic glycoside content in the tuberous roots of 288 cassava germplasm accessions generally conforms to a skewed distribution. Figure 1 A), the minimum value is 0.00 mg / kg ( Figure 1 B), with a maximum value of 699.08 mg / kg ( Figure 1 B), with an average value of 71.29 ± 94.17 mg / kg ( Figure 1 B), with a coefficient of variation of 132.09%, shows extremely rich variation in cyanogenic glycoside content within the population, providing a sufficient phenotypic basis for subsequent association analysis.

[0027] Example 2: Whole-genome resequencing and variant detection 1. DNA extraction and quality testing Genomic DNA was extracted from the tender leaves of 288 cassava germplasm resources from Example 1. The OD260 / OD280 ratio of the DNA was detected using a NanoDrop micro spectrophotometer, and the ratio was required to be between 1.8 and 2.0. The purity and integrity of the DNA were checked by 1% agarose gel electrophoresis. The qualified DNA samples were diluted to 100 ng / μL for sequencing library construction.

[0028] 2. Resequencing and Data Processing Library construction and resequencing were outsourced to Beijing Novogene Technology Co., Ltd. After the raw sequencing data was converted into sequence data via Base Calling, quality filtering was performed to obtain high-quality clean data, and statistical data on yield, error rate, Q20, and Q30 quality control indicators were collected.

[0029] High-quality sequences were aligned to the cassava reference genome (M. esculenta v7.1, https: / / phytozome-next.jgi.doe.gov / info / Mesculenta_v7_1) using BWA software. The alignment results were processed using SAMTOOLS software, and SNP sites were detected using a Bayesian model. Functional annotation of the SNP sites was performed using ANNOVAR software.

[0030] 3. Group structure and linkage disequilibrium analysis The population structure of 288 germplasm resources was analyzed using ADMIXTURE software (K value set to 1~20).

[0031] The grouping method is determined by the cross-validation error (CV error) value calculated by the software. The smaller the value, the better. Finally, the minimum K value is taken.

[0032] The results are as follows Figure 2 , Figure 3 As shown, the CV error is minimized when K is 10, indicating that K=10 is the optimal number of subgroups for this cassava population, which can divide the entire cassava population into 10 subgroups.

[0033] Linkage disequilibrium (LD) refers to the non-random assemblage of alleles at different gene loci within a population. Specifically, within a given population, two loci are linked when the probability of an allele at one locus co-occurring with an allele at another locus is greater than the probability of both alleles co-occurring due to random distribution within the population. The strength of LD is typically denoted by D' and r. 2 The value represents the level of LD. The level of LD can determine the accuracy of the association analysis and the number of selected markers.

[0034] The PopLDdecay software was used to calculate the LD size (r) between each pair of markers. 2 ), and plot the LD decay curve.

[0035] The results are as follows Figure 4 As shown, the LD decay of the cassava population is relatively slow, with r at 500 kb. 2 The value dropped to the background level (0.05), indicating that the group has a strong degree of linkage disequilibrium.

[0036] Example 3: Genome-wide association analysis identifies SNPs closely associated with cyanogenic glycoside content. 1. Association Analysis Methods For the SNP loci in Example 2, Tassel 5.0 software was used to filter SNP data with the lowest allele frequency (MAF≤0.05), highest allele frequency (MAF≥0.95), and highest heterozygosity (≤0.05) to obtain high-quality SNP loci for genome-wide association analysis.

[0037] Association analysis was performed using a mixed linear model (MLM) in Tassel 5.0, with the population structure matrix (Q matrix) and kinship matrix (K matrix) as covariates to effectively control for false positives.

[0038] The affinity coefficient between each pair of materials was estimated using the Loiselle algorithm in Tassel 5.0.

[0039] Using P≤0.0001 as the threshold, SNP sites that meet this condition are listed as candidate SNP sites that are significantly associated with cyanogenic glycoside content.

[0040] If multiple SNP loci controlling a trait are identified and fall within an LD region of a chromosome segment, they are called a locus.

[0041] A locus associated with multiple phenotypic traits is called a pleiotropic locus. Manhattan diagrams and QQ diagrams are drawn using the qqman package in R software.

[0042] 2. Results of Association Analysis The results are as follows Figure 5 As shown, genome-wide association analysis revealed a significant SNP site, Chr16_1071557 (G / A), on chromosome 16 of cassava (reference genome M. esculentav7.1) that is significantly associated with cyanogenic glycoside content in tubers. This SNP site is located at base 1071557 on chromosome 16, with a polymorphism of G / A. MANES_ 16G010400 The SNP site is located at 540 bp in the gene. The associated signal at this SNP site is shown in the Manhattan plot (…). Figure 5A) exceeds the significance threshold, and the QQ plot ( Figure 5 B) The association analysis results show that they are reliable and there is no obvious systematic bias.

[0043] The allele frequency (MAF) of the SNP site Chr16_1071557 (G / A) is greater than 0.05, which meets the basic requirements for further development of molecular markers, and it has been selected as a target site for KASP marker development.

[0044] Example 4: Development of KASP molecular markers based on Chr16_1071557 (G / A) 1. Primer design For the SNP site Chr16_1071557 (G / A), two allele-specific forward primers and one reverse universal primer were designed using the online software Primer3Plus (http: / / www.primer3plus.com). Following the KASP technical specifications, the standard FAM fluorescent tag sequence (5'-GAAGGTGACCAAGTTCATGCT-3') was added to the 5' end of the primer detecting the G allele, and the standard HEX fluorescent tag sequence (5'-GAAGGTCGGAGTCAACGGATT-3') was added to the 5' end of the primer detecting the A allele.

[0045] The designed KASP marker primer sequences are as follows: Allele-specific forward primer F1 (FAM tag, for detecting G allele): GAAGGTGACCAAGTTCATGCTTCACACAATAGACCACCAAGAG (SEQ ID NO: 2); where the bolded part is the FAM fluorescent tag; Allele-specific forward primer F2 (HEX tag, for detecting A allele): GAAGGTCGGAGTCAACGGATTTCACACAATAGACCACCAAGAA (SEQ ID NO: 3); where the bolded part is the HEX fluorescent tag; Reverse universal primer R: TAGTCTAGTACAGGCCCCTC (SEQ ID NO: 4).

[0046] 2. PCR reaction Using cassava genomic DNA (M. esculenta v7.1) as a template, PCR amplification was performed using allele-specific forward primers F1 and F2, and a reverse universal primer R.

[0047] PCR was performed using the 2× KASP Master Mix from the 2× Master Mix for ASPCR V1 Allelic Specific Genotyping Kit (Chengdu Hanchen Guangyi Biotechnology Co., Ltd.).

[0048] The reaction system (total volume 10 μL) is as follows: Genomic DNA template (50 ng / μL): 1 μL; 2×KASP MasterMix: 5 μL; Allele-specific forward primer F1 (10 μmol / L): 0.1 μL; Allele-specific forward primer F2 (10 μmol / L): 0.1 μL; Reverse universal primer R (10 μmol / L): 0.3 μL; ddH2O: 3.5 μL.

[0049] The PCR reaction procedure is shown in Table 1.

[0050] Table 1 PCR reaction procedure

[0051] 3. Genotyping test After PCR amplification, the gene sequence xl-KASP containing the SNP site Chr16_1071557 (G / A) was obtained. Its nucleotide sequence is shown in SEQ ID NO: 1. The degenerate base R is G / A, and the SNP site Chr16_1071557 (G / A) is located at the 22nd base of the gene sequence xl-KASP, and the polymorphic site is G / A.

[0052] SNP genotyping was performed using a Bio-Rad CFX Opus96 real-time PCR instrument in 96-well plates, with two wells of ddH2O per plate as negative controls (NTC). After PCR, the genotyping data were analyzed using the Bio-Rad CFX Opus96 instrument, and t-tests were applied to detect phenotypic differences between alleles. The FAM and HEX dual-channel fluorescence signals were read, and genotype interpretation was performed based on the clustering results in the scatter plot. (1) Only the FAM channel shows high fluorescence signal (scatter points are located along the FAM axis): interpreted as GG homozygous genotype; (2) High fluorescence signal only in the HEX channel (scatter points located along the HEX axis): interpreted as homozygous AA genotype; (3) Both FAM and HEX dual-channel fluorescence signals are present (scatter points are located between the two axes): interpreted as GA heterozygous genotype; (4) Low fluorescence signal in both channels (NTC clustering region): negative control.

[0053] Based on the genotype of SNP site Chr16_1071557 (G / A), the cyanogenic glycoside content trait of cassava was determined. When the genotype of SNP site Chr16_1071557 (G / A) is GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

[0054] Example 5: Preliminary validation of KASP molecular markers based on Chr16_1071557 (G / A) 1. Verification materials From the 288 population in Example 1, 24 low-cyanogenic glycoside content germplasms (cyanogenic glycoside content <50 mg / kg) and 24 high-cyanogenic glycoside content germplasms (cyanogenic glycoside content >50 mg / kg) were randomly selected, for a total of 48 germplasms, for preliminary verification of the KASP molecular marker.

[0055] 2. Verification Results Genotyping was performed on 48 validation germplasms using the method described in Example 4. Combined with the cyanogenic glycoside content data for each germplasm, the results are as follows: Figure 6 and Figure 7 As shown, the specific genotyping results and statistical analysis are shown in Tables 2 and 3.

[0056] Table 2 Cyanogenic glycoside content and KASP genotyping of 24 cassava germplasms with high and low cyanogenic glycoside content

[0057] Table 3 Accuracy statistics of marker genotypes for 24 cassava germplasms with high and low cyanogenic glycoside content.

[0058] Figure 6 The FAM and HEX fluorescence signals were clearly clustered into three groups: blue for AA genotype, green for GA genotype, and orange for GG genotype, with no cross-contamination. The black negative control NTC was located in the lower left corner, indicating high genotyping quality and no obvious non-specific amplification. Figure 7 The results indicate that the cyanogenic glycoside content of the AA and GA genotypes is significantly higher than that of the GG genotype. Validation results show that among the 48 germplasm accessions, the SNP locus Chr16_1071557 (G / A) GG genotype is predominantly concentrated in the low-cyanogenic glycoside group, while the GA and AA genotypes are predominantly concentrated in the high-cyanogenic glycoside group (Table 2), preliminarily showing a high correlation between this marker and cyanogenic glycoside content. Table 3 shows that the accuracy rate for low-cyanogenic glycoside content in the GG genotype is 81.48%, while the accuracy rate for high-cyanogenic glycoside content in the GA and AA genotypes is 90.48%, demonstrating significant genotyping effectiveness and enabling sensitive, efficient, and low-cost prediction of cyanogenic glycoside content in cassava.

[0059] Example 6: Application of KASP markers in screening 93 cassava germplasm accessions Ninety-three cassava germplasm resources were selected, covering germplasm materials from different origins and with varying levels of cyanogenic glycosides. Genotyping was performed on these 93 cassava germplasm resources using the method described in Example 4, and the cyanogenic glycoside content of the 93 cassava germplasm resources was detected. The results are as follows: Figure 8 As shown in Tables 4 and 5.

[0060] Table 4. Cyanogenic glycoside content and KASP genotyping of 93 cassava germplasms

[0061] Table 5. Accuracy statistics of 93 germplasm resources based on marker genotypes

[0062] The KASP molecular markers of this invention were used to screen 93 germplasm accessions. Figure 8 The results showed that the 93 germplasm accessions exhibited clear genotyping and no significant non-specific amplification. Table 4 revealed that the KASP molecular marker was present in all three genotypes (GG, GA, and AA) in the natural population. The cyanogenic glycoside content in GG genotype accessions was generally low, while the GA and AA genotype accessions showed generally higher cyanogenic glycoside content, indicating good genotyping effectiveness. Table 5 showed that 59 accessions were identified as having the GG genotype (low cyanogenic glycosides), achieving a screening accuracy of 83.05%. The average cyanogenic glycoside content in GG genotype accessions (39.00±29.61 mg / kg) was significantly lower than that in GA and AA genotype accessions (71.32±36.68 mg / kg), with a statistically significant difference at the 0.01 level. This further confirms the good practicality and reliability of the KASP molecular marker in the screening of low-cyanogenic cassava accessions.

[0063] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A reagent for detecting KASP molecular markers related to cassava cyanogenic glycoside content, used in identifying cassava cyanogenic glycoside content traits, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content traits, characterized in that: The KASP molecular marker is located at base 1071557 on chromosome 16 of the cassava reference genome M. esculenta v7.1, with a polymorphism of G / A. When the KASP molecular marker genotype is GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

2. The application of a KASP primer for detecting the KASP molecular marker in claim 1 in identifying the cyanogenic glycoside content trait in cassava, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content, characterized in that: The KASP primers include an allele-specific forward primer F1 with a nucleotide sequence as shown in SEQ ID NO: 2, an allele-specific forward primer F2 with a nucleotide sequence as shown in SEQ ID NO: 3, and a reverse universal primer R with a nucleotide sequence as shown in SEQ ID NO: 4; The allele-specific forward primer F1 contains a FAM fluorescent tag, and the allele-specific forward primer F2 contains a HEX fluorescent tag; When the KASP molecular marker genotype is GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

3. A method for identifying the content of cassava cyanogenic glycosides, characterized in that: The method uses the KASP primers in claim 2 to amplify cassava DNA, and completes genotyping by detecting fluorescence signals; The specific steps are as follows: S1. Extract DNA from the cassava to be tested; S2. PCR amplification of cassava DNA was performed using the KASP primers described above; S3. Read the fluorescence signals of the FAM and HEX dual channels. If only the FAM channel fluorescence signal is present, the KASP molecular marker genotype is the GG genotype. Or there is only HEX channel fluorescence signal, and the KASP molecular marker genotype is AA genotype; Alternatively, both FAM and HEX dual-channel fluorescence signals are present, and the KASP molecular marker genotype is the GA genotype; When the KASP molecular marker genotype is GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

4. The application of a kit containing the KASP primers of claim 2 in identifying the cyanogenic glycoside content trait in cassava, screening cassava with low cyanogenic glycoside content, and in genetic breeding of cassava with low cyanogenic glycoside content traits, characterized in that: When the KASP molecular marker genotype is GG, the cyanogenic glycoside content of cassava is lower than that of other genotypes.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker related to content of linamarin in cassava tuberous roots and application of SNP marker

    CN116024370A

  • Tetra primers ARMS-PCR molecular marker for discriminating cultivars of sweet potato and uses thereof

    KR102198566B1