RSV vaccine compositions, methods, and uses thereof

CN122270291APending Publication Date: 2026-06-23SICHUAN CLOVER BIOPHARM INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-13
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The prior art is difficult to effectively prevent and treat respiratory syncytial virus (RSV) infection, and the development of existing vaccines faces challenges such as production, stability, safety and effectiveness.

Method used

An immunogenic composition, particularly a fusion protein, is developed, comprising a recombinant peptide and a protein, comprising a soluble RSV virus surface antigen linked to a collagen trimerization domain, such as a recombinant F peptide or fragment or epitope thereof.

Benefits of technology

Through this composition, an effective immune response against RSV can be generated in a subject, including the production of neutralizing antibodies, thereby effectively preventing and treating RSV infection, and avoiding antibody-dependent enhancement and disease enhancement problems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000124_0000
    Figure 00000124_0000
  • Figure 00000125_0000
    Figure 00000125_0000
  • Figure 00000125_0001
    Figure 00000125_0001
Patent Text Reader

Abstract

The present invention provides recombinant peptides comprising soluble respiratory syncytial virus (RSV) viral antigens comprising a recombinant F protein peptide joined via an in-frame fusion to a collagen C-terminal portion to form a disulfide-linked trimeric fusion protein, and immunogenic compositions comprising the same. The immunogenic compositions can be used to generate an immune response, e.g., for the treatment or prevention of RSV infection. The immunogenic compositions can be used in vaccine compositions, e.g., as part of a prophylactic and / or therapeutic vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

RSV vaccine compositions, methods, and uses thereof Technical Field

[0001] The present disclosure relates in some aspects to an immunogenic composition comprising recombinant peptides and proteins comprising respiratory syncytial virus (RSV) viral antigens and immunogens, such as RSV F protein peptides, for use in treating and / or preventing RSV infection. Background Art

[0002] Respiratory syncytial virus (RSV) causes respiratory tract infections in adults and children and is a major cause of lower respiratory tract infections and hospitalizations in infancy and childhood. Although RSV infection rates are high, treatment options, including prophylactics, therapeutics, and vaccines, are limited or unavailable. Improved methods are needed to treat RSV. Provided herein are compositions, methods, uses, and products that meet these and other needs.

[0003] Summary of the Invention

[0004] Fusion protein (also may be referred to as recombinant polypeptide in this article) is provided herein, and described fusion protein comprises the soluble RSV viral surface antigen that is connected with collagen protein trimerization structural domain, and described soluble RSV viral surface antigen comprises the F peptide or its fragment or epi-position of reorganization.In some embodiments, RSV virus belongs to A hypotype and / or B hypotype.In some embodiments, soluble RSV viral surface antigen is connected by fusion in frame with collagen protein trimerization structural domain.In some embodiments, described fusion protein can form the trimeric fusion protein that disulfide bond connects.In some embodiments, described fusion protein exists with trimeric form.

[0005] In some embodiments, the collagen trimerization domain is a collagen C-terminal propeptide. In some embodiments, the collagen trimerization domain comprises a C-terminal polypeptide of proα1(I), proα1(II), proα1(III), proα1(V), proα1(XI), proα2(I), proα2(V), proα2(XI) or proα3(XI) or a fragment thereof. In some embodiments, the collagen trimerization domain comprises a sequence of any one of SEQ ID NOs: 103-118 or an amino acid sequence having at least 90% identity thereto, capable of forming an inter-polypeptide disulfide bond and trimerizing the fusion protein.

[0006] In some embodiments, the recombinant F peptide or fragment thereof or epitope has one or more mutation sites, and the F peptide or fragment thereof or epitope is a sulfur-containing amino acid or a sulfur-containing amino acid derivative at the one or more mutation sites. In some embodiments, the recombinant F peptide or fragment thereof or epitope has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 11, 16, 31 or 36.

[0007] In some embodiments, the recombinant F peptide, fragment, or epitope thereof comprises an F2 peptide, fragment, or epitope thereof and an F1 peptide, fragment, or epitope thereof. In some embodiments, the recombinant F peptide, fragment, or epitope thereof comprises a pep27 peptide. In some embodiments, the F2 peptide, fragment, or epitope thereof is located at the N-terminus of the F1 peptide, fragment, or epitope thereof.

[0008] In some embodiments, the recombinant F peptide, fragment, or epitope thereof comprises one or more mutation sites in the F2 peptide and / or pep27 peptide. In some embodiments, the recombinant F peptide, fragment, or epitope thereof comprises amino acid substitutions at one or more or all of amino acid residues 106, 108, 133, 135, or 136. In some embodiments, the sulfide bond-containing amino acid is cysteine. In some embodiments, the recombinant F peptide, fragment, or epitope thereof comprises amino acid substitutions R106C, R108C, R133C, R135C, and R136C.

[0009] In some embodiments, the recombinant F peptide or fragment or epitope thereof comprises the sequence of any one of SEQ ID NOs: 11-20, 31-40, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NOs: 11-20, 31-40.

[0010] In some embodiments, the fusion protein comprises the sequence of any one of SEQ ID NOs: 1-10, 21-30, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 1-10, 21-30.

[0011] In some embodiments, the recombinant F peptide, or fragment thereof, or epitope thereof, comprises an F1 peptide and an F2 peptide of the F peptide, wherein the F1 peptide and the F2 peptide are connected by an artificially introduced linker, wherein the artificially introduced linker is the amino acid sequence CGGG (SEQ ID NO: 138). In some embodiments, the F2 peptide, or fragment thereof, or epitope thereof, is located at the N-terminus of the F1 peptide, or fragment thereof, or epitope thereof.

[0012] In some embodiments, the F2 peptide comprises the amino acid sequence from amino acid residue 26 to amino acid residue 105 of the F0 precursor or the amino acid sequence from amino acid residue 1 to amino acid residue 105 of the F0 precursor. In some embodiments, the F1 peptide comprises the amino acid sequence from amino acid residue 105 to any one selected from amino acid residues 513-524 of the F0 precursor.

[0013] In some embodiments, the F0 precursor comprises the sequence of SEQ ID NO: 67 or 69, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of SEQ ID NO: 67 or 69.

[0014] In some embodiments, the recombinant F peptide or fragment or epitope thereof comprises the sequence of any one of SEQ ID NOs: 49-50, 62-63, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NOs: 49-50, 62-63.

[0015] In some embodiments, the fusion protein comprises the sequence of any one of SEQ ID NOs:41-48, 54-61, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs:41-48, 54-61.

[0016] Also provided herein are polynucleotides encoding any of the fusion proteins described herein. Also provided herein are vectors comprising any of the polynucleotides described herein. Also provided herein are host cells comprising any of the polynucleotides described herein or any of the vectors described herein.

[0017] Also provided herein are immunogenic compositions (also referred to as recombinant subunit vaccines) comprising any of the fusion proteins described herein. In some embodiments, the immunogenic compositions comprise one or more adjuvants or do not comprise an adjuvant. In some embodiments, the adjuvant is an aluminum agent. In some embodiments, the aluminum agent comprises aluminum hydroxide.

[0018] In some embodiments, the immunogenic composition is multivalent and comprises two or more of the fusion proteins, each comprising a fusion protein of a soluble RSV viral surface antigen of a different RSV viral subtype or strain linked to a collagen trimerization domain.

[0019] In some embodiments, the immunogenic composition comprises a fusion protein of a soluble RSV viral surface antigen of RSV subtype A linked to a collagen trimerization domain, and a fusion protein of a soluble RSV viral surface antigen of RSV subtype B linked to a collagen trimerization domain.

[0020] In some embodiments, the fusion protein of a soluble RSV viral surface antigen of RSV subtype A linked to a collagen trimerization domain comprises the sequence of any one of SEQ ID NOs: 1-10, 41-48, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 1-10, 41-48.

[0021] In some embodiments, the fusion protein of a soluble RSV viral surface antigen of RSV subtype B linked to a collagen trimerization domain comprises the sequence of any one of SEQ ID NOs: 21-30, 54-61, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 21-30, 54-61.

[0022] In some embodiments, the soluble RSV viral surface antigen of RSV subtype A comprises the sequence of any one of SEQ ID NOs: 11-20, 49-50, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 11-20, 49-50.

[0023] In some embodiments, the soluble RSV viral surface antigen of RSV subtype B comprises the sequence of any one of SEQ ID NOs: 31-40, 62-63, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 11-20, 49-50.

[0024] In some embodiments, the soluble RSV viral surface antigen of RSV subtype A comprises SEQ ID NO: 12 or 17, and the soluble RSV viral surface antigen of RSV subtype B comprises SEQ ID NO: 32 or 37.

[0025] In some embodiments, the soluble RSV viral surface antigen of RSV subtype A comprises SEQ ID NO: 49 or 50, and the soluble RSV viral surface antigen of RSV subtype B comprises SEQ ID NO: 62 or 63.

[0026] In some embodiments, the fusion protein of a soluble RSV viral surface antigen of RSV subtype A linked to a collagen trimerization domain comprises SEQ ID NO: 2 or 7, and the fusion protein of a soluble RSV viral surface antigen of RSV subtype B linked to a collagen trimerization domain comprises SEQ ID NO: 22 or 27.

[0027] In some embodiments, the fusion protein of a soluble RSV viral surface antigen of RSV subtype A linked to a collagen trimerization domain comprises SEQ ID NO:41 or 45, and the fusion protein of a soluble RSV viral surface antigen of RSV subtype B linked to a collagen trimerization domain comprises SEQ ID NO:54 or 58.

[0028] Provided herein are methods for preventing or treating respiratory syncytial virus (RSV) infection comprising administering to a subject any of the fusion proteins described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the host cells described herein, or any of the immunogenic compositions described herein.

[0029] Provided herein are methods for generating an immune response to the F peptide of RSV, or a fragment or epitope thereof, in a subject, comprising administering to the subject any of the fusion proteins described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the host cells described herein, or any of the immunogenic compositions described herein.

[0030] Provided herein are methods of producing neutralizing antibodies against RSV in a subject, comprising administering to the subject any of the fusion proteins described herein, any of the polynucleotides described herein, any of the vectors described herein, any of the host cells described herein, or any of the immunogenic compositions described herein.

[0031] In some embodiments, the method is by intramuscular administration (for immunization or vaccination) or by intranasal spray administration (for immunization or vaccination).

[0032] In some embodiments, the agent used in the method is administered (for immunization or vaccination) as a single dose or as a series of doses spaced apart at intervals of weeks or months.

[0033] Also provided herein is the use of any fusion protein described herein, any polynucleotide described herein, any vector described herein, any host cell described herein, or any immunogenic composition described herein in the preparation of a method for preventing or treating respiratory syncytial virus (RSV) infection, a method for generating an immune response to the F peptide or fragment or epitope thereof of RSV in a subject, and a medicament for generating neutralizing antibodies against RSV in a subject.

[0034] Provided herein is a protein comprising a plurality of recombinant polypeptides, each recombinant polypeptide comprising a respiratory syncytial virus (RSV) F protein peptide or a fragment or epitope thereof connected to a collagen C-terminal propeptide, wherein the C-terminal propeptide of the recombinant polypeptide forms an inter-polypeptide disulfide bond. In some embodiments, the RSV belongs to subtype A and / or subtype B. In some embodiments, the epitope is a linear epitope or a conformational epitope.

[0035] In some embodiments, the RSV is not soluble. The soluble RSV viral surface antigen comprises an F1 peptide or a fragment or epitope thereof having one or more mutation sites, and the one or more mutation sites of the F1 peptide or fragment or epitope thereof are sulfur-bonded amino acids or sulfur-bonded amino acid derivatives.

[0036] In some embodiments, disclosed herein are recombinant subunit vaccines comprising an extracellular domain (e.g., without a transmembrane domain and a cytoplasmic domain) of an RSV F protein or a fragment thereof, the extracellular domain being fused in-frame to a collagen C propeptide capable of forming a disulfide-linked homotrimer. The resulting recombinant subunit vaccine, such as an F trimer, can be expressed and purified from transfected cells and is expected to be in a natural-like conformation in the form of a trimer. This solves the misfolding problem often encountered when viral antigens are expressed as recombinant peptides or proteins in a soluble form without a transmembrane domain and / or a cytoplasmic domain. Such misfolded viral antigens cannot accurately retain the conformation of the native viral antigen and often fail to elicit neutralizing antibodies.

[0037] In some embodiments, the F protein peptide comprises an F1 subunit peptide, an F2 subunit peptide, or any combination thereof, and the protein comprises three recombinant polypeptides. In some embodiments, the F protein peptide comprises a signal peptide, a heptad repeat C (HRC) peptide, a pep27 peptide, a fusion peptide (FP), a heptad repeat A (HRA) peptide, a domain I peptide, a domain II peptide, or a heptad repeat B (HRB) peptide, or any combination thereof. In some embodiments, the F protein peptide comprises the F1 subunit of the F protein but not the F2 subunit, or vice versa. In some embodiments, the F protein peptide comprises the F1 subunit and the F2 subunit of the F protein, optionally in the absence of pep27, and optionally in the presence of a disulfide bond or an artificially introduced linker linking the F1 subunit and the F2 subunit. In some embodiments, pep27 is absent, and in the presence of an artificially introduced linker linking the F1 subunit and the F2 subunit.

[0038] In some embodiments, the F protein peptide does not comprise a transmembrane (TM) domain peptide and / or a cytoplasmic (CP) domain peptide. In some embodiments, the F protein peptide comprises a protease cleavage site, wherein the protease is optionally furin, trypsin, factor Xa, thrombin, or cathepsin L. In some embodiments, the F protein peptide does not comprise a protease cleavage site, wherein the protease is optionally furin, trypsin, factor Xa, thrombin, or cathepsin L.

[0039] In some embodiments, the F protein peptide is soluble or does not directly bind to a lipid bilayer, such as a membrane or viral envelope. In some embodiments, the F protein peptide is the same or different among the recombinant polypeptides of the protein. In some embodiments, the F protein peptide is fused directly to the C-terminal propeptide or is linked to the C-terminal propeptide via a linker, such as a linker comprising a glycine-XY repeat sequence, wherein X and Y are independently any amino acid, optionally proline or hydroxyproline.

[0040] In some embodiments, the protein is soluble or does not directly bind to a lipid bilayer, such as a membrane or viral envelope. In some embodiments, the protein is capable of forming a rosette-like oligomer comprising an F protein peptide trimer. In some embodiments, the protein is capable of binding to a cell surface attachment factor or receptor in a subject, optionally wherein the subject is a mammal, such as a primate, e.g., a human.

[0041] In some embodiments, the C-terminal propeptide belongs to human collagen. In some embodiments, the C-terminal propeptide comprises the C-terminal polypeptide of proα1(I), proα1(II), proα1(III), proα1(V), proα1(XI), proα2(I), proα2(V), proα2(XI) or proα3(XI) or a fragment thereof. In some embodiments, the C-terminal propeptides are the same or different between the recombinant polypeptides. In some embodiments, the C-terminal propeptide comprises any one of SEQ ID NO: 103-118 or an amino acid sequence having at least 90% identity thereto, capable of forming an inter-polypeptide disulfide bond and allowing the recombinant polypeptide to trimerize.

[0042] In some embodiments, the F protein peptide in each recombinant polypeptide is in a pre-fusion conformation or a post-fusion conformation, optionally wherein the protein comprises a rosette-like oligomer comprising a crutch-shaped rod-shaped F protein peptide trimer. In any of the above embodiments, the F protein peptide in each recombinant polypeptide can comprise any one of SEQ ID NOs: 11-20, 31-40, 49-50, 62-63, 67-70, or an amino acid sequence having at least 80% identity thereto.

[0043] In any of the above embodiments, the recombinant polypeptide may comprise any one of SEQ ID NOs: 1-10, 21-30, 41-48, and 54-61, or an amino acid sequence at least 80% identical thereto. In any of the above embodiments, the recombinant polypeptide may comprise any one of SEQ ID NOs: 11-20, 31-40, 49-53, 62-66, or an amino acid sequence at least 80% identical thereto, linked directly or indirectly to any one of SEQ ID NOs: 103-118, or an amino acid sequence at least 90% identical thereto.

[0044] Also provided herein is an immunogen comprising a protein as provided herein. Provided herein is a protein nanoparticle comprising a protein as provided herein directly or indirectly attached to a nanoparticle. Provided herein is a virus-like particle (VLP) comprising a protein as provided herein.

[0045] This paper also provides a kind of isolated nucleic acid, the protein 1,2,3 or more recombinant polypeptides that described isolated nucleic acid encoding this paper provides.In some embodiments, the polypeptide of coding F protein peptide and the polypeptide frame of coding collagen protein C-terminal propeptide merge.In some embodiments, the isolated nucleic acid that this paper provides is operably connected to promotor.

[0046] In some embodiments, the isolated nucleic acid provided herein is a DNA molecule. In some embodiments, the isolated nucleic acid provided herein is an RNA molecule, optionally an mRNA molecule, such as a nucleoside-modified mRNA, a non-amplified mRNA, a self-amplified mRNA, or a trans-amplified mRNA.

[0047] Also provided herein is a vector comprising the isolated nucleic acid provided herein.In some embodiments, the vector is a viral vector.

[0048] In some aspects, a virus, pseudovirus or cell comprising a vector as provided herein is provided herein, optionally wherein the virus or cell has a recombinant genome. In some aspects, an immunogenic composition is provided herein, comprising a protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus or cell as provided herein, and a pharmaceutically acceptable carrier.

[0049] Also provided herein is a vaccine comprising the immunogenic composition provided herein and an optional adjuvant, wherein the vaccine is optionally a subunit vaccine. In some embodiments, the vaccine is a prophylactic and / or therapeutic vaccine.

[0050] In some aspects, the present invention provides a method for producing a protein, comprising: expressing the isolated nucleic acid or vector provided herein in a host cell to produce the protein provided herein; and purifying the protein. The present invention provides a protein produced by the method provided herein.

[0051] Provided herein is a method for generating an immune response to the F protein peptide of RSV or its fragment or epitope in a subject, the method comprising administering to the subject an effective amount of a protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus, cell, immunogenic composition or vaccine as provided herein to generate the immune response. In some embodiments, the method provided herein is used to treat or prevent RSV infection. In some embodiments, generating an immune response inhibits or reduces the replication of RSV in the subject. In some embodiments, the immune response comprises a cell-mediated response and / or a humoral response, optionally comprising generating one or more neutralizing antibodies, such as polyclonal antibodies or monoclonal antibodies. In some embodiments, the immune response is directed against the F protein peptide of RSV or its fragment or epitope, but not against the C-terminal propeptide. In some embodiments, administration to the subject will not result in antibody-dependent enhancement (ADE) due to exposure to one or more RSVs before the subject. In some embodiments, when the subject is subsequently exposed to one or more RSVs, the administration will not result in antibody-dependent enhancement (ADE). In some embodiments, the method further comprises a primary immunization step and / or a booster step. In some embodiments, the administering step is performed topically, transdermally, subcutaneously, intradermally, orally, intranasally (e.g., intranasal spray), intratracheally, sublingually, buccally, rectally, vaginally, by inhalation, intravenously (e.g., intravenous injection), intraarterially, intramuscularly (e.g., intramuscular injection), intracardially, intraosseously, intraperitoneally, transmucosally, intravitreally, subretinally, intraarticularly, periarticularly, topically, or epidermally. In some embodiments, the effective amount is administered as a single dose or in a series of doses separated by one or more intervals. In some embodiments, the effective amount is administered without an adjuvant. In some embodiments, the effective amount is administered with an adjuvant.

[0052] This article provides a method, which includes administering an effective amount of the protein provided herein to a subject to produce neutralizing antibodies or neutralizing antiserum for RSV in the subject. In some embodiments, the subject is a mammal, optionally a human or non-human primate. In some embodiments, the method also includes isolating the neutralizing antibody or neutralizing antiserum from the subject. In some embodiments, the method also includes administering an effective amount of isolated neutralizing antibody or neutralizing antiserum to a human subject by passive immunization to prevent or treat RSV infection. In some embodiments, neutralizing antibodies or neutralizing antiserum for RSV comprise polyclonal antibodies to RSV F protein peptides or fragments or epitopes thereof, optionally wherein the neutralizing antibodies or neutralizing antiserum do not contain or are substantially free of antibodies to collagen C-terminal propeptide. In some embodiments, the neutralizing antibodies comprise monoclonal antibodies to RSV F protein peptides or fragments or epitopes thereof, optionally wherein the neutralizing antibodies do not contain or are substantially free of antibodies to collagen C-terminal propeptide.

[0053] In some aspects, the proteins, immunogens, protein nanoparticles, VLPs, isolated nucleic acids, vectors, viruses, pseudoviruses, cells, immunogenic compositions, or vaccines provided herein are used to induce an immune response to RSV in a subject and / or to treat or prevent RSV infection.

[0054] In some respects, the purposes of protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, carrier, virus, pseudovirus, cell, immunogenic composition or vaccine that this paper provides are provided herein, for inducing the immunne response to RSV and / or for treating or preventing RSV infection in a subject. In some respects, the purposes of protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, carrier, virus, pseudovirus, cell, immunogenic composition or vaccine that this paper provides are provided herein, for preparing medicine or prophylactic agent, and described medicine or prophylactic agent are used for inducing the immunne response to RSV virus and / or for treating or preventing RSV infection in a subject.

[0055] This paper also provides the method for analyzing sample, described method comprises: sample is contacted with the protein that this paper provides, and detects described protein and can specifically bind to the F protein peptide of RSV or its fragment or the combination between the analyte of epi-position.In some embodiments, described analyte is the antibody, receptor or cell that identifies F protein peptide or its fragment or epi-position.In some embodiments, described combination shows that there is RSV infection in the experimenter in described analyte and / or described sample source in described sample.

[0056] Provided herein is a kit comprising a protein provided herein and a substrate, pad or vial containing or immobilizing the protein, optionally wherein the kit is an ELISA or lateral flow assay kit. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] FIG1 shows a schematic diagram of an exemplary fusion peptide comprising the extracellular F domain of the A2 strain fused to a trimerizing peptide.

[0058] Figure 2 shows the OD values ​​in the supernatant of 293T cells on day 3. On day 3, the amounts of total protein and prefusion F protein in the supernatant were determined by ELISA.

[0059] Figure 3 shows the OD values ​​in the CHO cell supernatant on day 3. On day 3, the amounts of total protein and pre-fusion F protein in the supernatant were determined by ELISA.

[0060] Figure 4 shows the OD values ​​in the CHO cell supernatant on day 7. On day 7, the amounts of total protein and pre-fusion F protein in the supernatant were determined by ELISA.

[0061] Figure 5 shows the expression levels of peptides expressed using exemplary fusion peptides from serum-free fed-batch cell cultures, as analyzed by 8% SDS-PAGE. For SCB-N25 (i.e., SCB-N25_A), cell-free conditioned medium from days 1 to 13 was separated under non-reducing and reducing conditions, followed by Coomassie blue staining, with a sample volume of 16 μl. For SCB-N25C (i.e., SCB-N25C_A), cell-free conditioned medium from days 1 to 13 was separated under non-reducing and reducing conditions, followed by Coomassie blue staining, with a sample volume of 16 μl. For SCB-N25_A, transient conditioned medium was subjected to SDS-PAGE under non-reducing conditions, followed by Coomassie blue staining, with a sample volume of 13.5 μl.

[0062] Figure 6 shows the purity assessment of exemplary purified fusion peptides by SEC-HPLC, the main peak area of ​​the exemplary SCB-N25 (i.e., SCB-N25_A) fusion protein is 92.8%, the main peak area of ​​the SCB-N25C (i.e., SCB-N25C_A) protein is 81.7%, and the main peak area of ​​the 3.1SCB-N25C_A protein is 88.58%.

[0063] Figure 7 shows affinity kinetics. Figures A, B, and E show binding studies of palivizumab and an exemplary fusion peptide comprising an RSV F protein peptide using biolayer interferometry. 5 μg / mL palivizumab was first immobilized on a Protein A sensor, which was then immersed in various concentrations of the exemplary fusion peptide to measure binding kinetics. The resulting curves were fitted to a 1:1 binding model by subtracting the buffer reference value to obtain K. 缔合 and K 解离 , values ​​are shown in the table below. C, D, and F show binding studies conducted using antibody D25_A and an exemplary fusion peptide comprising an RSV F protein peptide. The corresponding KD, Kon, and Kdis from the antibody D25 binding experiment are shown in the tabs below. SCB-N25C (i.e., SCB-N25C_A) exhibited high affinity for both palivizumab and antibody D25, at 9.61 pM and 5.83 pM, respectively.

[0064] Figures 8A-8D show the results of immunization experiments using exemplary fusion peptides containing RSV F protein peptides. Figure 8A shows a schematic diagram of the experimental method: mice were immunized on days 0 and 21, and serum was collected on days 0 and 35, respectively. Figure 8B shows serological experiments (D35) - RSV A2 strain micro-neutralizing antibody titers against purified exemplary fusion peptides containing RSV F protein peptide and adjuvants Alum, Alum + CpG 1018, or CAS-1. Fusion proteins adjuvanted with Alum + CpG 1018 showed higher titer values ​​than corresponding fusion proteins adjuvanted with Alum or CAS-1. SCB-N25C (i.e., SCB-N25C_A) showed higher titer values ​​than other antigens. Figure 8C shows the competitive IgG titers of D25 and palivizumab that provide 50% inhibition of D25 and palivizumab binding to heat-inactivated RSV (HI-RSV) particles, as measured by serum sample dilutions. Values ​​are expressed as log2 and mean ± SEM. All antigens combined with Alum showed lower antibody (DCA: D25 competitive antibody and PCA: palivizumab competitive antibody) responses than the other two adjuvants. When used in combination with Alum + CpG1018 adjuvant, DS-CAV1-Trimer and N20 (i.e., SCB-N20_A) had higher DCA titers and PCA titers, and there was no significant difference between the two. The worst performer was N25 (i.e., SCB-N25_A). None of the four candidate antigens used in combination with CAS-1 adjuvant had effective DCA titers. N20 and N25 had higher PCA titers, while DS-CAV1-Trimer had the lowest. Figure 8D shows the results of the Elispot test. The N25C (i.e., SCB-N25C_A) antigen combined with Alum adjuvant can produce a strong Th1 cellular immune response. Antigens combined with Alum + CpG1018 adjuvant all produced lower Th2 cellular immune responses. The antigen combined with the CAS-1 adjuvant, which contains squalene, α-tocopherol, and Tween-80, produced a high Th1 and Th2 cellular immune response.

[0065] Figures 9A and 9B show the immunogenicity experiment of the candidate vaccine using 3.1SCB-N25C_A RSV-infected mice. Figure 9A shows a schematic diagram of the experimental method: 6-8 week-old SPF-grade BALB / c female mice were infected with RSV virus by intranasal drip, and the mice developed natural immunity; 60 days later, the mice were randomly divided into 6 groups, 8 mice in each group, and each group of mice was immunized with 50μL of RSV virus candidate vaccine and control vaccine by intramuscular injection according to the table below, and only one immunization was performed; blood was collected from the orbital vein on day 0 and day 14, and serum was obtained by centrifugation. Figure 9B shows the experimental results of the immunogenicity experiment.

[0066] Figure 10 shows a schematic diagram of an exemplary fusion peptide comprising an extracellular B-type F domain fused to a trimerizing peptide.

[0067] Figure 11 shows the ELISA affinity test of multiple antibodies to RSV candidate vaccine antigens: A: Anti-RSV post-F (4D7) antibody; B: Human Anti-RSV F (AM22) antibody; C: D25 antibody; D: Anti-RSV F (RSB1) antibody.

[0068] Figure 12 shows the neutralizing antibody titer test results for RSV A2 and B18537 strains. A: Neutralizing antibody titer test results against hRSV A2 real virus; B: Neutralizing antibody titer test results against hRSV B18537 real virus.

[0069] Figures 13A-13C show the immunogenicity experiment of an exemplary trimeric fusion peptide bivalent vaccine on infected mice. Figure 13A shows a schematic diagram of the experimental method: 6-8 week old SPF-grade BALB / c female mice were infected with RSV virus by intranasal drip, and the mice developed natural immunity; 28 days later, the mice were randomly divided into 8 groups, each with 12 mice. Each group of mice was immunized with 50μl of RSV virus candidate vaccine and control vaccine by intramuscular injection according to the table below, and only one immunization was performed; blood was collected through the orbital vein on days 0, 14, and 28, and serum was obtained by centrifugation. The bivalent vaccine is SCB-N25C_A+SCB-N25C_B, with a weight ratio of 1:1 and an aluminum dose of 75ug / dose. Figure 13B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses. FIG13C shows peptide library stimulation data for RSV subtype A and RSV subtype B F proteins.

[0070] Figures 14A-14B show the immunogenicity of an exemplary trimeric fusion peptide bivalent vaccine in non-human primates. Figure 14A shows a schematic diagram of the experimental method: SCB-N25C_A & B mixed with squalene emulsion adjuvant were injected intramuscularly into 10 male rhesus macaques, and the macaques produced an immune response; 28 days later, the macaques were randomly divided into two groups of 5, and each group of test monkeys was immunized intramuscularly with 500 μL of the RSV virus candidate vaccine according to the table below, for only one immunization; blood was collected on days 0, 14, 28, and 62 after immunization, and serum was obtained by centrifugation. The bivalent vaccine is SCB-N25C_A + SCB-N25C_B, with a weight ratio of 1:1, and a dose of 90 μg / antigen and 750 μg / dose of aluminum. FIG. 14B shows the neutralizing antibody titers induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 real viruses.

[0071] Figures 15A-15B show a mouse challenge experiment. Figure 15A shows a schematic diagram of the experimental method: a total of 56 mice, 24 6-8 week old SPF grade BALB / c female mice were infected with RSV virus by intranasal drops, and the mice developed natural immunity; the mice were randomly divided into 7 groups with 8 mice in each group, 3 groups of infected mice, and 4 groups of uninfected mice. Each group of mice was immunized with 50 μL of RSV virus candidate vaccine and control vaccine by intramuscular injection according to the table below; on the 49th day, blood was collected through the orbital vein and centrifuged to obtain serum. On the 54th day, the mouse viral load and lung pathological sections were tested. The bivalent vaccine is SCB-N25C_A+SCB-N25C_B, with a weight ratio of 1:1, a dose of 18 μg / antigen and 75 μg / dose of aluminum. Figure 13B shows the neutralizing antibody titer values ​​induced by the bivalent trimerization fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses.

[0072] Figures 16A-16C show a head-to-head comparison of immunogenicity between an exemplary trimerization fusion peptide vaccine and an already marketed RSV vaccine. Figure 16A shows a schematic diagram of the experimental method: 6-8 week-old SPF-grade BALB / c female mice were intranasally infected with RSV virus to produce natural immunity; 60 days later, the mice were randomly divided into 3 groups, each with 8 mice. Each group of mice was immunized intramuscularly with 50 μL of the RSV virus candidate vaccine and control vaccine according to the table below, for only one immunization; blood was collected from the orbital vein on days 0, 14, and 28, and serum was obtained by centrifugation. Figure 16B shows a head-to-head comparison of neutralizing antibodies between the trimerization fusion peptide vaccine and an already marketed RSV vaccine; Figure 16C shows the ratio of neutralizing antibodies to binding antibodies between the trimerization fusion peptide vaccine and an already marketed RSV vaccine.

[0073] FIG. 17 shows electron microscopic images of RSV A2 and B strains.

[0074] Figures 18A-18B show the immunogenicity experiment of an exemplary trimeric fusion peptide bivalent vaccine on normal healthy naive mice. Figure 18A shows a schematic diagram of the experimental method: the mice were randomly divided into 2 groups, 10 in each group, and each group of mice was immunized with the RSV virus candidate vaccine by intramuscular injection according to the table below, twice, on D0 and D21; blood was collected through the orbital vein on the 35th day, and serum was obtained by centrifugation. The bivalent vaccine is SCB-1019T (A) + SCB-1019T (B), with a weight ratio of 1: 1, and an aluminum agent of 75ug / dose. Figure 18B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses.

[0075] Figures 19A-19B show the immunogenicity experiment of an exemplary trimeric fusion peptide bivalent vaccine on infected mice. Figure 19A shows a schematic diagram of the experimental method: 6-8 week old SPF-grade BALB / c female mice were infected with RSV virus by intranasal drip, and the mice developed natural immunity; 28 days later, the mice were randomly divided into 3 groups, each with 10 mice. Each group of mice was immunized with 50μl of RSV virus candidate vaccine and commercial GSK control vaccine by intramuscular injection according to the table below, and only one immunization was performed; blood was collected from the orbital vein on days 0, 14, 28, and 56, and serum was obtained by centrifugation. The bivalent vaccine is SCB-1019T (A) + SCB-1019T (B), with a weight ratio of 1:1 and an aluminum dose of 75ug / dose. Figure 19B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 real viruses.

[0076] Figures 20A-20D show a cotton rat challenge experiment. Figure 20A shows a schematic diagram of the experimental method: a total of 14 cotton rats, 5 of which were infected with RSV virus by intranasal drip, and the natural immunity was set as the first group; 2 groups of uninfected mice, each group of mice was immunized with 50 μL of RSV virus candidate vaccine and control vaccine by intramuscular injection according to the table below; on week 9, that is, D21 post boost and 5 days after the challenge, blood was collected through the orbital vein, and serum was obtained by centrifugation. The mouse viral load and lung pathological sections were detected on day 68. The bivalent vaccine is SCB-1019T (A) + SCB-1019T (B), the weight ratio of the dosage is 1: 1, and the dose is 90 μg / antigen. Figure 20B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses. Figure 20C shows the pathological score. Figure 20D shows the lung viral load. DETAILED DESCRIPTION

[0077] In some embodiments, compositions and methods of use of recombinant soluble surface antigens from RNA viruses in the form of covalently linked trimers are disclosed. In some embodiments, the resulting fusion protein is secreted as a disulfide-linked homotrimer, which is structurally more stable while retaining the conformation of the native-like trimeric viral antigen and can therefore be used as a more effective vaccine against these dangerous pathogens.

[0078] In some embodiments, disclosed herein are methods of preventing viral infection using viral antigen trimers as a vaccine or as part of a multivalent vaccine, with or without an adjuvant or with more than one adjuvant, optionally by intramuscular injection or intranasal administration.

[0079] In some embodiments, disclosed herein is a method for diagnosing viral infection using viral antigen trimers as antigens by detecting antibodies, such as IgM or IgG, such as neutralizing antibodies, that recognize the viral antigens.

[0080] In some embodiments, disclosed herein are methods for using viral antigen trimers as antigens to generate polyclonal or monoclonal antibodies that can be used for passive immunization, such as neutralizing mAbs for treating RSV infection in infants.

[0081] In some embodiments, disclosed herein is a viral antigen trimer as a vaccine or as part of a multivalent vaccine, wherein the vaccine comprises multiple trimeric subunit vaccines, wherein the multiple trimeric subunit vaccines comprise viral antigens of the same viral protein or viral antigens of two or more different proteins of one or more viruses or one or more strains of the same virus.

[0082] In some embodiments, disclosed herein is a monovalent vaccine comprising a viral antigen trimer disclosed herein. In some embodiments, disclosed herein is a bivalent vaccine comprising a viral antigen trimer disclosed herein. In some embodiments, disclosed herein is a trivalent vaccine comprising a viral antigen trimer disclosed herein. In some embodiments, disclosed herein is a tetravalent vaccine comprising a viral antigen trimer disclosed herein.

[0083] In some embodiments, disclosed herein is a monovalent vaccine comprising an F trimer disclosed herein. In some embodiments, disclosed herein is a bivalent vaccine comprising an F trimer disclosed herein. In some embodiments, disclosed herein is a bivalent vaccine comprising at least one F trimer comprising a first F protein antigen and at least one F trimer comprising a second F protein antigen. In some embodiments, the first and second F protein antigens are derived from the same F protein from one or more viral species, strains, or subtypes, or from two or more different F proteins from one or more viral species, or from one or more strains or subtypes of the same viral species. In some embodiments, disclosed herein is a trivalent vaccine comprising an F trimer disclosed herein. In some embodiments, disclosed herein is a trivalent vaccine comprising at least one F trimer comprising a first F protein antigen, at least one F trimer comprising a second F protein antigen, and at least one F trimer comprising a third F protein antigen. In some embodiments, the first, second, and third F protein antigens are derived from the same F protein from one or more viral species, strains, or subtypes, or from two, three, or more different F proteins from one or more viral species, or from one or more strains or subtypes of the same viral species. In some embodiments, disclosed herein is a tetravalent vaccine comprising an F trimer disclosed herein. In some embodiments, disclosed herein is a tetravalent vaccine comprising at least one F trimer comprising a first F protein antigen, at least one F trimer comprising a second F protein antigen, at least one F trimer comprising a third F protein antigen, and at least one F trimer comprising a fourth F protein antigen. In some embodiments, the first, second, third, and fourth F protein antigens are derived from the same F protein of one or more viral species or strains / subtypes, or from two, three, four, or more different F proteins of one or more viral species or one or more strains / subtypes of the same viral species.

[0084] Provided herein are immunogenic compositions, methods, and uses of fusion peptides and proteins comprising RSV viral antigens or immunogens for, e.g., prophylactic or therapeutic treatment of RSV infection. Respiratory syncytial virus (RSV) is considered a leading cause of acute lower respiratory tract infections (ALRTI) in infants and young children, killing 7,000 to 20,000 more children worldwide each year. RSV infection is the second most common cause of death in infants in developing countries. In addition, RSV can cause severe disease in the elderly and immunocompromised populations. The effective prophylactic humanized mAb palivizumab It should only be used as a passive immunization measure for infants at high risk of RSV infection.

[0085] Despite decades of research, RSV vaccine development has been unsuccessful for a variety of reasons. For example, production, stability, and efficacy issues of RSV vaccine candidates have been difficult to overcome. In particular, safety is a major concern due to the recognition that formalin-inactivated RSV (FI-RSV) vaccines mediate vaccine-induced disease enhancement (VED).

[0086] The protein that comprises RSV viral antigen and immunogen provided herein, comprises recombinant polypeptide and fusion protein, can be used for effectively and safely treating (for example therapeutically, prophylactically) RSV and infect.For example, the protein therapy RSV that comprises RSV viral antigen and immunogen provided herein infects, without considering VED and / or antibody-dependent enhancement (ADE).In addition, the protein that comprises RSV viral antigen and immunogen provided herein is easy to produce, and shows stability under high stress conditions such as high temperature, extreme pH and hyperosmotic pressure and hypoosmotic pressure.Therefore, the protein that this paper provided and immunogenic composition circumvent and meet the production, stability, safety and effectiveness problem that hinder RSV vaccine development.

[0087] In some aspects, the RSV viral antigens and immunogens provided herein comprise RSV glycoprotein (F), also referred to herein as RSV F protein peptide or peptide. RSV F protein peptide is a homotrimeric type I transmembrane protein that mediates membrane and viral penetration into host cells. RSV F protein peptide is synthesized as F0 proprotein precursor, which is converted into disulfide-linked F1 and F2 mature forms after being cleaved by furin at two sites. RSV F protein peptide is highly conserved between RSV A and B strains. Neutralizing antibodies such as palivizumab target the antigenic site of F, and provide protection for respiratory diseases caused by RSV infection.

[0088] In some embodiments, the protein comprising RSV viral antigens or immunogens, such as RSV F protein peptides, can produce an immune response, such as an immune response to RSV F peptide protein. In some embodiments, the immune response suppresses or reduces the duplication of RSV in a subject, such as a patient. In some embodiments, the immune response comprises producing one or more neutralizing antibodies, such as polyclonal and / or monoclonal antibodies. In some embodiments, the neutralizing antibodies suppress or reduce the duplication of RSV in a subject, such as a patient. In some embodiments, the subject is administered protein (such as in the form of an immunogenic composition) and will not cause antibody-dependent enhancement (ADE) due to prior exposure to RSV. In some respects, the protein comprising RSV viral antigens and immunogens, such as RSV F protein peptides, is used as a vaccine.

[0089] In some embodiments, RSV viral antigen and immunogen, for example RSV F protein peptides, are connected to protein or peptide to form fusion rotein or recombinant polypeptide.In some embodiments, the protein to which RSV viral antigen or immunogen are connected or peptide can be associated with protein or peptide, such as protein or peptide of fusion rotein or recombinant polypeptide, for example covalently or non-covalently connected.Therefore, in some cases, the protein to which RSV viral antigen or immunogen are connected or peptide are multimerization domains.

[0090] In some embodiments, RSV viral antigens and immunogens, such as RSV F protein peptides, are connected to collagen propeptides, such as collagen propeptide C-terminus, to form fusion peptides or recombinant polypeptides. Therefore, in some embodiments, the protein provided herein comprises a recombinant polypeptide containing RSV viral antigens and immunogens, such as RSV F protein peptides or fragments or epitopes thereof, connected to collagen C-terminal propeptides. In some embodiments, the collagen propeptides are derived from human α1 collagen C propeptides and are capable of self-trimerization.

[0091] In some embodiments, RSV viral antigens and immunogens, such as RSV F protein peptides are connected to collagen propeptide, such as collagen propeptide C-terminal, contribute to the ability of protein to produce an immune response.For example, the generation of recombinant protein can retain the tertiary and quaternary structures of RSV F protein peptides, and this may be important to the accessibility of antigenic sites on the surface of the protein (such as neutralizing antibodies) that can induce an immune response. In addition, RSV F protein peptides are connected to proteins or peptides that can self-trimerization, thereby allowing recombinant protein to assemble, thereby simulating the natural homotrimeric structure of the RSV F protein peptides on the viral envelope.

[0092] In some embodiments, RSV F protein peptide is connected to collagen C-terminal propeptide to produce self-trimerized recombinant polypeptide.In some embodiments, protein provided herein comprises the propeptide of multiple self-trimerized RSV F protein peptide and collagen recombinant polypeptide, optionally wherein said multiple recombinant proteins form the structure of for example rosette (referring to Fig. 2 B of for example PCT / CN2021 / 099286, this PCT patent application is for all purposes incorporated herein by reference in its entirety).In some embodiments, the trimeric properties of recombinant protein contribute to the stability of protein.In some embodiments, the macrostructure (for example rosette) of multiple self-trimerization recombinant proteins contribute to the stability of protein.In some embodiments, the trimeric properties of recombinant protein and the macrostructure (for example rosette) of multiple self-trimerization recombinant proteins contribute to the stability of protein.In some embodiments, the trimeric properties of recombinant protein contribute to the ability of protein to produce immune response.In some embodiments, the macrostructure (for example rosette) of multiple self-trimerization recombinant proteins contribute to the ability of protein to produce immune response. In some embodiments, the trimeric nature of the recombinant protein and the macroscopic structure of multiple self-trimerized recombinant proteins contribute to the protein's ability to generate an immune response.

[0093] Also provided herein are immunogenic compositions comprising the proteins provided herein, methods of producing the proteins provided herein, methods of treating subjects with the proteins and compositions provided herein, and kits.

[0094] All publications, including patent documents, scientific papers, and databases, mentioned in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. To the extent that definitions set forth herein are contrary to or inconsistent with definitions set forth in patents, applications, published applications, and other publications incorporated by reference herein, the definitions set forth herein take precedence over those incorporated by reference herein.

[0095] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0096] I. Viral Antigens and Immunogens

[0097] Respiratory syncytial virus (RSV) is the most common cause of acute lower respiratory tract infections in infants and young children and represents a significant burden of disease in the elderly. Despite being characterized half a century ago, limited vaccines are available, and development efforts have been hampered by vaccine-mediated disease enhancement in children who received formalin-inactivated RSV in the 1960s. Challenges in antigen production, purity, stability, and potency of RSV vaccine candidates have also been obstacles to development.

[0098] In some embodiments, the protein provided herein comprises RSV viral antigens and / or immunogens. In some embodiments, RSV viral antigens and / or immunogens can promote or stimulate cell-mediated response and / or humoral response. In some embodiments, response (such as cell-mediated response or humoral response) includes producing antibodies, such as neutralizing antibodies. In some embodiments, neutralizing antibodies (NAb) directed against viral antigens and / or immunogens provide adaptive immune defense for RSV exposure by blocking the infection of susceptible cells. In some embodiments, the efficacy of vaccines for several viruses is owing to and / or is relevant to the ability of their induction of NAb. In some embodiments, RSV viral antigens or immunogens are RSV F protein peptides disclosed herein.

[0099] RSV F protein peptide is the envelope glycoprotein of respiratory syncytial virus (RSV) (RSV mentioned herein includes all subtypes, such as A subtype and B subtype, when the subtype is not clearly stated). RSV F protein peptide is translated into a single precursor polypeptide (named F0). RSV F mentioned herein includes all subtypes, such as A subtype and B subtype, when the subtype is not clearly stated, such as RSV F from A2RSV A2 strain (GenBank accession number AAC55970) and B Australian strain. RSV F protein mediates virus entry into cells and cell-cell fusion, is the target of neutralizing antibodies, and is highly conserved between RSV A and B strains. F0 can be cleaved into three fragments by cellular furin at Arg109 and Arg136. The shorter F2 polypeptide is covalently linked to the longer F1 polypeptide at the N-terminus by two disulfide bonds. The latter has an 18-amino acid fusion domain at the N-terminus and a hydrophobic transmembrane region near the C-terminus; and releases the middle 27-amino acid fragment. Neutralizing monoclonal antibodies palivizumab and motavizumab bind to RSV F antigenic site II (Asn258-Val278) and have been shown to have a protective effect on lower and upper respiratory tract RSV diseases in high-risk and full-term infants. The structure of the RSV F epitope polypeptides bound to these neutralizing antibodies is larger than that of linear peptides, with palivizumab binding to RSV F with nanomolar affinity and motavizumab binding to RSV F with picomolar affinity. Modeling predicts that the complete degree of palivizumab and motavizumab binding requires amino acids from one or two RSV F protomers, respectively. Therefore, retaining RSV F tertiary and quaternary structures may be very important in developing RSV F vaccines that retain the natural conformation of this important neutralization region.

[0100] In some embodiments, the F0 precursor polypeptide is 574 amino acids in length, as shown in SEQ ID NO: 68 or 70.

[0101] In some embodiments, the F0 precursor polypeptide is 574 amino acids in length, as shown in SEQ ID NO: 67 or 69.

[0102] In some embodiments, the RSV F protein peptides herein comprise substitutions at one or more or all of residues 106, 107, 108, 109, 133, 135, 136, wherein the substituted amino acids are selected from cysteine, alanine, threonine, tyrosine, glycine, or serine, or any combination thereof.

[0103] In some embodiments, the RSV F protein peptide herein comprises amino acids as set forth in SEQ ID NO: 68 or 70, with substitutions at one or more of residues 106, 107, 108, 109, 133, 135, 136 thereof, wherein the substituted amino acids are freely selected from cysteine, alanine, threonine, tyrosine, glycine, or serine, or any combination thereof.

[0104] In some embodiments, the RSV F protein peptide herein comprises a replacement, deletion, and / or insertion at and / or near residues 109, 136, 161, and / or 215. In some embodiments, the RSV F protein peptide herein comprises a replacement, deletion, and / or insertion at and / or near residues 109, 136, 161, and / or 215 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptide herein comprises an alanine or proline at any one or more of residues 109, 136, 161, and / or 215 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptide herein comprises an alanine at residue 109 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptide herein comprises an alanine at residue 136 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptide herein comprises an alanine at residues 109 and 136 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptides herein comprise a proline at residue 161 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptides herein comprise a proline at residue 215 of SEQ ID NO: 67 or 69. In some embodiments, the RSV F protein peptides herein comprise a proline at residues 161 and 215 of SEQ ID NO: 67 or 69.

[0105] In some embodiments, the RSV F protein peptide herein comprises alanine at residues 109 and 136 and proline at residues 161 and 215 of SEQ ID NO: 67 or 69.

[0106] In some embodiments, the RSV F protein peptide herein comprises a replacement, deletion, and / or insertion of any one or more of and / or near residues 131-154 of SEQ ID NO:31 or 32. In some embodiments, the RSV F protein peptide herein comprises a deletion of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or more of residues 131-154 of SEQ ID NO:31 or 32. In some embodiments, the RSV F protein peptide herein comprises a deletion of any one or more of residues 137-154 of SEQ ID NO:31 or 32. In some embodiments, the RSV F protein peptide herein comprises a deletion of any one or more of residues 137-146 of SEQ ID NO:31 or 32. In some embodiments, the RSV F protein peptides herein comprise glutamine at residues 133, 135, and 136 of SEQ ID NO: 31 or 32 and a deletion of residues 137-146.

[0107] In some embodiments, the RSV A subtype F protein peptide herein comprises amino acids 1-25 of the F0 precursor, which is the signal peptide MELLILKANAITTILTAVTFCFASG (SEQ ID NO: 71). In some embodiments, the RSV B subtype F protein peptide herein comprises amino acids 1-25 of the F0 precursor, which is the signal peptide MELLIHRSSA IFLTLAINAL YLTSS (SEQ ID NO: 72). In some embodiments, the precursor polypeptide F0 forms a precursor trimer. In some embodiments, the RSV F protein peptide herein is hydrolyzed and cleaved by one or more cellular proteases, for example, at a conserved furin consensus cleavage site to produce Pep 27 polypeptide (also referred to as p27), F1 polypeptide, and F2 polypeptide. In some embodiments, the Pep 27 polypeptide (e.g., amino acids 110-136 of the F0 precursor) is removed and, in some aspects, does not become part of a mature RSV F trimer. In some embodiments, the F2 polypeptide (which may be alternatively referred to herein as "F2" or "F2 subunit peptide") comprises amino acid residues 26-109 of the F0 precursor. In some embodiments, the F1 polypeptide (which may be alternatively referred to herein as "F1" or "F1 subunit peptide") comprises amino acid residues 137-574 of the F0 precursor and may include an extracellular region (e.g., residues 137-524), a transmembrane domain (e.g., residues 525-550), and a cytoplasmic domain (e.g., residues 551-574).

[0108] In some embodiments, the RSV F protein peptide herein comprises F1 and F2 polypeptides, which are connected by a disulfide bond to form a heterodimer, referred to as RSV F "protomer". In some embodiments, the RSV F protein peptide herein comprises three protomers that form an RSV F trimer, so it is a homotrimer of the three protomers. In some embodiments, the RSV F protein peptide herein is a mature RSV F trimer. In some embodiments, the RSV F protein peptide herein is membrane-bound. In some embodiments, the RSV F protein peptide herein is not membrane-bound. In some embodiments, the RSV F protein peptide herein is soluble and lacks a transmembrane region and a cytoplasmic region or a fragment thereof. For example, conversion to a soluble form can be achieved by truncating the RSV F protein at amino acid 513 (by removing the amino acid starting at 514), 514, 515, 516, 517, 518, 519, 520, 521, 522, 523 or 524. In nature, ripe RSV F trimer mediation virus and cell membrane fusion.Mature RSV F tripolymer fusion pre-conformation (this paper can be referred to as " pre-F " or before fusion) highly unstable (metastable) of RSV F trimer.But, once RSV virus and cell membrane dock after, RSV F protein trimer just carries out a series of conformational changes and transitions to highly stable fusion after (" post-F ") conformation.

[0109] In some embodiments, the RSV viral antigen or immunogen comprises a signal peptide (SP) (e.g., amino acids 1-22 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, a heptad repeat C (HRC) (e.g., F2, which can be amino acids 23-109 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, a furin cleavage site (FCS) (e.g., at the junction between amino acids 109 / 110 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, a 27-mer fragment (pep27) (e.g., amino acids 110-136 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, a putative fusion peptide (FP) (e.g., amino acids 137-155 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, a heptad repeat A (HRA) (e.g., amino acids 156-214 of SEQ ID NO: 68 or 70) or a fragment and / or mutant sequence thereof, domains I and II (e.g., SEQ ID NO: 31 or 32) or fragments and / or mutant sequences thereof, heptad repeat B (HRB) (e.g., amino acids 477-524 of SEQ ID NO: 68 or 70) or fragments and / or mutant sequences thereof, transmembrane (TM) domain (e.g., amino acids 525-550 of SEQ ID NO: 68 or 70) or fragments and / or mutant sequences thereof, and / or cytoplasmic (CP) domain (e.g., amino acids 551-574 of SEQ ID NO: 68 or 70) or fragments and / or mutant sequences thereof.

[0110] In some embodiments, the RSV viral antigen or immunogen are the RSV F protein peptides of RSV A hypotype. In some embodiments, the RSV viral antigen or immunogen are the RSV F protein peptides of RSV A2 hypotype. In some embodiments, the RSV viral antigen or immunogen are the RSV F protein peptides of RSV B hypotype. In some cases, the RSV F protein peptides are conservative between RSV hypotypes.

[0111] In some cases, the RSV viral antigen or immunogen is a fragment of the RSV F protein peptide. In some embodiments, the RSV viral antigen or immunogen is an epitope of the RSV F protein peptide. In some embodiments, the epitope is a linear epitope. In some embodiments, the epitope is a conformational epitope. In some embodiments, the epitope is a neutralizing epitope site, such as site I, II or IV. In some embodiments, all neutralizing epitopes of the RSV F protein peptide or its fragments exist as RSV viral antigens or immunogens.

[0112] In some cases, such as when the RSV viral antigen or immunogen is a fragment of an RSV F protein peptide, only a single subunit of the RSV F protein peptide is present.

[0113] In some embodiments, the RSV viral antigen or immunogen is or comprises an F1 subunit peptide. In some embodiments, the F1 subunit peptide is or comprises the amino acid sequence of 137-574 of wild-type F protein. In some embodiments, the RSV viral antigen or immunogen is or comprises an F2 subunit peptide. In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide containing a signal peptide, a heptad repeat C (HRC) peptide, a pep27 peptide, a fusion peptide (FP), a heptad repeat A (HRA) peptide, a domain I peptide, a domain II peptide or a heptad repeat B (HRB) peptide or any combination thereof. In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide containing a signal peptide. In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide containing a pep27 peptide. In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide containing a fusion peptide (FP) (also known as a fusion domain (FD)). In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide comprising a signal peptide, a pep27 peptide, and a fusion peptide (FP).

[0114] In some embodiments, the RSV viral antigens or immunogens comprise the RSV F protein peptides containing the F1 subunit and the F2 subunit of the F protein. In some embodiments, the RSV viral antigens or immunogens comprise the RSV F protein peptides containing the F1 subunit and the F2 subunit of the F protein. In some embodiments, the RSV viral antigens or immunogens comprise the RSV F protein peptides containing the F1 subunit and the F2 subunit of the F protein and not containing the pep 27 peptide. In some embodiments, the RSV viral antigens or immunogens comprise the RSV F protein peptides containing the F1 subunit, the F2 subunit, and the pep 27 peptide of the F protein. In some embodiments, the RSV viral antigens or immunogens comprise the RSV F protein peptides containing the F1 subunit, the F2 subunit, the pep 27 peptide and the FP of the F protein.

[0115] In some cases, such as when the viral antigen or immunogen comprises both the F1 subunit peptide and the F2 subunit peptide of the RSV F protein peptide, the F1 and F2 subunits are linked. In some embodiments, the F1 and F2 subunits are linked by a disulfide bond. In some embodiments, the F1 and F2 subunits are linked by a pep27 peptide. For example, in some embodiments, the N-terminus to C-terminus orientation is or comprises F2-pep27-F1. In some embodiments, the N-terminus to C-terminus orientation is or comprises F2-pep27-FP-F1 (F2-pep27-FD-F1). In some embodiments, FP is considered a structural feature of the F1 subunit peptide. In some embodiments, the F1 and F2 subunits are linked by an artificially introduced linker. For example, in some embodiments, the N-terminus to C-terminus orientation is or comprises F2-artificially introduced linker-F1. The artificially introduced linker is a non-amino acid compound or one or more amino acids. In some embodiments, the F1 and F2 subunits are linked by an artificially introduced linker. In some embodiments, the one or more amino acids are CGGG (SEQ ID NO: 138). For example, in some embodiments, the direction from the N-terminus to the C-terminus is or comprises F2-artificially introduced linker-F1, wherein F2 lacks furin site I, and / or F1 lacks furin site II, and / or lacks pep27 peptide, specifically, the artificially introduced linker replaces furin site I, the artificially introduced linker replaces furin site II, the artificially introduced linker replaces furin site I and PEP 27 peptide, and the artificially introduced linker connects and replaces furin site I and PEP 27 peptide and one or more bases connected to furin site II. In some embodiments, the one or more bases that are substituted are selected from FLGFLLGV (SEQ ID NO: 126), such as F, FL, FLG, FLGF (SEQ ID NO: 127), FLGFL (SEQ ID NO: 128), FLGFLL (SEQ ID NO: 129), FLGFLLG (SEQ ID NO: 130), or FLGFLLGV (SEQ ID NO: 131). In some embodiments, the F1 polypeptide may comprise amino acid residues 145-574 of the F0 precursor, or may comprise the extracellular region (e.g., residues 145-520). In some embodiments, the F2 polypeptide may comprise amino acid residues 26-105 or 1-105 of the F0 precursor.

[0116] In some cases, RSV viral antigen or immunogen are RSV F protein peptides that do not contain transmembrane (TM) domain peptides.In some cases, described RSV F albumen does not contain cytoplasm (CP) domain peptides.In some cases, described RSV F albumen does not contain TM domain peptides or CP domain peptides.

[0117] In some embodiments, the RSV viral antigen or immunogen comprises an RSV F protein peptide that contains a protease cleavage site. In some embodiments, the protease cleavage site is specific to the cutting of the protease furin. In some embodiments, the protease cleavage site is specific to the cutting of the protease trypsin. In some embodiments, the protease cleavage site is specific to the cutting of protease factor Xa. In some embodiments, the protease cleavage site is specific to the cutting of the protease cathepsin L.

[0118] In some cases, the RSV viral antigens or immunogens comprise RSV F protein peptides that do not contain a protease cleavage site. In some cases, the RSV viral antigens or immunogens comprise RSV F protein peptides that do not contain a protease cleavage site specific for the cutting of the protease furin. In some cases, the RSV viral antigens or immunogens comprise RSV F protein peptides that do not contain a protease cleavage site specific for the cutting of the protease trypsin. In some cases, the RSV viral antigens or immunogens comprise RSV F protein peptides that do not contain a protease cleavage site specific for the cutting of the protease factor Xa. In some cases, the RSV viral antigens or immunogens comprise RSV F protein peptides that do not contain a protease cleavage site specific for the cutting of the protease cathepsin L.

[0119] In some embodiments, the RSV viral antigen or immunogen comprise soluble RSV F protein peptides. In some embodiments, the soluble RSV F protein peptides lack TM domain peptides and CP domain peptides. In some embodiments, the soluble RSV F protein peptides are not attached to a lipid bilayer, such as a film or a viral envelope.

[0120] In some embodiments, the RSV F protein peptide is produced by a codon-optimized nucleic acid sequence. In some embodiments, the RSV F protein peptide is produced by a non-codon-optimized nucleic acid sequence.

[0121] In some embodiments, the RSV F protein peptide can comprise any F protein sequence known in the art, such as those disclosed in US Patent No. 10,017,543, which is herein incorporated by reference in its entirety for all purposes.

[0122] In some embodiments, the RSV viral antigen or immunogen is or comprises an RSV F protein peptide having an amino acid sequence of 1-520 of SEQ ID NO: 68 or 70. In some embodiments, the RSV viral antigen or immunogen is or comprises an RSV F protein peptide having an amino acid sequence of 26-520 of SEQ ID NO: 68 or 70.

[0123] In some embodiments, the RSV viral antigen or immunogen are or comprise the sequence of F2, the sequence of pep27 and the sequence of F1 (such as F2-pep27-F1).In some embodiments, the RSV viral antigen or immunogen comprise fusogenic peptide and expose and have fusion rear conformation.In some embodiments, the RSV viral antigen or immunogen comprise furin cleavage site sudden change.In some embodiments, the RSV viral antigen or immunogen comprise furin site I sudden change (for example R109A) and / or furin site II sudden change (for example R136A), in these examples some in, the RSV viral antigen or immunogen have fusion rear conformation, and in other examples, the RSV viral antigen or immunogen have fusion front conformation.In some embodiments, the RSV viral antigen or immunogen comprise furin site I sudden change and furin site II sudden change (for example R109A / R136A), in these examples some in, the RSV viral antigen or immunogen comprise full length F0, do not have fusogenic peptide and expose and have fusion rear conformation. In some embodiments, the RSV viral antigen or immunogen include one or more mutations, and the mutation prevents the formation of long spirals and / or stable α4-α5 hinge loops. In some embodiments, the RSV viral antigen or immunogen include one or more mutations, and the mutation retains conformation before fusion. In some embodiments, the RSV viral antigen or immunogen include one or more mutations, and the mutation improves expression. In some embodiments, the replacement of position 161,182 and 215 (for example, with proline) causes higher expression levels, and E161P and S215P also increase protein stability. In some embodiments, the RSV viral antigen or immunogen include E161P and / or S215P and have conformation before fusion. In some embodiments, the RSV viral antigen or immunogen include R109A, R136A, E161P and / or S215P and have conformation before fusion.

[0124] In some embodiments, the RSV viral antigen or immunogen comprises an amino acid replacement at any one, any two, any three, any four, any five, or all of amino acid positions 106, 108, 109, 133, 135, 136 of the RSV F protein peptide. In some embodiments, one or more or all of amino acid positions 106, 108, 109, 133, 135, 136 are replaced with cysteine. In some embodiments, the RSV F protein peptide herein comprises residues 106, 108, 133, 135, 136 of SEQ ID NO: 1 or 21 are all replaced with cysteine.

[0125] In some embodiments, the viral antigen or immunogen comprises the sequence set forth in SEQ ID NO: 11 or 31. In some embodiments, the viral antigen or immunogen comprises an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of SEQ ID NO: 11 or 31, including sequences comprising substitutions, deletions and / or insertions at one or more amino acid positions. In some embodiments, the RSV F protein peptide herein comprises a substitution of one or more residues 106, 107, 108, 109, 133, 135, or 136 of SEQ ID NO: 11 or 31. In some embodiments, the RSV F protein peptide herein comprises residues 106, 108, 109, 133, 135, 136 of SEQ ID NO: 11 or 31, at one or more of which are replaced. In some embodiments, the RSV F protein peptide herein comprises residues 106, 108, 109, 133, 135, 136 of SEQ ID NO: 11 or 31, at one or more of which are replaced with cysteine. In some embodiments, the RSV F protein peptide herein comprises residues 106, 108, 133, 135, 136 of SEQ ID NO: 11 or 31, at all of which are replaced with cysteine. The RSV F protein peptide herein comprises residues 108, 133, 135, 136 of SEQ ID NO: 11 or 31, at all of which are replaced with cysteine. The RSV F protein peptide herein comprises residues 133, 135, 136 of SEQ ID NO: 11 or 31, at all of which are replaced with cysteine. The RSV F protein peptide herein comprises residues 135 and 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residue 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residue 135 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, 135, 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 135, 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, 136 of SEQ ID NO: 11 or 31 replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, 135 of SEQ ID NO: 11 or 31 replaced with cysteine.The RSV F protein peptide herein comprises residues 106 and 136 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 135 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 136 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 135 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 133 of SEQ ID NO: 104, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 133 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 133 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 133 of SEQ ID NO: 11 or 31, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 108, 133, 135, and 136 of SEQ ID NO: 11 or 31, all replaced with alanine. The RSV F protein peptide herein comprises residues 106, 108, 133, 135, and 136 of SEQ ID NO: 11 or 31, all replaced with threonine. The RSV F protein peptide herein comprises residues 106, 108, 133, 135, and 136 of SEQ ID NO: 11 or 31, all replaced with tyrosine. The RSV F protein peptide herein comprises residues 106, 108, 133, 135, and 136 of SEQ ID NO: 11 or 31, all replaced with histidine. The RSV F protein peptide herein comprises residues 106, 108, 133, 135, and 136 of SEQ ID NO: 11 or 31, all of which are replaced with serine.

[0126] In some embodiments, the viral antigen or immunogen comprises a sequence as set forth in any one of SEQ ID NOs: 11-20, 31-40, 49-53, 62-120. In some embodiments, the viral antigen or immunogen comprises an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NOs: 11-20, 31-40, 49-53, 62-120, including sequences comprising substitutions, deletions and / or insertions at one or more amino acid positions.

[0127] In some embodiments, the viral antigen or immunogen comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, the viral antigen or immunogen comprises an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of SEQ ID NO: 100, including sequences comprising substitutions, deletions and / or insertions at one or more amino acid positions. In some embodiments, the RSV F protein peptide herein comprises one or more substitutions at residues 106, 107, 108, 109, 133, 135, 136 of SEQ ID NO: 100. In some embodiments, the RSV F protein peptide herein comprises one or more replacements of residues 106, 108, 109, 133, 135, and 136 of SEQ ID NO: 100. In some embodiments, the RSV F protein peptide herein comprises one or more replacements of residues 106, 108, 109, 133, 135, and 136 of SEQ ID NO: 102 with cysteine. In some embodiments, the RSV F protein peptide herein comprises one or more replacements of residues 106, 108, 109, 133, 135, and 136 of SEQ ID NO: 100 with cysteine. The RSV F protein peptide herein comprises one or more replacements of residues 108, 109, 133, 135, and 136 of SEQ ID NO: 100 with cysteine. The RSV F protein peptide herein comprises one or more replacements of residues 109, 133, 135, and 136 of SEQ ID NO: 100 with cysteine. The RSV F protein peptide herein comprises residues 133, 135, and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 135 and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residue 136 of SEQ ID NO: 100, replaced with cysteine. The RSV F protein peptide herein comprises residue 135 of SEQ ID NO: 100, replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, 135, and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 135, and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106, 133, and 136 of SEQ ID NO: 100, all replaced with cysteine.The RSV F protein peptide herein comprises residues 106, 133, and 135 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 135 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 136 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 135 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 133 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 106 and 133 of SEQ ID NO: 100, all replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 133 of SEQ ID NO: 100, all of which are replaced with cysteine. The RSV F protein peptide herein comprises residues 108 and 133 of SEQ ID NO: 100, all of which are replaced with cysteine.

[0128] In some embodiments, the viral antigens or immunogens herein may comprise RSV glycoprotein (G) or a fragment, variant or mutant thereof; RSV small hydrophobic protein (SH) or a fragment, variant or mutant thereof; RSV fusion protein (F) or a fragment, variant or mutant thereof; RSV matrix protein (M) or a fragment, variant or mutant thereof; RSV nucleoprotein (N) or a fragment, variant or mutant thereof; RSV phosphoprotein (P) or a fragment, variant or mutant thereof; RSV "large" protein (L) or a fragment, variant or mutant thereof; M2-1 protein or a fragment, variant or mutant thereof; RSV M2-2 protein or a fragment, variant or mutant thereof; RSV NS-1 protein or a fragment, variant or mutant thereof; or RSV Ns-2 protein or a fragment, variant or mutant thereof; or any combination thereof.

[0129] In some embodiments, the viral antigen or immunogen is produced by a codon-optimized nucleic acid sequence. In some embodiments, the viral antigen or immunogen is produced by a non-codon-optimized nucleic acid sequence.

[0130] In some embodiments, RSV viral antigen or immunogen mentioned herein can comprise recombinant polypeptide or the fusion polypeptide that comprises described viral antigen or immunogen.Term viral antigen or immunogen can be used for referring to and comprise RSV viral antigen or immunogenic protein.In some cases, described RSV viral antigen or immunogen are RSV protein peptides as provided herein.

[0131] II. Recombinant Peptides and Proteins

[0132] It is envisioned that RSV viral antigens and immunogens provided herein, for example RSV F protein peptides (referring to Section 1) can be combined with other proteins or peptides, for example, connected to form recombinant polypeptides, including fusogenic peptides. In some embodiments, individual recombinant polypeptides (for example monomers) provided herein associate to form a multimer, for example a trimer, of a recombinant polypeptide. In some embodiments, the association of individual recombinant polypeptide monomers occurs by covalent interactions. In some embodiments, the association of individual recombinant polypeptide monomers occurs by non-covalent interactions. In some embodiments, the protein or peptide to which the interaction (for example covalent or non-covalent) is connected by RSV viral antigens or immunogens (for example RSV F protein peptides) affects. In some embodiments, for example, when RSV viral antigens or immunogens are RSV F protein peptides as described herein, the protein or peptide to which it will be connected can be selected to retain the natural homotrimeric structure of glycoprotein. This may be conducive to stimulating the strong and effective immunogenic response to RSV F protein peptides. For example, retain and / or keep the natural conformation of RSV viral antigen or immunogen (such as RSV F protein peptides) can improve or allow approaching the antigenic site that can produce an immunne response.In some cases, the recombinant polypeptide comprising RSV F protein peptides as herein described (such as referring to Section 1) is alternatively referred to as recombinant RSV F antigen, recombinant RSV F immunogen or recombinant RSV F albumen in this article.

[0133] In some cases, it is also envisioned that the recombinant polypeptide or its polymerized recombinant polypeptide gather or can gather to form a protein that comprises multiple RSV viral antigens and / or immunogen recombinant polypeptide.The formation of this type of protein may help RSV viral antigens and / or immunogen produce strong and effective immunogenicity response.For example, the formation of the protein that comprises multiple recombinant polypeptides and therefore the formation of multiple RSV viral antigens (such as RSV F protein peptides) can retain tertiary and / or quaternary structure of viral antigen, thereby allow strengthening the immunne response for native structure.In some cases, gathering can give RSV viral antigen or immunogen structural stability, and then can approach the potential antigenic site that can promote immunne response.

[0134] 1. Fusion peptides and recombinant peptides

[0135] In some embodiments, RSV viral antigen or immunogen can be connected (C-terminus is connected) to trimerization domain at its C-terminus, to promote monomer trimerization.In some embodiments, trimerization has stabilized the membrane proximal situation of RSV viral antigen or immunogen (such as RSV F protein peptide) in trimeric conformation.

[0136] Non-limiting examples of exogenous multimerization domains that promote stable trimers of soluble recombinant proteins include: GCN4 leucine zipper (Harbury et al., 1993 Science 262: 1401-1407), a trimerization motif from lung surfactant protein (Hoppe et al., 1994 FEBS Lett 344: 191-195), collagen (McAlinden et al., 2003 J Biol Chem 278: 42200-42207), and bacteriophage T4 minor fibrin foldon (Miroshnikov et al., 1998 Protein Eng 11: 329-414), any of which can be linked to the recombinant RSV viral antigens or immunogens described herein (e.g., by linking to the C-terminus of the RSV F peptide) to promote trimerization of the recombinant viral antigens or immunogens. See also U.S. Patent Nos. 7,268,116, 7,666,837, 7,691,815, 10,618,949, 10,906,944, and 10,960,070, and US 2020 / 0009244, which are incorporated herein by reference in their entirety for all purposes.

[0137] In some embodiments, one or more peptide connectors (such as gly-ser connectors, e.g., 10 amino acid glycine-serine peptide connectors) can be used to connect the recombinant viral antigen or immunogen to the multimerization domain. The trimer can include any stabilizing mutations (or combinations thereof) described herein, as long as the recombinant viral antigen or immunogen trimer retains the desired properties (e.g., pre-fusion conformation).

[0138] To be therapeutically viable, the desired trimerization protein portion for biopharmaceutical design should meet the following criteria. Ideally, it should be a portion of a naturally secreted protein, such as immunoglobulin Fc, also abundant in the circulation (non-toxic), of human origin (lack of immunogenicity), relatively stable (long half-life), and able to efficiently trimerize itself (enhanced by interchain covalent disulfide bonds), so that the trimeric RSV viral antigen or immunogen structure is stable.

[0139] Collagen belongs to the fibrous protein family and is a major component of the extracellular matrix. It is the most abundant protein in mammals, comprising nearly 25% of the total protein in the body. Collagen plays a major structural role in the formation of bones, tendons, skin, cornea, cartilage, blood vessels, and teeth. The fibrillar types of collagen I, II, III, IV, V, and XI are synthesized as large, trimeric precursors called procollagens, consisting of a central, uninterrupted triple-helical domain composed of hundreds of "GXY" repeats (or glycine repeats) flanked by a non-collagenous domain (NC), an N-propeptide, and a C-propeptide. Both the C-terminal and N-terminal extensions undergo proteolytic processing after procollagen secretion, triggering the assembly of the mature protein into collagen fibrils, thereby forming an insoluble cellular matrix. BMP-1 is a protease that recognizes a specific peptide sequence in procollagen near the junction between the glycine repeats and the collagen C-proper domain and is responsible for removing the propeptide. The shed trimeric C-propeptide of type I collagen is found in normal adult human serum at concentrations ranging from 50 to 300 ng / mL, with levels much higher in children, indicating active bone formation. In individuals with familial high serum type I collagen C-propeptide concentrations, levels can be as high as 1-6 μg / mL without apparent abnormalities, suggesting that the C-propeptide is non-toxic. Structural studies of the collagen trimeric C-propeptide have revealed a trilobal structure in which all three subunits come together in a linker region near their N-termini, connecting to the rest of the procollagen molecule. The geometry of this protein to be fused, with one direction extending outward, resembles that of an Fc dimer.

[0140] Type I, IV, V, and XI collagens primarily assemble into heterotrimeric forms composed of two α-1 chains and one α-2 chain (for types I, IV, and V) or three distinct, highly sequenced chains (for type XI). Type II and III collagens are homotrimers of α-1 chains. Type I collagen, the most abundant collagen form, also forms stable α(I) homotrimers, present at variable levels in different tissues. Most of these collagen C propeptide chains can self-assemble into homotrimers when overexpressed alone in cells. Although the N propeptide domain is synthesized first, molecular assembly into trimeric collagen begins with the mutually aligned association of the C propeptides. The C propeptide complex is believed to be stabilized by the formation of interchain disulfide bonds, but the necessity of disulfide bond formation for proper chain alignment is unclear. The glycine triple helix repeats and then propagates in a zipper-like manner from the associated C-terminus to the N-terminus. This understanding has led to the creation of non-natural collagen matrices by exchanging the C-propeptides of different collagen chains using recombinant DNA technology. Non-collagenous proteins, such as cytokines and growth factors, have also been fused to the N-termini of procollagen or mature collagen to form new collagen matrices, a move intended to allow for the slow release of non-collagenous proteins from the cell matrix. However, in both cases, the C-propeptide must be cleaved before the recombinant collagen fibrils can assemble into an insoluble cell matrix.

[0141] Although other protein trimerization domains have been described previously, such as those from yeast GCN4, the minor fibrin of bacteriophage T4, and the aspartate transcarbamylase of Escherichia coli, which allow the trimerization of heterologous proteins, none of these trimerizing proteins are native human proteins, nor are they naturally secreted proteins. Therefore, any trimeric fusion protein must be produced intracellularly, which not only may cause naturally secreted proteins (such as soluble receptors) to fold incorrectly, but also makes it difficult to purify the fusion protein from thousands of other intracellular proteins. Furthermore, a fatal drawback of using such non-human protein trimerization domains (e.g., from yeast, phage, and bacteria) for trimeric biopharmaceutical design is their presumed immunogenicity in humans, rendering such fusion proteins ineffective shortly after they are injected into humans.

[0142] Therefore, the use of collagen in recombinant polypeptides as described herein has many advantages, including: (1) collagen is the most abundant protein secreted by mammals, comprising nearly 25% of the total protein in the body; (2) the major form of collagen exists naturally as a trimeric helix, with its globular C propeptide responsible for initiating trimerization; (3) the collagen trimeric C propeptide, released by hydrolysis of mature collagen, is found naturally in mammalian blood at submicrogram / ml levels and is known to be non-toxic to the body; (4) the linear triple helical region of collagen can be included as a linker, with a predicted spacing of each residue of Alternatively, it may be excluded from the fusion protein portion, thereby enabling precise adjustment of the distance between the protein to be trimerized and the collagen C propeptide for optimal biological activity; (5) the BMP1 recognition site that cleaves the C propeptide from the procollagen may be mutated or deleted to prevent disruption of the trimeric fusion protein; (6) the C propeptide domain trimerizes itself via disulfide bonds, which provides a universal affinity tag that can be used to purify any secreted fusion protein produced. In some embodiments, the collagen C propeptide to which RSV viral antigens and immunogens (e.g., RSV F protein peptides) are attached enables the recombinant production of a soluble, covalently linked homotrimeric fusion protein.

[0143] In some embodiments, RSV viral antigen or immunogen are connected to collagen C-terminal propeptide to form recombinant polypeptide.In some embodiments, the C-terminal propeptide of described recombinant polypeptide has formed interpolypeptide disulfide bond.In some embodiments, described recombinant protein has formed trimer.In some embodiments, described RSV viral antigen or immunogen are RSV F protein peptides as described in Section 1.

[0144] In some embodiments, the C-terminal propeptide is of human collagen. In some embodiments, the C-terminal propeptide comprises the C-terminal polypeptide of proα1(I), proα1(II), proα1(III), proα1(V), proα1(XI), proα2(I), proα2(V), proα2(XI), or proα3(XI), or a fragment thereof. In some embodiments, the C-terminal propeptide is or comprises the C-terminal polypeptide of proα1(I).

[0145] In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 103. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 103. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 104. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the C-terminal propeptide exhibits an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 105. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 106. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 107. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 107. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 108. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 108.

[0146] In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 109. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 109. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 110. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 110. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 111. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 111. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence set forth in SEQ ID NO: 112. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 112. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 115. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 113. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 114. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity to the sequence of SEQ ID NO: 114.

[0147] In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 115. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 115. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 116. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 116. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 117. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95%, or 97% sequence identity with the sequence of SEQ ID NO: 117. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of SEQ ID NO: 118. In some embodiments, the C-terminal propeptide is an amino acid sequence that has at least or about 85%, 90%, 92%, 95% or 97% sequence identity to the sequence of SEQ ID NO:118.

[0148] In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of a collagen trimerization domain (e.g., the C-propeptide of human α1(I) collagen), wherein the aspartic acid (D) in the BMP-1 site is replaced with asparagine (N), for example, wherein RAD is mutated to RAN. In some embodiments, the C-terminal propeptide is or comprises the amino acid sequence of a collagen trimerization domain (e.g., the C-propeptide of human α1(I) collagen), wherein the alanine (A) in the BMP-1 site is replaced with asparagine (N), for example, wherein RAD is mutated to RND. In some embodiments, the C-terminal propeptide herein may comprise a mutated BMP-1 site, for example, RSAN (SEQ ID NO: 121) replaces DDAN (SEQ ID NO: 122). In some embodiments, the C-terminal propeptide herein may comprise a BMP-1 site, for example, a sequence comprising a RAD (e.g., RADDAN (SEQ ID NO: 123)) sequence rather than a RAN (e.g., RANDAN (SEQ ID NO: 124)) or RND (e.g., RNDDAN (SEQ ID NO: 125)) sequence may be used in the fusion polypeptides disclosed herein.

[0149] In some embodiments, the C-terminal propeptide is or comprises an amino acid sequence that is a fragment of any one of SEQ ID NOs: 103-118.

[0150] In some embodiments, the C-terminal propeptide may comprise a sequence comprising a glycine-XY repeating sequence, wherein X and Y are independently any amino acid, or an amino acid sequence having at least 85%, 90%, 92%, 95%, or 97% identity thereto, capable of forming an interpolypeptide disulfide bond and trimerizing the recombinant polypeptide. In some embodiments, X and Y are independently proline or hydroxyproline.

[0151] In some cases where RSV F peptide protein (for example RSV viral antigen or immunogen, for example, referring to Section 1) is connected to C-terminal propeptide to form recombinant polypeptide, described recombinant polypeptide has formed trimer, thereby produces the homotrimer of RSV F protein peptide.In some embodiments, trimerized recombinant polypeptide contains the F protein peptide trimer of crutch-shaped rod.In some embodiments, the RSV F protein peptide of trimerized recombinant polypeptide is conformation before fusion.In some embodiments, the RSV F protein peptide of trimerized recombinant polypeptide is conformation after fusion.In some embodiments, described conformational state allows approaching the different antigenic sites on the F protein peptide.In some embodiments, described antigenic site is epitope, as linear epitope or conformational epitope.An advantage with described trimerized recombinant polypeptide is that the immunne response for various potential different antigenic sites can be strengthened.

[0152] In some embodiments, the trimerized recombinant polypeptide comprises individual recombinant polypeptides comprising the same viral antigen or immunogen. In some embodiments, the trimerized recombinant polypeptide comprises individual recombinant polypeptides each comprising a different viral antigen or immunogen than the other recombinant polypeptides. In some embodiments, the trimerized recombinant polypeptide comprises individual recombinant polypeptides wherein one of the individual recombinant polypeptides comprises a different viral antigen or immunogen than the other recombinant polypeptides. In some embodiments, the trimerized recombinant polypeptide comprises individual recombinant polypeptides wherein two of the individual recombinant polypeptides comprise the same viral antigen or immunogen, and the viral antigen or immunogen is different than the viral antigen or immunogen comprised by the remaining recombinant polypeptides.

[0153] In some embodiments, the recombinant polypeptide comprises any RSV viral antigen or immunogen described in Section 1. In some embodiments, the recombinant polypeptide comprises any RSV viral antigen or immunogen described in Section 1, as described herein, linked to a collagen C-terminal propeptide as described herein.

[0154] In some embodiments, the recombinant polypeptide or the fusion protein comprises a first sequence shown in any one of SEQ ID NOs: 11-20, 31-40, 49-53, 62-102 and 119-120 linked to a second sequence shown in any one of SEQ ID NOs: 103-118, wherein the C-terminus of the first sequence is directly linked to the N-terminus of the second sequence.

[0155] In some embodiments, the recombinant polypeptide or the fusion protein comprises a first sequence as set forth in any one of SEQ ID NOs: 11-20, 31-40, 49-53, 62-102, and 119-120 linked to a second sequence as set forth in any one of SEQ ID NOs: 103-118, wherein the C-terminus of the first sequence is indirectly linked to the N-terminus of the second sequence, for example, via a linker. In some embodiments, the linker comprises a sequence comprising a glycine-XY repeat sequence. In some embodiments, the recombinant polypeptide or the fusion protein comprises a first sequence as set forth in any one of SEQ ID NOs: 11-20, 31-40, and 119-120 linked to a second sequence as set forth in any one of SEQ ID NOs: 103-118, wherein the C-terminus of the first sequence is indirectly linked to the N-terminus of the second sequence, for example, via a linker. In some embodiments, the linker comprises a sequence comprising a glycine-XY repeat sequence. In some embodiments, the recombinant polypeptide or fusion protein comprises a first sequence set forth in any one of SEQ ID NOs: 49-53 and 62-102 linked to a second sequence set forth in any one of SEQ ID NOs: 103-118, wherein the C-terminus of the first sequence is indirectly linked to the N-terminus of the second sequence, for example, via a linker. In some embodiments, the linker comprises a sequence comprising a glycine-XY repeat sequence.

[0156] In some embodiments, the recombinant polypeptide is or comprises a sequence selected from the group consisting of SEQ ID NOs: 11-20, 31-40, 49-53, 62-102, and 119- 120. In some embodiments, the recombinant polypeptide is or comprises an amino acid sequence that has at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 64-71, 80-89, 98-99, 102-103.

[0157] In some embodiments, the recombinant polypeptide or fusion protein comprises a first sequence set forth in any one of SEQ ID NOs: 11-20, 31-40, 49-53, and 62-66 linked to a second sequence set forth in any one of SEQ ID NOs: 103-118, wherein the C-terminus of the first sequence is indirectly linked to the N-terminus of the second sequence, for example, via a linker. In some embodiments, the linker comprises a sequence comprising a glycine-XY repeat sequence.

[0158] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 1 or 21. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 1 or 21 having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, including at one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379 or 447 (relative to SEQ ID NO: NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21 comprising any one, two, three, four, five or more mutations selected from R106A, R108A, R133A, R135A, R136A or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21, comprising any one, two, three, four, five or more mutations selected from R106T, R108T, R133T, R135T, R136T, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21, comprising any one, two, three, four, five or more mutations selected from R106Y, R108Y, R133Y, R135Y, R136Y, or any combination thereof.In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21, comprising any one, two, three, four, five or more mutations selected from R106G, R108G, R133G, R135G, R136G, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 1 or 21, comprising any one, two, three, four, five or more mutations selected from R106S, R108S, R133S, R135S, R136S, or any combination thereof.

[0159] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 6 or 26. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: , 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO: 6 or 26) NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:6 or 26, comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 6 or 26 comprising any one, two, three, four, five or more mutations selected from R106A, R108A, R133A, R135A, R136A or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 6 or 261, comprising any one, two, three, four, five mutations selected from R106T, R108T, R133T, R135T, R136T, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 6 or 26, comprising any one, two, three, four, five mutations selected from R106Y, R108Y, R133Y, R135Y, R136Y, or any combination thereof.In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 6 or 26, comprising any one, two, three, four, five mutations selected from R106G, R108G, R133G, R135G, R136, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 6 or 26, comprising any one, two, three, four, five mutations selected from R106S, R108S, R133S, R135S, R136S, or any combination thereof.

[0160] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 2 or 22. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: , 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO: 2 or 22) NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 2 or 22, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 2 or 22 comprising any one, two, three, four, five or more mutations selected from R106C, R108C, R133C, R135C, R136C or any combination thereof.

[0161] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 3 or 23. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: or 23 having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, including at one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379 or 447 (relative to SEQ ID NO: NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:3 or 23, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 3 or 23 comprising any one, two, three, four, five or more mutations selected from R108C, R133C, R135C, R136C, or any combination thereof.

[0162] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 4 or 24. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the sequence of SEQ ID NO: 4, including at least one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO: 4). NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:4 or 24, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 T, R133T, R135T, R136T, R106Y, R108Y, R133Y, R135Y, R136Y, R106G, R108G, R133G, R135G, R136G, R106S, R108S, R133S, R135S, R136S, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 4 or 24, comprising any one, two, three, four, five or more mutations selected from R133C, R135C, and R136C, or any combination thereof.

[0163] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 5 or 25. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: , 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO: 5 or 25) NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:5 or 25, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 R135S, R136S, R106S, R108S, R133S, R135S, R136S, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 5 or 25 comprising one or more mutations selected from R135C and R136C.

[0164] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 7 or 27. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the sequence of SEQ ID NO: 6, including at least one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO: 6). NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:7 or 27, comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 7 or 27 comprising any one, two, three, four, five or more mutations selected from R106C, R108C, R133C, R135C, R136C or any combination thereof.

[0165] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 8 or 28. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 8 or 28 has an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, including at one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379 or 447 (relative to SEQ ID NO: NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:8 or 28, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 8 or 28 comprising any one, two, three, four, five or more mutations selected from R108C, R133C, R135C, R136C or any combination thereof.

[0166] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 9 or 29. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 8 has an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, including at one or more amino acid positions such as 102, 106, 107, 108, 109, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379 or 447 (relative to SEQ ID NO: NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO:9 or 29, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 R133C, R135C, R136C, or any combination thereof.

[0167] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 10 or 30. In some embodiments, the recombinant polypeptide is or comprises the sequence shown in SEQ ID NO: 98, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 161, 215, 218, 379, or 447 (relative to SEQ ID NO:9) NO:67, 68, 69 or 70) or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 10 or 30, the variant comprising P102A, R109A, R136A, E161P, E218A, S215P, I379A, M447V, R106C, R108C, R133C, R135C, R136C, R106A, R108A, R133A, R135A, R136A, R106T, R108 R135S, R136S, R106Y, R108Y, R133Y, R135Y, R136Y, R106G, R108G, R133G, R135G, R136G, R106S, R108S, R133S, R135S, R136S, or any combination thereof. In some embodiments, the recombinant polypeptide is or comprises a variant of SEQ ID NO: 10 or 30 comprising one or two mutations selected from R135C, R136C.

[0168] In some embodiments, the recombinant polypeptide is or comprises the sequence shown in any one of SEQ ID NOs: 1-10, 21-30, 41-48, 54-61. In some embodiments, the recombinant polypeptide is or comprises an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 1-10, 21-30, 41-48, 54-61.

[0169] As pointed out above, in some embodiments, recombinant polypeptide provided herein not only associates to form a trimer, but also can assemble or be assembled to produce a protein that comprises a plurality of recombinant polypeptides.In some embodiments, formed protein has macrostructure.In some cases, macrostructure can give RSV viral antigen or immunogen recombinant polypeptide structural stability, and then can approach the potential antigenic site that can promote immunne response.

[0170] In some embodiments, the trimerized recombinant polypeptides aggregate to form a protein comprising multiple trimerized recombinant polypeptides. In some embodiments, the multiple trimerized recombinant polypeptides form a protein having a macrostructure. In some embodiments, the protein comprises a rosette-like oligomer comprising a crutch-shaped rod-shaped F protein peptide trimer.

[0171] In some embodiments, provided herein is a complex comprising any suitable combination of recombinant polypeptides selected from SEQ ID NOs: 1-10, 21-30, 41-48 and 54-61, or fragments, variants or mutants thereof. In some embodiments, provided herein is a complex comprising a trimer of recombinant polypeptides selected from SEQ ID NOs: 1-10, 21-30, 41-48 and 54-61, or fragments, variants or mutants thereof, wherein the recombinant polypeptides are trimerized via inter-polypeptide disulfide bonds to form the trimer.

[0172] In some embodiments, the proteins comprising multiple recombinant polypeptides described herein are immunogens. In some embodiments, the proteins comprising multiple recombinant polypeptides described herein are contained in nanoparticles. For example, in some embodiments, the proteins are directly attached to nanoparticles, such as protein nanoparticles. In some embodiments, the proteins are indirectly attached to nanoparticles. In some embodiments, the proteins comprising multiple recombinant polypeptides described herein are contained in virus-like particles (VLPs).

[0173] 2. Polynucleotides and Vectors

[0174] Also provided are polynucleotides (nucleic acid molecules) encoding the RSV antigens or immunogens and recombinant polypeptides provided herein, as well as vectors for genetically engineering cells to express such RSV antigens or immunogens and recombinant polypeptides.

[0175] In some embodiments, the polynucleotides of the recombinant polypeptide that coding this paper provides are provided.Aspect some, described polynucleotides contain single nucleotide sequence, as the nucleotide sequence of encoding recombinant polypeptide.In other cases, described polynucleotides contain the first nucleotide sequence that coding comprises specific RSV viral antigen or immunogenic recombinant polypeptide and coding comprises different RSV viral antigen or immunogenic second nucleotide sequence of recombinant polypeptide.

[0176] In some embodiments, the polynucleotide encoding the recombinant polypeptide contains at least one promoter operably linked to control the expression of the recombinant polypeptide. In some embodiments, the polynucleotide contains two, three or more promoters operably linked to control the expression of the recombinant polypeptide.

[0177] In some embodiments, for example, when the polynucleotide contains two or more nucleic acid encoding sequences, such as encoding a sequence of a recombinant polypeptide comprising different RSV viral antigens or immunogens, at least one promoter is operably connected to control the expression of the two or more nucleic acid sequences. In some embodiments, the polynucleotide contains two, three or more promoters, and the promoter is operably connected to control the expression of the recombinant polypeptide.

[0178] In some embodiments, the expression of the recombinant polypeptide is inducible or conditional. Therefore, in some aspects, the polynucleotide encoding the recombinant polypeptide contains a conditional promoter, enhancer or transactivator. In some such aspects, the conditional promoter, enhancer or transactivator is an inducible promoter, enhancer or transactivator, or an inhibitory promoter, enhancer or transactivator. For example, in some embodiments, an inducible or conditional promoter can be used to confine the expression of the recombinant polypeptide to a specific microenvironment. In some embodiments, expression driven by an inducible or conditional promoter is regulated by exposure to exogenous factors such as heat, radiation or drugs.

[0179] In the case where the polynucleotide contains more than one nucleic acid sequence encoding a recombinant polypeptide, the polynucleotide may also include a nucleic acid sequence encoding a peptide between one or more nucleic acid sequences. In some cases, the peptide encoded by the nucleic acid between the nucleic acid sequences separates the translation products of the nucleic acid sequences during or after translation. In some embodiments, the peptide contains an internal ribosome entry site (IRES), a self-cleaving peptide, or a peptide that causes ribosome skipping, such as a T2A peptide.

[0180] In some embodiments, the polynucleotide encoding the recombinant polypeptide is introduced into a composition containing cultured cells (e.g., host cells), such as by retroviral transduction, transfection, or transformation. In some embodiments, this can allow expression (e.g., production) of the recombinant polypeptide. In some embodiments, the expressed recombinant polypeptide is purified.

[0181] In some embodiments, provided herein are polynucleotides (nucleic acid molecules) encoding RSV viral antigens or immunogens as described herein. In some embodiments, provided herein are polynucleotides (nucleic acid molecules) encoding recombinant polypeptides comprising RSV viral antigens or immunogens, such as RSV F peptide proteins as described herein.

[0182] Also provided are vectors or constructs containing nucleic acid molecules as described herein. In some embodiments, the vector or construct contain one or more promoters, and the promoter is operably connected to the nucleic acid molecules encoding recombinant polypeptides to drive their expression. In some embodiments, the promoter is operably connected to one or more than one nucleic acid molecules, such as nucleic acid molecules encoding recombinant polypeptides containing different RSV viral antigens or immunogens.

[0183] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a retroviral vector. In some embodiments, the retroviral vector is a lentiviral vector. In some embodiments, the retroviral vector is a gammaretroviral vector.

[0184] In some embodiments, described vector or construct include single promoter, and described promoter drives the expression of one or more nucleic acid molecules of polynucleotide.In some embodiments, this type of promoter can be polycistronic (bicistronic or tricistronic, referring to, for example, U.S. Patent number 6,060,273).For example, in some embodiments, transcription unit can be engineered to contain the bicistronic unit of IRES (internal ribosome entry site), thus allows by the signal coexpression gene product (for example, encoding different recombinant polypeptides) from single promoter.In some embodiments, provided herein is a bicistronic carrier, thereby allows described carrier to contain and express two nucleotide sequences.In some embodiments, provided herein is a tricistronic carrier, thereby allows described carrier to contain and express three nucleotide sequences.

[0185] In some embodiments, a single promoter guides RNA expression, and the RNA contains two or three genes (e.g., encoding a chimeric signaling receptor and encoding a recombinant receptor) in a single open reading frame (ORF), and the genes are separated from each other by sequences encoding self-cleaving peptides (e.g., 2A sequences) or protease recognition sites (e.g., furin). The ORF therefore encodes a single polypeptide, which is processed into individual proteins during translation (in the case of 2A) or after translation. In some cases, the peptide, such as T2A, may cause the ribosome to skip (ribosome skipping) the peptide bond at the C-terminus of the synthetic 2A element, resulting in the 2A sequence end being separated from the next downstream peptide (see, e.g., de Felipe. Genetic Vaccines and Ther. 2: 13 (2004); and de Felipe et al., Traffic 5: 616-626 (2004)). Many 2A elements are known in the art. Examples of 2A sequences that can be used in the methods and nucleic acids disclosed herein include, but are not limited to, 2A sequences from foot-and-mouth disease virus (F2A), equine rhinitis virus (E2A), Thosea asigna virus (T2A), and porcine teschovirus-1 (P2A) as described in U.S. Patent Publication No. 20070116690.

[0186] In some embodiments, the vector is contained in a virus. In some embodiments, the virus is a pseudovirus. In some embodiments, the virus is a virus-like particle. In some embodiments, the vector is contained in a cell. In some embodiments, the virus or cell containing the vector contains a recombinant genome.

[0187] III. Immunogenic Compositions and Formulations

[0188] In some embodiments, there is provided herein an immunogenic composition, the immunogenic composition comprising a trimer of a recombinant polypeptide or any two or more combinations of the trimer, the recombinant polypeptide comprising a sequence selected from SEQ ID NO: 1-10, 21-30, 41-48 and 54-61. In some embodiments, the unit dose of the immunogenic composition may include about 10 μg to about 100 μg of RSV F antigen, preferably about 25 μg to about 75 μg of RSV F antigen, preferably about 40 μg to about 60 μg of RSV F antigen or about 50 μg of RSV F antigen. In some embodiments, the dosage contains 3 μg of RSV F antigen. In other embodiments, the dosage contains 9 μg of RSV F antigen. In other embodiments, the dosage contains 30 μg of RSV F antigen.

[0189] In some cases, it may be necessary to combine the disclosed immunogen with other medicines (e.g., vaccines) that induce the protective response to other factors. For example, compositions comprising recombinant RSV F antigens as described herein (e.g., trimers or proteins) can be administered simultaneously (usually separately) or sequentially with other vaccines such as influenza vaccines or varicella zoster vaccines recommended by the U.S. Advisory Committee on Immunization Practices (ACIP; cdc.gov / vaccines / acip / index.html) for target age groups (e.g., approximately 1 to 6 month old infants). Therefore, disclosed immunogens comprising recombinant RSV F antigens as described herein can be administered simultaneously or sequentially with vaccines such as for hepatitis B (HepB), diphtheria, tetanus, and pertussis (DTaP), pneumococcus (PCV), Haemophilus influenzae type b (Hib), polio, influenza, and rotavirus.

[0190] Multivalent or combination vaccines provide protection against multiple pathogens. In some cases, multivalent vaccines can provide protection against multiple strains or strains of the same pathogen. In some cases, multivalent vaccines provide protection against multiple pathogens, such as the combination vaccine Tdap, which provides protection against strains of tetanus, pertussis, and diphtheria. Multivalent vaccines are ideal for minimizing the number of immunizations required to provide protection against multiple pathogens or strains or strains of pathogens, reducing administration costs, and increasing coverage. This can be particularly useful, for example, when vaccinating infants or children.

[0191] In some embodiments, for example, a vaccine comprising an immunogenic composition as described herein is a multivalent vaccine (e.g., a bivalent vaccine). In some embodiments, the antigenic material for incorporating the multivalent vaccine composition of the present invention is derived from type A or type B RSV or a combination thereof. The antigen for incorporating the multivalent vaccine composition of the present invention can be derived from one RSV or multiple strains, for example, two to five strains, in order to provide a wider range of protection. In one embodiment, the antigen for incorporating the multivalent vaccine composition of the present invention is derived from multiple strains of RSV virus. Other useful antigens include live, attenuated, and inactivated viruses, such as inactivated poliovirus (Jiang et al., J. Biol. Stand., (1986) 14: 103-9), attenuated hepatitis A virus (Bradley et al., J. Med. Virol., (1984) 14: 373-86), attenuated measles virus (James et al., N. Engl. J. Med., (1995) 332: 1262-6), and pertussis virus epitopes (e.g., ACEL-IMUNErM cell-free DTP, Wyeth-Lederle vaccine, and children's medicine).

[0192] In some aspects, the vaccine provided herein is a universal vaccine. In some embodiments, a universal vaccine is a vaccine that provides protection against multiple strains of the same virus, such as multiple RSV strains. Developing an effective universal RSV vaccine would reduce the cost and labor of, for example, seasonal vaccine preparations, and allow for more robust pandemic preparedness.

[0193] In some respects, universal vaccine is the vaccine that comprises a plurality of epi-positions that derive from different virus strains.In some respects, universal vaccine is included in the single epi-position that is conservative between different virus strains.For example, universal vaccine can be based on the relatively conservative structural domain of RSV F albumen.

[0194] In some embodiments, the antigenic material for incorporation into the multivalent vaccine composition of the present invention is derived from RSV type A and type B, which are combined in a ratio of 0.1-20 (by weight), for example, 2: 1, 1.5: 1, 1: 1, 1: 1.5, 1: 2. In some embodiments, the antigenic material derived from RSV type A is a recombinant polypeptide or trimer formed by linking any one of the RSV AF protein peptides described herein (e.g., RSV A viral antigens or immunogens, for example, see Section 1) to a C-terminal propeptide. In some embodiments, the RSV AF protein peptide comprises an F1 subunit and an F2 subunit of the RSV AF protein or a fragment thereof, optionally wherein the F1 subunit and the F2 subunit are linked by a disulfide bond or an artificially introduced linker. In some embodiments, the antigenic material derived from RSV type B is a recombinant polypeptide or trimer formed by linking any one of the RSV BF protein peptides described herein (e.g., RSV viral antigens or immunogens, for example, see Section 1) to a C-terminal propeptide. In some embodiments, the RSV BF protein peptide comprises the F1 subunit and F2 subunit of the RSV BF protein or a fragment thereof, optionally wherein the F1 subunit and the F2 subunit are connected by a disulfide bond or an artificially introduced linker. In some embodiments, RSV A type is RSV A2 strain. In some embodiments, RSV B type is RSV B Australian strain. In some embodiments, the artificially introduced linker is a non-amino acid compound or one or more amino acids. In some embodiments, the one or more amino acids are freely selected from CGGG (SEQ ID NO: 138). In some embodiments, the artificially introduced linker replaces any one, two or three of furin site I, furin site II, and PEP 27 peptide. In some embodiments, the artificially introduced linker replaces furin site I and PEP 27 peptide and one or more bases connected to furin site II. In some embodiments, the one or more bases are selected from FLGFLLGV (SEQ ID NO: 126), such as F, FL, FLG, FLGF (SEQ ID NO: 127), FLGFL (SEQ ID NO: 128), FLGFLL (SEQ ID NO: 129), FLGFLLG (SEQ ID NO: 130), or FLGFLLGV (SEQ ID NO: 131).In some embodiments, the antigenic material derived from RSV type A is or comprises a sequence shown in any one of SEQ ID NOs: 1-20, or an amino acid sequence that has at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 1-20. In some embodiments, the antigenic material derived from RSV type A is or comprises the sequence shown in any one of SEQ ID NOs:41-50, or an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NOs:41-50. In some embodiments, the antigenic material derived from RSV type B is or comprises the sequence shown in any one of SEQ ID NOs: 21-40, or an amino acid sequence having at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any one of SEQ ID NOs: 21-40. In some embodiments, the antigenic material derived from RSV A type is or comprises the sequence shown in any one of SEQ ID NO:54-63 or with SEQ ID NO:54-63 any one has at least or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity amino acid sequence. Also provided is an immunogenic composition comprising a disclosed immunogen (for example, a nucleic acid molecule of the protomer of a disclosed recombinant RSV F antigen or encoding a disclosed recombinant RSV F antigen) and a pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a trimerization recombinant polypeptide provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a protein containing a plurality of trimerization recombinant polypeptides provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a protein nanoparticle as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a VLP as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises an isolated nucleic acid as provided herein and an optional pharmaceutically acceptable carrier.In some embodiments, the immunogenic composition comprises a carrier as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a virus as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a pseudovirus as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition comprises a cell as provided herein and an optional pharmaceutically acceptable carrier. In some embodiments, the immunogenic composition, such as the immunogenic composition described herein, is a vaccine. In some embodiments, the vaccine is a prophylactic vaccine. In some embodiments, the vaccine is a therapeutic vaccine. In some embodiments, the vaccine is a prophylactic vaccine and a therapeutic vaccine. Such pharmaceutical compositions can be administered to a subject by various modes of administration known to those of ordinary skill, such as intramuscular, intradermal, subcutaneous, intravenous, intraarterial, intraarticular, intraperitoneal, intranasal, sublingual, tonsil, oropharyngeal, or other parenteral and mucosal routes. In several embodiments, a pharmaceutical composition comprising one or more disclosed immunogens is an immunogenic composition. Actual methods of preparing administrable compositions will be known or apparent to those skilled in the art and are described in more detail in publications such as Remingtons Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995.

[0195] The present invention relates to the preparation of the present invention and the invention relates to immunogens, for example recombinant RSV F antigens, for example tripolymers as herein described, proteins, can be prepared together with a pharmaceutically acceptable carrier, to help retain biological activity, and also to contribute to increase the stability during storage in an acceptable temperature range. Possible carriers include but are not limited to physiological equilibrium culture medium, phosphate buffered saline solution, water, emulsions (for example oil / water or water / oil emulsions), various types of wetting agents, cryoprotectant additives or stabilizers such as protein, peptide or hydrolyzate (for example albumin, gelatin), sugar (for example sucrose, lactose, sorbitol), amino acids (for example sodium glutamate) or other protective agents. The gained aqueous solution can be used by former state or freeze-dried packaging. Freeze-dried preparations are combined with sterile solution before administration for single or multiple administration.

[0196] Formulated compositions, especially liquid formulations, may contain bacteriostatic agents to prevent or minimize degradation during storage, including but not limited to benzyl alcohol, phenol, m-cresol, chlorobutanol, methylparaben, and / or propylparaben at effective concentrations (typically 1% w / v). Some patients may be averse to bacteriostatic agents; therefore, lyophilized formulations can be reconstituted in solutions with or without such ingredients.

[0197] The immunogenic compositions of the present invention may contain pharmaceutically acceptable vehicle substances as needed to approach physiological conditions, such as pH regulators and buffers, osmotic pressure regulators, wetting agents, and the like, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. The immunogenic compositions may optionally include adjuvants to enhance the host's immune response. Suitable adjuvants include, for example, toll-like receptor agonists, aluminum agents, AlPO4, aluminum hydrogels, lipid A and its derivatives or variants, oil emulsions, saponins, neutral liposomes, liposomes containing vaccines and cytokines, nonionic block copolymers, and chemokines. Nonionic block polymers containing polyoxyethylene (POE) and polyoxypropylene (POP), such as POE-POP-POE block copolymers, MPL TM (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, Ind.) and IL-12 (Genetics Institute, Cambridge, Mass.), as well as many other suitable adjuvants well known in the art, can be used as adjuvants (Newman et al., 1998, Critical Reviews in Therapeutic Drug Carrier Systems 15:89-142). The advantage of these adjuvants is that they help stimulate the immune system in a non-specific manner, thereby enhancing the immune response to the drug. In some embodiments, the immunogenic compositions of the present disclosure may include more than one adjuvant or be administered with more than one adjuvant. In some embodiments, the immunogenic compositions of the present disclosure may include two adjuvants or be administered with two adjuvants. In some embodiments, the immunogenic compositions of the present disclosure may include multiple adjuvants or be administered with multiple adjuvants. For example, in some cases, a vaccine, such as one comprising the immunogenic compositions provided herein, may include multiple adjuvants or be administered in combination with multiple adjuvants.

[0198] For vaccine compositions, examples of suitable adjuvants include, for example, aluminum hydroxide, lecithin, Freund's adjuvant, MPL TM and IL-12. In some embodiments, the vaccine compositions or nanoparticle immunogens disclosed herein (e.g., RSV vaccine compositions) can be formulated as controlled-release or timed-release formulations. This can be achieved in compositions containing sustained-release polymers or by microencapsulation delivery systems or bioadhesive gels. Various pharmaceutical compositions can be prepared according to standard procedures well known in the art.

[0199] In some embodiments, the immunogenic compositions of the present invention may contain an adjuvant formulation comprising a metabolizable oil (e.g., squalene) and alpha tocopherol, and polyoxyethylene sorbitan monooleate (Tween-80) in the form of an oil-in-water emulsion. In some embodiments, the adjuvant formulation may comprise about 2% to about 10% squalene, about 2 to about 10% alpha tocopherol (e.g., D-alpha tocopherol), and about 0.3 to about 3% polyoxyethylene sorbitan monooleate. In some embodiments, the adjuvant formulation may comprise about 5% squalene, about 5% tocopherol, and about 0.4% polyoxyethylene sorbitan monooleate. In some embodiments, the immunogenic compositions of the present disclosure may contain 3-O-deacylated monophosphoryl lipid A (3D-MPL) and an adjuvant in the form of an oil-in-water emulsion containing a metabolizable oil, alpha tocopherol, and polyoxyethylene sorbitan monooleate. In some embodiments, the immunogenic compositions of the present disclosure may contain QS21 (Quillaja saponaria Molina extract: fraction 21), 3D-MPL, and an oil-in-water emulsion, wherein the oil-in-water emulsion comprises a metabolizable oil, alpha-tocopherol, and polyoxyethylene sorbitan monooleate. In some embodiments, the immunogenic compositions of the present disclosure may contain QS21, 3D-MPL, and an oil-in-water emulsion, wherein the oil-in-water emulsion has the following composition: a metabolizable oil such as squalene, alpha-tocopherol, and Tween-80. In some embodiments, the immunogenic compositions of the present disclosure may contain an adjuvant in the form of a liposomal composition.

[0200] In some embodiments, the immunogenic compositions of the present disclosure may contain an adjuvant formulation comprising a metabolizable oil (e.g., squalene), polyoxyethylene sorbitan monooleate (Tween-80), and Span 85. In some embodiments, the adjuvant formulation may comprise about 5% (w / v) squalene, about 0.5% (w / v) polyoxyethylene sorbitan monooleate, and about 0.5% (w / v) Span 85.

[0201] In some embodiments, the immunogenic compositions of the present disclosure may contain an adjuvant formulation, for example in the form of a nanoparticle composition, comprising Quillaja saponins, cholesterol, and a phospholipid. In some embodiments, the immunogenic compositions of the present disclosure may contain a mixture of separately purified Quillaja fractions that are subsequently formulated with cholesterol and a phospholipid.

[0202] In some embodiments, the immunogenic composition of the present disclosure may contain a TM Matrix-A TM Matrix-C TM 、Matrix-M TM , AS01, AS02, AS03 and AS04 adjuvants.

[0203] In some embodiments, the immunogenic composition of the present invention may contain a toll-like receptor 9 (TLR9) agonist, wherein the TLR9 agonist is an oligonucleotide having a length of 8 to 35 nucleotides and comprising an unmethylated cytidine-phosphate-guanosine (also referred to as CpG or cytosine-phosphate-guanosine) motif, and the RSV antigen and the oligonucleotide are present in the immunogenic composition in an amount that can effectively stimulate an immune response of a mammalian subject in need thereof, such as a human subject, to the RSV antigen. TLR9 (CD289) recognizes unmethylated cytidine-phosphate-guanosine (CpG) motifs found in microbial DNA, which can be simulated using synthetic CpG-containing oligodeoxynucleotides (CpG-ODN). CpG-ODN is known to enhance antibody production and stimulate T helper 1 (Th1) cell responses (Coffman et al., Immunity, 33:492-503, 2010). The best oligonucleotide TLR9 agonists generally contain a palindromic sequence that follows the following general formula: 5'-purine-purine-CG-pyrimidine-pyrimidine-3', or 5'-purine-purine-CG-pyrimidine-pyrimidine-CG-3'. U.S. Patent No. 6,589,940, which is incorporated herein by reference in its entirety. In some embodiments, the CpG oligonucleotide is linear. In other embodiments, the CpG oligonucleotide is annular or includes a hairpin loop. The CpG oligonucleotide can be single-stranded or double-stranded. In some embodiments, the CpG oligonucleotide can contain modifications. Modifications include, but are not limited to, modifications of 3'OH or 5'OH groups, modifications of nucleotide bases, modifications of sugar components, and modifications of phosphate groups. The modified base can be included in the palindromic sequence of the CpG oligonucleotide, as long as the modified base maintains the same specificity to its natural complement by Watson-Crick base pairing (e.g., the palindromic portion is still self-complementary). In some embodiments, the CpG oligonucleotide comprises an atypical base. In some embodiments, the CpG oligonucleotide comprises a modified nucleoside. In some embodiments, the modified nucleoside is selected from 2'-deoxy-7-deazaguanosine, 2'-deoxy-6-thioguanosine, arabinoguanosine, 2'-deoxy-2' substituted-arabinoguanosine and 2'-O-substituted-arabinoguanosine. The CpG oligonucleotide can contain the modification of a phosphate group. For example, in addition to a phosphodiester bond, phosphate modification also includes but is not limited to methylphosphonate, phosphorothioate, phosphoramide (bridged or non-bridged), phosphotriester and dithiophosphate, and can be used in any combination. Other non-phosphate bonds can also be used. In some embodiments, the oligonucleotide only comprises a thiophosphate backbone. In some embodiments, the oligonucleotide only comprises a phosphodiester backbone. In some embodiments, the oligonucleotide comprises a combination of phosphate bonds in the phosphate backbone, such as a combination of phosphodiester bonds and thiophosphate bonds.Oligonucleotides with thiophosphate backbones may be more immunogenic than oligonucleotides with phosphodiester backbones and appear to be more resistant to degradation after injection into the host (Braun et al., J Immunol, 141:2084-2089, 1988; and Latimer et al., Mol Immunol, 32:1057-1064, 1995). The CpG oligonucleotides of the present disclosure include at least one, two or three internucleotide thiophosphate bonds. In some embodiments, when multiple CpG oligonucleotide molecules are present in a pharmaceutical composition comprising at least one excipient, two stereoisomers of thiophosphate bonds are present in multiple CpG oligonucleotide molecules. In some embodiments, all internucleotide bonds of the CpG oligonucleotides are thiophosphate bonds, or in other words, the CpG oligonucleotides have a thiophosphate backbone.

[0204] Any suitable CpG oligodeoxynucleotide (ODN) or combination thereof can be used as an adjuvant in the present disclosure. For example, K-type ODN (also referred to as B-type) encodes multiple CpG motifs on a phosphorothioate backbone. K-type ODN can be based on the following sequence: TCCATGGACGTTCCTGAGCGTT (SEQ ID NO: 132). Compared to natural phosphodiester nucleotides, the use of phosphorothioate nucleotides enhances resistance to nuclease digestion, resulting in a substantially longer in vivo half-life. K-type ODN induces pDC differentiation and TNF-α production, and induces B cell proliferation and IgM secretion. D-type ODN (also referred to as A-type) is constructed from a mixed phosphodiester / phosphorothioate backbone, contains a single CpG motif flanked by palindromic sequences, and has poly-G tails (a structural motif that facilitates concatemer formation) at the 3' and 5' ends. D-type ODN can be based on the following sequence: GGTGCATCGATGCAGGGGGG (SEQ ID NO: 133). D-type ODN triggers pDC maturation and IFN-α secretion, but has no effect on B cells. C-type ODN is similar to K-type in that it is composed entirely of phosphorothioate nucleotides, but is similar to D-type in containing a palindromic CpG motif. C-type ODN can be based on the following sequence: TCGTCGTTCGAACGACGTTGAT (SEQ ID NO: 134). This type of ODN stimulates B cells to secrete IL-6 and pDC to produce IFN-α. P-type ODN contains two palindromic sequences, enabling them to form a more highly ordered structure. P-type ODN can be based on the following sequence: TCGTCGACGATCGGCGCGCGCCG (SEQ ID NO: 135). P-type ODN activates B cells and pDC and induces substantially higher IFN-α production compared to C-type ODN. In this paragraph, bold letters in the ODN sequence indicate self-complementary palindromic sequences, and CpG motifs are underlined.

[0205] Exemplary CpG ODNs include CpG 7909 (5'-TCGTCGTTTTGTCGTTTTGTCGTT-3') (SEQ ID NO: 136) and CpG 1018 (5'-TGACTGTGAACGTTCGAGATGA-3') (SEQ ID NO:137) is known and is disclosed in U.S. Patent Nos. 7,255,868, 7,491,706, 7,479,285, 7,745,598, 7,785,610, 8,003,115, 8,133,874, 8,114,418, 8,222,398, 8,333,980, 8,597,665, 8,669,237, 9,028,845 and 10,052,378, application publication US2020 / 0002704, and Bode et al., "CpG DNA as a vaccine adjuvant," Expert Rev Vaccines (2011), 10(4):499-511, all of which are incorporated herein by reference in their entirety for all purposes.

[0206] One or more adjuvants can be used in combination and may include, but are not limited to, aluminum hydroxide (aluminum salts), oil-in-water emulsions, water-in-oil emulsions, liposomes, and microparticles, such as poly(lactide-co-glycolide) microparticles (Shah et al., Methods Mol, 1494: 1-14, 2017). In some embodiments, the immunogenic composition further comprises an aluminum salt adjuvant that adsorbs RSV antigens. In some embodiments, the aluminum salt adjuvant comprises one or more of amorphous aluminum hydroxyphosphate sulfate, aluminum hydroxide, aluminum phosphate, and potassium aluminum sulfate. In some embodiments, the aluminum salt adjuvant comprises one or both of aluminum hydroxide and aluminum phosphate. In some embodiments, the aluminum salt adjuvant comprises aluminum hydroxide. In some embodiments, the unit dose of the immunogenic composition comprises about 0.25 to about 0.50 mg Al 3+ or about 0.35 mg Al 3+. In some embodiments, the immunogenic composition further comprises other adjuvants. Other suitable adjuvants include, but are not limited to, squalene in water emulsion (e.g., MF59 or AS03 / CAS-1), TLR3 agonists (e.g., poly IC or poly ICLC), TLR4 agonists (e.g., bacterial lipopolysaccharide derivatives such as monophosphoryl lipid A (MPL) and / or saponins such as Quil A or QS-21, such as in AS01 or AS02), TLR5 agonists (bacterial flagellin) and TLR7, TLR8 and / or TLR9 agonists (imidazoquinoline derivatives such as imiquimod and resiquimod) (Coffman et al., Immunity, 33:492-503, 2010). In some embodiments, other adjuvants include MPL and aluminum agents (e.g., AS04). For veterinary use and for producing antibodies in non-human animals, the mitogenic component of Freund's adjuvant (complete and incomplete) can be used. CAS-1 is an oil-in-water emulsion containing α-tocopherol, squalene and polysorbate 80.

[0207] In some embodiments, the immunogenic composition comprises a pharmaceutically acceptable excipient, including, for example, a solvent, a bulking agent, a buffer, a tonicity regulator, and a preservative (Pramanick et al., Pharma Times, 45:65-77, 2013). In some embodiments, the immunogenic composition may comprise an excipient that functions as one or more of a solvent, a bulking agent, a buffer, and a tonicity regulator (e.g., sodium chloride in saline may serve as both an aqueous vehicle and a tonicity regulator).

[0208] In some embodiments, the immunogenic composition comprises an aqueous vehicle as a solvent. Suitable vehicles include, for example, sterile water, saline solution, phosphate-buffered saline, and Ringer's solution. In some embodiments, the composition is isotonic.

[0209] The immunogenic composition may include a buffer. The buffer controls the pH to suppress degradation of the active agent during processing, storage, and optional reconstitution. Suitable buffers include, for example, salts, including acetates, citrates, phosphates, or sulfates. Other suitable buffers include, for example, amino acids such as arginine, glycine, histidine, and lysine. The buffer may also include hydrochloric acid or sodium hydroxide. In some embodiments, the buffer maintains the pH of the composition within the range of 6 to 9. In some embodiments, the pH is greater than (lower limit) 6, 7, or 8. In some embodiments, the pH is less than (upper limit) 9, 8, or 7. That is, the pH is within the range of approximately 6 to 9, wherein the lower limit is less than the upper limit.

[0210] The immunogenic composition may comprise a tonicity adjusting agent. Suitable tonicity adjusting agents include, for example, dextrose, glycerol, sodium chloride, glycerol and mannitol.

[0211] The immunogenic composition may include an extender. When the pharmaceutical composition is lyophilized before administration, an extender is particularly useful. In some embodiments, the extender is a protective agent that helps to stabilize and prevent the active agent from degrading during freezing or spray drying and / or storage. Suitable extenders are sugars (monosaccharides, disaccharides, and polysaccharides), such as sucrose, lactose, trehalose, mannitol, sorbitol, glucose, and raffinose.

[0212] The immunogenic composition may contain a preservative. Suitable preservatives include, for example, antioxidants and antimicrobials. However, in a preferred embodiment, the immunogenic composition is prepared under sterile conditions and in a single-use container and therefore does not need to include a preservative.

[0213] In some embodiments, the composition can be provided as a sterile composition. The pharmaceutical composition generally contains an effective amount of the disclosed immunogen and can be prepared by conventional methods. Generally, the amount of the immunogen in each dose of the immunogenic composition is selected to be an amount that induces an immune response without significant adverse side effects. In some embodiments, the composition can be provided in a unit dosage form for inducing an immune response in a subject. The unit dosage form contains a suitable single preselected dose to supply the drug to the subject, or two or more preselected unit doses of suitable markings or measurements, and / or a metering mechanism for administering a unit dose or multiple unit doses. In other embodiments, the composition further comprises an adjuvant.

[0214] IV. Methods of Inducing an Immune Response

[0215] In some embodiments, there is provided herein a method for generating an immune response to RSV surface antigens in a subject, the method comprising administering to the subject an effective amount of any recombinant polypeptide described herein or its trimer, nucleic acid, vector, host cell, immunogenic composition or vaccine composition. In some embodiments, there is provided herein a method for generating an immune response to RSV surface antigens in a subject, the method comprising administering to the subject an effective amount of a complex comprising a recombinant polypeptide selected from SEQ ID NO: 1-10, 21-30, 41-48 and 54-61. In some embodiments, there is provided herein a method for generating an immune response to RSV surface antigens in a subject, wherein the surface antigen comprises F protein or an antigenic fragment thereof, the method comprising administering to the subject an effective amount of a complex comprising a recombinant polypeptide selected from SEQ ID NO: 1-10, 21-30, 41-48 and 54-61. In some embodiments, provided herein is a method for generating an immune response to an RSV surface antigen in a subject, wherein the surface antigen comprises a sequence selected from SEQ ID NOs: 11-20, 31-40, 49-53 and 62-102, the method comprising administering to the subject an effective amount of a complex comprising a recombinant polypeptide selected from SEQ ID NOs: 1-10, 21-30, 41-48 and 54-61. In some embodiments, provided herein is a method for generating an immune response to an RSV surface antigen in a subject, wherein the surface antigen comprises the F protein of RSV or an antigenic fragment thereof, optionally, the surface antigen comprises a sequence of any one or more of SEQ ID NOs: 11-20, 31-40, 49-53 and 62-102 or an antigenic fragment thereof, the method comprising administering to the subject an effective amount of a complex comprising a recombinant polypeptide comprising a sequence shown in any one of SEQ ID NOs: 1-10, 21-30, 41-48 and 54-61.

[0216] In some embodiments, the present invention provides a method for generating an immune response to an RSV surface antigen in a subject, wherein the surface antigen comprises an F protein or an antigenic fragment thereof, the method comprising administering to the subject an effective amount of a complex comprising a recombinant polypeptide comprising a sequence selected from SEQ ID NO: 1-10, 21-30, 41-48 and 54-61, or a combination of any two or more complexes.

[0217] Disclosed immunogens (e.g., recombinant RSV F antigens, such as trimers, proteins, nucleic acid molecules (e.g., RNA molecules) or vectors encoding the protomers of disclosed recombinant RSV F antigens as described herein, or protein nanoparticles or virus-like particles comprising disclosed recombinant RSV F antigens) can be administered to a subject to induce an immune response to the corresponding RSV F antigen in the subject. In a specific instance, the subject is a human. The immune response can be a protective immune response, such as one that suppresses the response of subsequent infection with the corresponding RSV. Inducing an immune response can also be used to treat or suppress infections and diseases relevant to the corresponding RSV.

[0218] In some embodiments, subjects who have or are at risk of RSV infection (e.g., due to exposure or potential exposure to RSV) can be selected for treatment. Following administration of the disclosed immunogens, the subject can be monitored for infection or symptoms associated with RSV, or both.

[0219] Typical subjects that are intended to be treated with the therapeutic agents and methods of the present invention include humans, as well as non-human primates and other animals. In order to identify a subject for prevention or treatment according to the methods of the present invention, generally recognized screening methods are used to determine the risk factors relevant to the target or suspected disease or illness, or to determine the situation of the subject's existing disease or illness. These screening methods include, for example, routine inspections to determine the environment, family, occupation and other such risk factors that may be relevant to the target or suspected disease or illness, and diagnostic methods for detecting and / or characterizing RSV infection, such as various ELISAs and other immunoassays. These and other conventional methods allow clinicians to use the methods and pharmaceutical compositions of the present invention to select patients who need treatment. According to these methods and principles, compositions can be administered according to the teachings of this paper or other conventional methods, as an independent prevention or treatment regimen, or as a follow-up, auxiliary or coordinated treatment regimen for other treatments.

[0220] In some embodiments, the present invention provides the therapeutic agent of the present invention.Disclosed immunogen, for example RSV F antigen, for example tripolymer, protein administration can be used for preventive or therapeutic purpose.When providing prophylactically, disclosed therapeutic agent is before any symptom, for example, provides before infection.The prophylactic administration of disclosed therapeutic agent is used to prevent or improve any secondary infection.When providing therapeutically, disclosed therapeutic agent is when disease or infection symptom outbreak or afterwards, for example, after the RSV infection symptom corresponding to RSV F antigen occurs, or provides after being diagnosed as RSV and infect.Therefore described therapeutic agent can provide before expection is exposed to RSV, so that after exposure or suspected exposure to described virus or after infecting actual beginning, weaken the severity, duration or degree of the estimate of infection and / or related disease symptom.

[0221] The immunogens and immunogenic compositions described herein are provided to the subject in an amount that effectively induces or enhances an immune response of the subject (preferably a human) to the RSV F antigen. The actual dosage of the disclosed immunogen will vary according to many factors, such as the subject's disease indications and specific state (e.g., the subject's age, size, health status, symptom level, predisposition factors, etc.), the time and route of administration, other drugs or treatments administered concurrently, and the specific pharmacology of the composition for eliciting the desired activity or biological response in the subject. The dosage regimen can be adjusted to provide optimal preventive or therapeutic response.

[0222] Immunogenic compositions comprising one or more disclosed immunogens can be used to coordinate (or initially immunize-boost) vaccination regimens or combined formulations. In certain embodiments, new combined immunogenic compositions and coordinated vaccination regimens employ separate immunogens or formulations, each directed against eliciting an antiviral immune response, such as an immune response to RSV F antigen. Separate immunogenic compositions that elicit an antiviral immune response can be combined in a multivalent immunogenic composition administered to a subject in a single vaccination step, or they can be administered separately (in a monovalent immunogenic composition) in a coordinated (or initially immunize-boost) vaccination regimen.

[0223] Can carry out several reinforcements, and each reinforcement can be different disclosed immunogens.In some instances, reinforcement can be the immunogen identical with another reinforcement or initial immunization.Described initial immunization and reinforcement can be administered as single dose or multiple doses, for example, can be administered two doses, three doses, four doses, five doses, six doses or more to the subject in a few days, weeks or months.Can also carry out multiple reinforcements, for example 1 to 5 times (for example 1,2,3,4 or 5 reinforcements) or more times.Different doses can be used in a series of sequential immunizations.For example, a relatively large dose in the first immunization, then a relatively small dose is used in reinforcement.

[0224] In some embodiments, the strengthening can be at about 2 weeks, about 3 to 8 weeks or about 4 weeks after the initial exemption, or at about several months administration after the initial exemption. In some embodiments, the strengthening can be at about 5, about 6, about 7, about 8, about 10, about 12, about 18, about 24 months after the initial exemption or at more or less time administration after the initial exemption. It is also possible to use regular additional reinforcement at the time point that is suitable, to enhance " immune memory " of the experimenter. The adequacy of the vaccination parameters such as preparation, dosage, scheme etc. selected can be determined by obtaining aliquots of serum from the experimenter and measuring antibody titer in the immunization program process. In addition, the clinical condition of the experimenter can be monitored to find required effect, such as the prevention of infection or the improvement (such as reduction of viral load) of morbid state. If this type of monitoring shows that vaccination is suboptimal, then the experimenter can be strengthened with extra immunogenic composition dosage, and the vaccination parameters can be modified in the mode of expected enhanced immune response.

[0225] In certain embodiments, the prime-boost method may comprise providing a subject with a DNA prime and protein boost vaccination regimen.The method may comprise two or more administrations of the nucleic acid molecule or protein.

[0226] For protein therapeutics, typically, each human dose comprises 1-1000 μg of protein, such as about 1 μg to about 100 μg, for example, about 1 μg to about 50 μg, such as about 1 μg, about 2 μg, about 5 μg, about 10 μg, about 15 μg, about 20 μg, about 25 μg, about 30 μg, about 40 μg, or about 50 μg.

[0227] The amount utilized in the immunogenic composition is selected based on a subject population (such as an infant or the elderly). By standard studies, including observing the antibody titer and other responses of the subject, the optimal dose of a particular composition can be determined. It is understood that the disclosed immunogen in the immunogenic composition, such as the disclosed recombinant RSV F antigen (such as a trimer, protein), viral vector or nucleic acid molecule, can include a single dose of administration that is ineffective in eliciting an immune response but is effective after administering multiple doses, such as in a primary immunity-boosting regimen.

[0228] After administration of an immunogen disclosed herein, the subject's immune system typically responds to the immunogenic composition by producing antibodies specific for the RSV F protein peptides included in the immunogen. Such a response indicates that an immunologically effective dose has been delivered to the subject.

[0229] In some embodiments, the antibody response of experimenter is determined under the background of assessment effective dose / immunization scheme.In most cases, it is enough to assess the antibody titer in the serum or plasma obtained from the experimenter.About whether to administer booster vaccination and / or change the decision of the amount of the therapeutic agent administered to an individual may be at least partially based on antibody titer levels.Antibody titer levels can be based on, for example, immune binding assays, and the immune binding assays measure the antibody concentration combined with antigen (comprising, for example, recombinant RSV F antigen, for example, tripolymer, protein) in serum.

[0230] There is no need to completely eliminate or reduce or prevent RSV infection for the method to be considered effective. For example, compared with RSV infection when there is no immunogen, the immune response to RSV caused by one or more disclosed immunogens can reduce or suppress the required amount of RSV infection, such as at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or even at least 100% (eliminating or preventing detectable infected cells). In other embodiments, RSV replication can be reduced or suppressed by the disclosed method. There is no need to completely eliminate RSV replication for the method to be considered effective. For example, compared with RSV replication when there is no immunogen, the immune response caused by one or more disclosed immunogens can reduce the required amount of corresponding RSV replication, such as at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or even at least 100% (eliminating or preventing detectable RSV replication).

[0231] In some embodiments, the disclosed immunogens are administered to a subject concurrently with administration of an adjuvant. In other embodiments, the disclosed immunogens are administered to a subject after administration of an adjuvant and within an amount of time sufficient to induce an immune response.

[0232] A method for administering nucleic acid is to use plasmid DNA, such as direct immunization with mammalian expression plasmids. Immunization by nucleic acid constructs is well known in the art and is taught in, for example, U.S. Patent No. 5,643,578 (describing the method for initiating cell-mediated response or humoral response by introducing DNA encoding the desired antigen to immunize vertebrates) and U.S. Patent No. 5,593,972 and 5,817,637 (describing the nucleic acid sequence operably connected to encode antigens and the regulatory sequence enabling their expression). U.S. Patent No. 5,880,103 describes several methods for delivering nucleic acids encoding immunogenic peptides or other antigens to organisms. Described method includes liposome delivery of nucleic acid (or synthetic peptide itself) and immunostimulatory constructs or ISCOMS. TM , that is, in a mixture of cholesterol and Quil A TMISCOMS is a 30-40 nm negatively charged cage-like structure that spontaneously forms after the addition of saponin. ISCOMS has been used in various infection models, including toxoplasmosis and Epstein-Barr virus-induced tumors. TM As an antigen delivery vehicle, it has produced protective immunity (Mowat and Donachie, Immunol. Today 12:383, 1991). It has been found that as little as 1 μg of the antigen encapsulated in ISCOMS TM Antigen doses in the range of 1:1 to 2 generated class I-mediated CTL responses (Takahashi et al., Nature 344:873, 1990).

[0233] In some embodiments, a plasmid DNA vaccine is used to express the disclosed immunogens in a subject. For example, a nucleic acid molecule encoding the disclosed immunogen can be administered to a subject to induce an immune response to the RSV F antigen. In some embodiments, the nucleic acid molecule can be included in a plasmid vector for DNA immunization, such as the pVRC8400 vector (described in Barouch et al., J. Virol, 79, 8828-8834, 2005, which is incorporated herein by reference).

[0234] In another method for immunization using nucleic acid, the disclosed recombinant RSV F antigen, such as a trimer or protein, can be expressed by an attenuated viral host or vector or a bacterial vector. Recombinant vaccinia virus, adeno-associated virus (AAV), herpes virus, retrovirus, cytomegalovirus or other viral vectors can be used to express the peptide or protein, thereby inducing CTL responses. For example, U.S. Patent No. 4,722,848 describes vaccinia virus vectors and methods that can be used for immunization protocols. BCG (BCG) provides another vector for expressing peptides (see Stover, Nature 351:456-460, 1991).

[0235] In one embodiment, nucleic acids encoding the disclosed recombinant RSV F antigens are introduced directly into cells. For example, nucleic acids can be loaded onto gold microspheres by standard methods and expressed by, for example, Bio-Rad's HELIOS TM The nucleic acid can be introduced into the skin using a device such as a gene gun. The nucleic acid can be "naked," consisting of a plasmid under the control of a strong promoter. Typically, DNA is injected into muscle, but it can also be injected directly into other sites. The injection dose is typically about 0.5 μg / kg to about 50 mg / kg, typically about 0.005 mg / kg to about 5 mg / kg (see, for example, U.S. Patent No. 5,589,466).

[0236] For example, nucleic acids can be loaded onto gold microspheres by standard methods and analyzed by a HELIOS microscope, such as that from Bio-Rad. TM The nucleic acid can be introduced into the skin using a device such as a gene gun. The nucleic acid can be "naked," consisting of a plasmid under the control of a strong promoter. Typically, DNA is injected into muscle, but it can also be injected directly into other sites. The injection dose is typically about 0.5 μg / kg to about 50 mg / kg, typically about 0.005 mg / kg to about 5 mg / kg (see, for example, U.S. Patent No. 5,589,466).

[0237] In another embodiment, mRNA-based immunization schemes can be used to directly deliver nucleic acids encoding the disclosed recombinant RSV F antigens into cells. In some embodiments, mRNA-based nucleic acid-based vaccines can provide effective alternatives to the aforementioned methods. mRNA vaccines eliminate the safety issues associated with DNA integration into the host genome and can be directly translated in the host cytoplasm. In addition, the simple cell-free in vitro synthesis of RNA avoids the manufacturing complexity associated with viral vectors. Two exemplary formats of RNA-based vaccination that can be used to deliver nucleic acids encoding the disclosed recombinant RSV F antigens include conventional non-amplified mRNA vaccination (see, e.g., Petsch et al., “Protective efficacy of in vitro synthesized, specific mRNA vaccines against influenza A virus infection,” Nature biotechnology, 30(12):1210-6, 2012) and self-amplifying mRNA vaccination (see, e.g., Geall et al., “Nonviral delivery of self-amplifying RNA vaccines,” PNAS, 109(36):14604-14609, 2012; Magini et al., “Self-Amplifying mRNA Vaccines Expressing Multiple Conserved Influenza Antigens Confer Protection against Homologous and Heterosubtypic Viral Challenge,” PLoS One One, 11(8):e0161193, 2016; and Brito et al., “Self-amplifying mRNA vaccines”, Adv Genet., 89:179-233, 2015).

[0238] In some embodiments, one or more disclosed immunogens of a subject's administration of a therapeutically effective dose are induced in the subject to induce a neutralizing immune response. In order to assess neutralizing activity, after subject immunization, serum can be collected from the subject at an appropriate time point, frozen and stored to carry out a neutralization test. The method for measuring neutralizing activity is known to those of ordinary skill in the art and is further described herein, including but not limited to plaque reduction neutralization (PRNT) assay, microneutralization assay, flow cytometry-based assay, single-cycle infection assay. In some embodiments, a group of RSV pseudoviruses can be used to measure serum neutralization activity.

[0239] In some embodiments, one or more disclosed immunogens of a subject's administration of a therapeutically effective dose are induced in the subject to induce a neutralizing immune response. In order to assess neutralizing activity, after subject immunization, serum can be collected from the subject at an appropriate time point, frozen and stored to carry out a neutralization test. The method for measuring neutralizing activity is known to those of ordinary skill in the art and is further described herein, including but not limited to plaque reduction neutralization (PRNT) assay, microneutralization assay, flow cytometry-based assay, single-cycle infection assay. In some embodiments, a group of RSV pseudoviruses can be used to measure serum neutralization activity.

[0240] In some embodiments, neutralizing antibodies against RSV are produced by the neutralizing immune response induced by the immunogen disclosed herein. In some embodiments, the neutralizing antibodies herein bind to the cell receptors or co-receptors of RSV or its components. Nucleolin is the entry co-receptor of RSV, and also mediates the cell entry of influenza virus, parainfluenza virus, some enteroviruses and the bacteria that cause tularemia. The combination of RSV-F glycoprotein and insulin-like growth factor 1 receptor (IGF1R) before fusion may also trigger the activation of protein kinase C ζ (PKCζ), thereby recruiting nucleolin to the cytoplasmic membrane from the nucleus to bind to the RSV-F on the virion. In some embodiments, the viral receptor or co-receptor is a paramyxovirus receptor or co-receptor, preferably a pneumonia virus receptor or co-receptor, more preferably a human RSV receptor or co-receptor. For example, CCR1, CCR2, CCR3, CCR4, CCR5 and / or CCR8 receptors may be involved in human RSV infection. RhoA is another example of a host cell RSV receptor or co-receptor. In some embodiments, the neutralizing antibodies herein regulate, reduce, antagonize, alleviate, block, suppress, eliminate and / or interfere with at least one RSV activity or combination or RSV receptor activity or combination in vitro, in situ and / or in vivo, such as RSV release, RSV receptor signaling, membrane RSV cutting, RSV activity, RSV production and / or synthesis. In some embodiments, immunogens disclosed herein induce neutralizing antibodies for RSV, which regulate, reduce, antagonize, alleviate, block, suppress, eliminate and / or interfere with the combination of RSV and RSV receptors or auxiliary receptors such as nucleolin, IGF1R, CCR1, CCR2, CCR3, CCR4, CCR5, CCR8 and / or RhoA.

[0241] V. Products or Kits

[0242] Also provided are articles or kits containing the provided recombinant polypeptides, proteins, and immunogenic compositions. The articles can include a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, test tubes, IV bags, etc. The container can be formed from a variety of materials such as glass or plastic. In some embodiments, the container has a sterile access port. Exemplary containers include intravenous bags, vials, including those with stoppers that can be pierced by an injection needle. The articles or kits can also include a package insert indicating that the composition can be used to treat a specific illness, such as an illness as described herein (e.g., RSV infection). Alternatively, or additionally, the articles or kits can also include another or the same container containing a pharmaceutically acceptable buffer. It can also include other materials, such as other buffers, diluents, filters, needles, and / or syringes.

[0243] The label or package insert can indicate that the composition is used to treat individual RSV infection. The label or package insert accompanying the container can indicate guidance about preparation reconstruction and / or use. The label or package insert can also indicate that the preparation can be used for or is intended to be used for subcutaneous, intravenous or other modes of administration, to treat or prevent individual RSV infection.

[0244] In some embodiments, the container contains the composition itself or in combination with another composition that is effective for treating, preventing and / or diagnosing the condition. The article of manufacture or kit may include (a) a first container containing a composition (i.e., a first medicament), wherein the composition includes the immunogenic composition or a protein or recombinant polypeptide thereof; and (b) a second container containing a composition (i.e., a second medicament), wherein the composition includes other agents, such as adjuvants or other therapeutic agents, and the article of manufacture or kit further includes instructions on the label or package insert for treating the subject with the second medicament in an effective amount.

[0245] the term

[0246] Unless otherwise defined, all special terms, symbols, and other technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. In some cases, terms with commonly understood meanings are defined herein for clarity and / or ease of reference, and the inclusion of such definitions herein should not be construed as representing a substantial difference from what is generally understood in the art.

[0247] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues, and do not impose a minimum length restriction. Polypeptides (including the provided receptors and other polypeptides, such as linkers or peptides) can include amino acid residues, including natural and / or non-natural amino acid residues. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, and phosphorylation. In some aspects, a polypeptide may contain modifications with respect to the native or native sequence, so long as the protein retains the desired activity. These modifications may be intentional, such as through site-directed mutagenesis, or accidental, such as through mutations in the host that produces the protein or errors due to PCR amplification.

[0248] The term "F0" refers to the precursor polypeptide of the RSV F protein, which is a single polypeptide consisting of a signal polypeptide sequence, an F1 polypeptide sequence, a pep27 polypeptide sequence, and an F2 polypeptide sequence. Typically, the RSV F0 polypeptide consists of 574 amino acids.

[0249] Term " F1 " refers to the polypeptide chain of mature RSV F protein.Natural F1 includes the approximate residue 137-574 of RSV F0 precursor and is made up of (from N-terminal to C-terminal) extracellular region (approximate residue 137-524), membrane spaning domain (approximate residue 525-550) and cytoplasmic domain (approximate residue 551-574).This term covers natural F1 polypeptide and the F1 polypeptide including modification (for example, amino acid replacement, insertion or deletion) from native sequence, and the modification is for example designed to stabilize F mutant or enhance the immunogenic modification of F mutant.

[0250] The term "F2" refers to the polypeptide chain of mature RSV F protein. Natural F2 includes the approximate residues 26-109 of the RSV F0 precursor. This term encompasses both natural F2 polypeptides and F2 polypeptides including modifications (e.g., amino acid substitutions, insertions or deletions) from native sequences, which modifications are for example designed to stabilize the F mutant or enhance the immunogenic modification of the F mutant. In natural RSV F protein, the F2 polypeptide is connected to the F1 polypeptide to form an F2-F1 heterodimer by two disulfide bonds.

[0251] The term "F protein" or "F peptide" refers to a polypeptide or protein having all or part of the amino acid sequence of a RSV F protein (e.g., F0, F1 and / or F2), including a native F protein or variant thereof. The term "recombinant F protein" or "recombinant F peptide" refers to a polypeptide or protein having one or more amino acid insertions, substitutions or deletions relative to a native RSV F protein (e.g., F0, F1 and / or F2). Herein, a fragment of an F protein or F peptide can include one or more or all epitopes of a native RSV F protein.

[0252] The term "multimerization domain" refers to an amino acid sequence capable of forming multimers (eg, trimers). An example of such a multimerization domain is the collagen C-terminal propeptide.

[0253] The term "pep27" refers to a 27-amino acid polypeptide that is cleaved from the F0 precursor during maturation of the RSV F protein. The pep27 sequence is flanked by two furin cleavage sites that are cleaved by cellular proteases during F protein maturation to generate the F1 and F2 polypeptides.

[0254] The term "immunogenicity" refers to the ability of a substance to elicit, trigger, stimulate or induce an immune response in an animal against a specific antigen, with or without an adjuvant.

[0255] The term "mutation" refers to the deletion, addition or substitution of amino acid residues in the amino acid sequence of a protein or polypeptide compared to the amino acid sequence of a reference protein or polypeptide.

[0256] The term "soluble" refers to a protein that is capable of dissolving in an aqueous liquid and remaining solubilized.

[0257] The term "sequence identity" is used to describe the dependency between two amino acid sequences or between two nucleotide sequences." sequence identity " refers to the sequence identity percentage value determined when two sequences are optimally compared (i.e., so that sequence identity is maximum) on a comparison window, and the two sequences compared can achieve optimal comparison by adding or disappearance (i.e., room). The sequence identity percentage can be calculated in the following way: determine the number of positions in which the same nucleic acid base or amino acid residue occurs in the two sequences under optimal comparison mode to produce the number of matching positions, divide the number of matching positions by the total number of positions compared, and then multiply the result by 100 to produce the sequence identity percentage. The sequence identity between two amino acid sequences can be measured using available local alignment tools (e.g., BLAST) or global alignment tools (e.g., using the Needleman-Wunsch algorithm).

[0258] As used herein, reference to an amino acid position refers to a position that corresponds to a specific position in a reference amino acid sequence when the query amino acid sequence is optimally aligned with the reference amino acid sequence. In the present invention, the positions of amino acids in the RSV AF protein peptides described herein are determined based on the amino acid sequence set forth in the reference amino acid sequence SEQ ID NO: 67 or 69, and the positions of amino acids in the RSV BF protein peptides described herein are determined based on the amino acid sequence set forth in the reference amino acid sequence SEQ ID NO: 68 or 70.

[0259] As used herein, a "subject" is a mammal, such as a human or other animal, typically a human. In some embodiments, the subject (e.g., patient) to whom one or more agents, cells, cell populations, or compositions are administered is a mammal, typically a primate, such as a human. In some embodiments, the primate is a monkey or ape. The subject can be male or female and can be of any suitable age, including infants, teenagers, adolescents, adults, and elderly subjects. In some embodiments, the subject is a non-primate mammal, such as a rodent.

[0260] As used herein, "treating" (and grammatical variations thereof) refers to the complete or partial improvement or alleviation of a disease or illness or condition, or symptoms, adverse reactions or consequences, or phenotype associated therewith. Desirable effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, alleviating any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or alleviating the disease state, and alleviating or improving prognosis. The term does not mean to completely cure the disease or completely eliminate any symptoms or to be effective for all symptoms or consequences.

[0261] As used herein, "delaying disease progression" means delaying, hindering, slowing, retarding, stabilizing, inhibiting, and / or postponing the development of a disease (e.g., cancer). The length of this delay may vary depending on the history of the disease and / or the individual being treated. In some embodiments, a sufficient or significant delay may actually encompass prevention, in that the individual will not develop the disease. For example, the development of advanced cancers, such as metastases, may be delayed.

[0262] As used herein, "prevention" includes providing protection against the occurrence or recurrence of a disease in a subject who may be susceptible to the disease but has not yet been diagnosed with the disease. In some embodiments, provided cells and compositions are used to delay the development of a disease or slow the progression of a disease.

[0263] As used herein, "inhibiting" a function or activity means reducing the function or activity when compared to otherwise identical conditions except for the conditions or parameters of interest, or when compared to another condition. For example, a cell that inhibits tumor growth reduces the tumor growth rate compared to the tumor growth rate in the absence of the cell.

[0264] In the context of administration, an "effective amount" of an agent, such as a pharmaceutical preparation, cell, or composition, refers to an amount effective, at dosages / amounts, and for periods of time necessary, to achieve a desired result, such as a therapeutic or prophylactic result.

[0265] A "therapeutically effective amount" of an agent, such as a pharmaceutical formulation, cell, or composition, refers to the amount of dosage and time period necessary to effectively achieve a desired therapeutic outcome, such as the pharmacokinetic or pharmacodynamic effect of treating a disease, illness, or condition and / or a therapeutic effect. A therapeutically effective amount can vary depending on factors such as the disease state, age, sex, and weight of the subject, as well as the cell population being administered. In some embodiments, provided methods comprise administering the cells and / or composition in an effective amount (e.g., a therapeutically effective amount).

[0266] A "prophylactically effective amount" refers to an amount effective at the dosage and for the period of time necessary to achieve the desired prophylactic result. Typically, but not necessarily, a prophylactic effective amount is less than a therapeutically effective amount because a prophylactic dose is used in subjects before or at an early stage of disease. In cases where the tumor burden is low, the prophylactically effective amount in some aspects may be higher than the therapeutically effective amount.

[0267] As used herein, the term "about" refers to the typical error range for each value that is readily known to those skilled in the art. Reference herein to "about" a value or parameter includes (and describes) embodiments for that value or parameter itself.

[0268] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" or "an" means "at least one" or "one or more."

[0269] Throughout this disclosure, various aspects of the claimed subject matter are presented in the form of ranges. It should be understood that the description in the form of ranges is merely for convenience and brevity and should not be considered as a rigid limitation on the scope of the claimed subject matter. Therefore, the description of a range should be considered as having clearly disclosed all possible sub-ranges and individual numerical values ​​within the range. For example, where a range of values ​​is provided, it should be understood that each intermediate value between the upper and lower limits of the range and any other described or intermediate values ​​within the described range are encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges can be independently included in a smaller range and are also encompassed within the claimed subject matter, subject only to any explicitly excluded limitations within the described range. When the described range includes one or more limits, the scope excluding any one or two of those included limits is also encompassed within the claimed subject matter. This applies to any range width.

[0270] As used herein, a composition refers to any mixture of two or more products, substances or compounds, including cells. It can be a solution, suspension, liquid, powder, paste, aqueous solution, non-aqueous solution or any combination thereof.

[0271] As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0272] Exemplary embodiments

[0273] Embodiment 1. A protein comprising a plurality of recombinant polypeptides, each recombinant polypeptide comprising a respiratory syncytial virus (RSV) F protein peptide or a fragment or epitope thereof linked to a collagen C-terminal propeptide, wherein the C-terminal propeptide of the recombinant polypeptide forms an inter-polypeptide disulfide bond.

[0274] Embodiment 2. The protein of embodiment 1, wherein the RSV belongs to subtype A and / or subtype B.

[0275] Embodiment 3. The protein of embodiment 1 or 2, wherein the epitope is a linear epitope or a conformational epitope.

[0276] Embodiment 4. The protein according to any one of embodiments 1 to 3, wherein the F protein peptide comprises an F1 subunit peptide and an F2 subunit peptide, and the protein comprises three recombinant polypeptides.

[0277] Embodiment 5. A protein according to any one of embodiments 1 to 4, wherein the F protein peptide comprises a signal peptide, a heptad repeat C (HRC) peptide, a pep27 peptide, a fusion peptide (FP), a heptad repeat A (HRA) peptide, a domain I peptide, a domain II peptide or a heptad repeat B (HRB) peptide or any combination thereof.

[0278] Embodiment 6. The protein of any one of embodiments 1 to 5, wherein the F protein peptide comprises the F1 subunit but not the F2 subunit of the F protein, or vice versa.

[0279] Embodiment 7. A protein according to any one of embodiments 1 to 6, wherein the F protein peptide comprises the F1 subunit and the F2 subunit of the F protein, optionally in the absence of pep27, optionally wherein the F1 subunit and the F2 subunit are connected by a disulfide bond or an artificially introduced linker.

[0280] Embodiment 8. The protein of any one of embodiments 1 to 7, wherein the F protein peptide does not comprise a transmembrane (TM) domain peptide and / or a cytoplasmic (CP) domain peptide.

[0281] Embodiment 9. The protein of any one of embodiments 1 to 8, wherein the F protein peptide comprises a protease cleavage site, wherein the protease is optionally furin, trypsin, Factor Xa, or cathepsin L.

[0282] Embodiment 10. The protein of any one of embodiments 1 to 8, wherein the F protein peptide does not comprise a protease cleavage site, wherein the protease is optionally furin, trypsin, Factor Xa, or cathepsin L.

[0283] Embodiment 11. The protein of any one of embodiments 1 to 10, wherein the F protein peptide is soluble or does not directly bind to a lipid bilayer, such as a membrane or viral envelope.

[0284] Embodiment 12. The protein of any one of embodiments 1 to 11, wherein the F protein peptides are the same or different among recombinant polypeptides of the protein.

[0285] Embodiment 13. The protein of any one of embodiments 1 to 12, wherein the F protein peptide is fused directly to the C-terminal propeptide or is linked to the C-terminal propeptide via a linker, such as a linker comprising a glycine-XY repeat sequence, wherein X and Y are independently any amino acid, optionally proline or hydroxyproline.

[0286] Embodiment 14. The protein of any one of embodiments 1 to 13, which is soluble or not directly bound to a lipid bilayer, such as a membrane or viral envelope.

[0287] Embodiment 15. The protein of any one of embodiments 1 to 14, wherein the protein is capable of forming rosette-like oligomers comprising F protein peptide trimers.

[0288] Embodiment 16. The protein of any one of embodiments 1 to 15, wherein the protein is capable of binding to a cell surface attachment factor or receptor in a subject, optionally wherein the subject is a mammal, such as a primate, eg, a human.

[0289] Embodiment 17. The protein of any one of embodiments 1 to 16, wherein the C-terminal propeptide is of human collagen.

[0290] Embodiment 18. A protein according to any one of embodiments 1 to 17, wherein the C-terminal propeptide comprises the C-terminal polypeptide of proα1(I), proα1(II), proα1(III), proα1(V), proα1(XI), proα2(I), proα2(V), proα2(XI) or proα3(XI) or a fragment thereof.

[0291] Embodiment 19. The protein of any one of embodiments 1 to 18, wherein the C-terminal propeptide is the same or different among the recombinant polypeptides.

[0292] Embodiment 20. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 103 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0293] Embodiment 21. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 104 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0294] Embodiment 22. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 105 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0295] Embodiment 23. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 106 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0296] Embodiment 24. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 107 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0297] Embodiment 25. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 108 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0298] Embodiment 26. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 109 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0299] Embodiment 27. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises any one of SEQ ID NOs: 110-114 or an amino acid sequence that is at least 90% identical thereto and is capable of forming inter-polypeptide disulfide bonds and trimerizing the recombinant polypeptide.

[0300] Embodiment 28. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises SEQ ID NO: 115 or an amino acid sequence that is at least 90% identical thereto and is capable of forming an inter-polypeptide disulfide bond and trimerizing the recombinant polypeptide.

[0301] Embodiment 29. A protein according to any one of embodiments 1 to 19, wherein the C-terminal propeptide comprises any one of SEQ ID NOs: 116-118 or an amino acid sequence that is at least 90% identical thereto and is capable of forming inter-polypeptide disulfide bonds and trimerizing the recombinant polypeptide.

[0302] Embodiment 30. The protein of any one of embodiments 1 to 29, wherein the C-terminal propeptide comprises an amino acid sequence comprising a glycine-XY repeat sequence linked to the N-terminus of any one of SEQ ID NOs: 103-118, wherein X and Y are independently any amino acid, optionally proline or hydroxyproline, or an amino acid sequence having at least 90% identity thereto, capable of forming an interpolypeptide disulfide bond and allowing trimerization of the recombinant polypeptide.

[0303] Embodiment 31. A protein according to any one of embodiments 1 to 30, wherein the F protein peptide in each recombinant polypeptide is in a pre-fusion conformation or a post-fusion conformation, optionally wherein the protein comprises a rosette-like oligomer comprising a crutch-shaped rod-shaped F protein peptide trimer.

[0304] Embodiment 32. The protein of any one of embodiments 1 to 31, wherein the F protein peptide in each recombinant polypeptide comprises any one of SEQ ID NOs: 11-20, 21-40, 49-53, 62-66, or an amino acid sequence that is at least 80% identical thereto.

[0305] Embodiment 33. A protein according to any one of embodiments 1 to 31, wherein the recombinant polypeptide comprises any one of SEQ ID NOs: 16-20, 26-30, 50, 52, 53, 63, 65, 66 or an amino acid sequence that is at least 80% identical thereto.

[0306] Embodiment 34. An immunogen comprising the protein of any one of embodiments 1 to 33.

[0307] Embodiment 35. A protein nanoparticle comprising the protein according to any one of embodiments 1 to 33 directly or indirectly attached to the nanoparticle.

[0308] Embodiment 36. A virus-like particle (VLP) comprising the protein of any one of embodiments 1 to 33.

[0309] Embodiment 37. An isolated nucleic acid encoding one, two, three or more recombinant polypeptides of the protein according to any one of embodiments 1 to 33.

[0310] Embodiment 38. The isolated nucleic acid of embodiment 37, wherein the polypeptide encoding the F protein peptide is fused in frame with the polypeptide encoding the collagen C-terminal propeptide.

[0311] Embodiment 39. The isolated nucleic acid of embodiment 37 or 38, wherein the isolated nucleic acid is operably linked to a promoter.

[0312] Embodiment 40. The isolated nucleic acid of any one of embodiments 37 to 39, wherein the isolated nucleic acid is a DNA molecule.

[0313] Embodiment 41. The isolated nucleic acid of any one of embodiments 37 to 39, which is an RNA molecule, optionally an mRNA molecule such as a nucleoside-modified mRNA, a non-amplified mRNA, a self-amplified mRNA, or a trans-amplified mRNA.

[0314] Embodiment 42. A vector comprising the isolated nucleic acid according to any one of embodiments 37 to 41.

[0315] Embodiment 43. The vector of embodiment 42, wherein the vector is a viral vector.

[0316] Embodiment 44. A virus, pseudovirus or cell comprising the vector of embodiment 42 or 43, optionally wherein the virus or cell has a recombinant genome.

[0317] Embodiment 45. An immunogenic composition comprising the protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus or cell of any one of embodiments 1 to 44, and a pharmaceutically acceptable carrier.

[0318] Embodiment 46. A vaccine comprising the immunogenic composition of embodiment 45 and optionally an adjuvant, wherein the vaccine is optionally a subunit vaccine, and / or optionally wherein the vaccine is a prophylactic and / or therapeutic vaccine.

[0319] Embodiment 47. The vaccine of embodiment 46, wherein the vaccine comprises a plurality of different adjuvants.

[0320] Embodiment 48. A method of producing a protein, the method comprising: expressing the isolated nucleic acid or vector of any one of embodiments 37 to 43 in a host cell to produce the protein of any one of embodiments 1 to 33; and purifying the protein.

[0321] Embodiment 49. A protein produced according to the method of embodiment 48.

[0322] Embodiment 50. A method for generating an immune response to an F protein peptide of RSV or a fragment or epitope thereof in a subject, the method comprising administering to the subject an effective amount of a protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus, cell, immunogenic composition or vaccine according to any one of embodiments 1 to 47 and 49 to generate the immune response.

[0323] Embodiment 51. The method of embodiment 50, for treating or preventing RSV infection.

[0324] Embodiment 52. The method of embodiment 50 or 51, wherein generating the immune response inhibits or reduces RSV replication in the subject.

[0325] Embodiment 53. A method according to any one of embodiments 50 to 52, wherein the immune response comprises a cell-mediated response and / or a humoral response, optionally comprising the production of one or more neutralizing antibodies, such as polyclonal antibodies or monoclonal antibodies.

[0326] Embodiment 54. The method of any one of embodiments 50 to 53, wherein the immune response is directed against a peptide of the RSV F protein or a fragment or epitope thereof, but not against the C-terminal propeptide.

[0327] Embodiment 55. The method of any one of embodiments 50 to 54, wherein the administering does not result in antibody-dependent enhancement (ADE) due to the subject's prior exposure to one or more RSVs.

[0328] Embodiment 56. The method of any one of embodiments 50 to 55, wherein the administering does not result in antibody-dependent enhancement (ADE) upon subsequent exposure of the subject to one or more RSVs.

[0329] Embodiment 57. The method according to any one of embodiments 50 to 56, further comprising a priming step and / or a boosting step.

[0330] Embodiment 58. The method of any one of embodiments 50 to 57, wherein the administering step is performed topically, transdermally, subcutaneously, intradermally, orally, intranasally (e.g., intranasal spray), intratracheally, sublingually, buccally, rectally, vaginally, by inhalation, intravenously (e.g., intravenous injection), intraarterially, intramuscularly (e.g., intramuscular injection), intracardially, intraosseously, intraperitoneally, transmucosally, intravitreally, subretinally, intraarticularly, periarticularly, topically, or transdermally.

[0331] Embodiment 59. The method of any one of embodiments 50 to 58, wherein the effective amount is administered as a single dose or a series of doses separated by one or more intervals.

[0332] Embodiment 60. The method of any one of embodiments 50 to 59, wherein the effective amount is administered without an adjuvant.

[0333] Embodiment 61. The method of any one of embodiments 50 to 59, wherein the effective amount is administered with an adjuvant.

[0334] Embodiment 62. A method comprising administering to a subject an effective amount of a protein according to any one of embodiments 1 to 33 to produce neutralizing antibodies or neutralizing antiserum against RSV in the subject.

[0335] Embodiment 63. The method of embodiment 62, wherein the subject is a mammal, optionally a human or a non-human primate.

[0336] Embodiment 64. The method of embodiment 62 or 63, further comprising isolating the neutralizing antibody or neutralizing antiserum from the subject.

[0337] Embodiment 65. The method of embodiment 64, further comprising administering an effective amount of the isolated neutralizing antibody or neutralizing antiserum to a human subject by passive immunization to prevent or treat RSV infection.

[0338] Embodiment 66. A method according to any one of embodiments 62 to 65, wherein the neutralizing antibodies or neutralizing antiserum against the RSV comprises polyclonal antibodies against the RSV F protein peptide or a fragment or epitope thereof, optionally wherein the neutralizing antibodies or neutralizing antiserum does not contain or is substantially free of antibodies against the collagen C-terminal propeptide.

[0339] Embodiment 67. The method of any one of embodiments 62 to 65, wherein the neutralizing antibodies comprise monoclonal antibodies to the RSV F protein peptide or fragment or epitope thereof, optionally wherein the neutralizing antibodies are free or substantially free of antibodies to the collagen C-terminal propeptide.

[0340] Embodiment 68. A protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus, cell, immunogenic composition or vaccine according to any one of embodiments 1 to 47 and 49 for inducing an immune response to RSV in a subject, and / or for treating or preventing RSV infection.

[0341] Embodiment 69. Use of a protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus, cell, immunogenic composition or vaccine according to any one of embodiments 1 to 47 and 49 for inducing an immune response to RSV in a subject, and / or for treating or preventing RSV infection.

[0342] Embodiment 70. Use of a protein, immunogen, protein nanoparticle, VLP, isolated nucleic acid, vector, virus, pseudovirus, cell, immunogenic composition or vaccine according to any one of embodiments 1 to 47 and 49 for the manufacture of a medicament or prophylactic agent for inducing an immune response to RSV in a subject and / or for treating or preventing RSV infection.

[0343] Embodiment 71. A method for analyzing a sample, the method comprising: contacting the sample with a protein according to any one of embodiments 1 to 33, and detecting the binding between the protein and an analyte that can specifically bind to the F protein peptide or a fragment or epitope thereof of the RSV.

[0344] Embodiment 72. The method of embodiment 71, wherein the analyte is an antibody, receptor, or cell that recognizes the F protein peptide or fragment or epitope thereof.

[0345] Embodiment 73. The method of embodiment 71 or 72, wherein said binding indicates the presence of said analyte in said sample and / or that the subject from which said sample was derived is infected with said RSV.

[0346] Embodiment 74. A kit comprising a protein according to any one of embodiments 1 to 33 and a substrate, liner or vial containing or immobilizing the protein, optionally wherein the kit is an ELISA or lateral flow assay kit.

[0347] Embodiment 75. The protein according to embodiment 1 is a protein subtype A and subtype B comprising two recombinant polypeptides, each recombinant polypeptide comprising a respiratory syncytial virus (RSV) F protein peptide or a fragment or epitope thereof connected to a collagen C-terminal propeptide, wherein the C-terminal propeptide of the recombinant polypeptide forms an inter-polypeptide disulfide bond.

[0348] Embodiment 76. The ratio of subtype A to subtype B of the protein according to embodiment 75 is 0.1-20 (by weight), for example 1:1.

[0349] Embodiment 77. A protein according to any one of embodiments 1 to 9, wherein the F protein peptide comprises the F1 subunit and the F2 subunit of the F protein or a fragment thereof, optionally in the presence of pep27, optionally wherein the F1 subunit and the F2 subunit are linked by a disulfide bond or an artificially introduced linker.

[0350] Embodiment 78. The protein of any one of embodiments 1 to 6 and 77, wherein the pep27 peptide or fragment or epitope thereof comprises one or more mutation sites.

[0351] Embodiment 79. The protein according to any one of embodiments 1 to 6, 77, and 78, wherein the one or more mutation sites contained in the pep27 peptide or fragment or epitope thereof are amino acids containing a sulfur bond.

[0352] Embodiment 80. The protein according to any one of embodiments 1 to 6 and 77-79, wherein the one or more mutation sites of the pep27 peptide or fragment or epitope thereof are freely selected from R133C, R135C, R136C or any combination thereof.

[0353] Embodiment 81. The protein or method of any one of embodiments 1 to 19 and 31-80, wherein the fusion protein comprises a sequence freely selected from the group consisting of SEQ ID NOs: 1-102 and 119-120.

[0354] Embodiment 82. A protein or method according to any one of embodiments 1 to 19 and 31-81, wherein the fusion protein comprises a sequence freely selected from the group consisting of SEQ ID NOs: 16-20, 36-40, 50, 52, 53, 63, 64, 66, and optionally one or more sequences selected from SEQ ID NOs: 17, 37, 50, 63.

[0355] Embodiment 83. A protein according to any one of embodiments 1 to 9 and 77, wherein the F protein peptide comprises the F1 subunit and the F2 subunit of the F protein or a fragment thereof, optionally wherein the F1 subunit and the F2 subunit are connected by a disulfide bond or an artificially introduced linker.

[0356] Embodiment 84. The protein of any one of embodiments 1 to 9, 77 and 83, wherein the F1 subunit and the F2 subunit are connected via the artificially introduced linker.

[0357] Embodiment 85. A protein according to any one of embodiments 1 to 9, 77, 83-84, wherein the artificially introduced linker is a non-amino acid compound or one or more amino acids.

[0358] Embodiment 86. A protein according to any one of embodiments 1 to 9, 77, 83-84, wherein the artificially introduced linker is one or more amino acids.

[0359] Embodiment 87. The protein of any one of embodiments 1 to 9, 77, 83-86, wherein the one or more amino acids are selected from CGGG (SEQ ID NO: 138).

[0360] Embodiment 88. A protein according to any one of embodiments 1 to 9, 77, 83-87, wherein the artificially introduced linker replaces furin site I.

[0361] Embodiment 89. A protein according to any one of embodiments 1 to 9, 77, 83-88, wherein the artificially introduced linker replaces furin site II.

[0362] Embodiment 90. The protein of any one of embodiments 1 to 9, 77, 83-89, wherein the artificially introduced linker replaces the furin site 1 and the PEP 27 peptide.

[0363] Embodiment 91. A protein according to any one of embodiments 1 to 9, 77, 83-90, wherein the artificially introduced linker connects and replaces the furin site I and PEP 27 peptide and one or more bases connected to the furin site II.

[0364] Embodiment 92. The protein of any one of embodiments 1 to 9, 77, 83-91, wherein the one or more bases are selected from FLGFLLGV (SEQ ID NO: 126), such as F, FL, FLG, FLGF (SEQ ID NO: 127), FLGFL (SEQ ID NO: 128), FLGFLL (SEQ ID NO: 129), FLGFLLG (SEQ ID NO: 130), or FLGFLLGV (SEQ ID NO: 131).

[0365] Exemplary Schemes

[0366] Scheme 1. Use of a recombinant subunit vaccine in the preparation of a medicament for preventing respiratory syncytial virus (RSV) infection in mammals, the recombinant subunit vaccine comprising a soluble RSV viral surface antigen, the soluble RSV viral surface antigen comprising an F peptide or a fragment or epitope thereof having one or more mutation sites, and the one or more mutation sites of the F peptide or fragment or epitope thereof are sulfur-bonded amino acids or sulfur-bonded amino acid derivatives, the soluble RSV viral surface antigen is linked to collagen by in-frame fusion to form a disulfide-linked trimeric fusion protein.

[0367] Option 2. The use according to Option 1, wherein the RSV belongs to subtype A or / and subtype B.

[0368] Option 3. The use according to any one of Option 1 or 2, wherein the RSV viral surface antigen comprises an F2 peptide or a fragment or epitope thereof.

[0369] Option 4. The use according to any one of Options 1 to 3, wherein the RSV viral surface antigen comprises a mutant F1 peptide or a fragment or epitope thereof.

[0370] Scheme 5. The use according to any one of Schemes 1 to 4, wherein the one or more mutation sites of the F2 peptide or its fragment or epitope are R106C and / or R108C.

[0371] Option 6. The use according to any one of Option 1 to 5, wherein the RSV viral surface antigen comprises a pep27 peptide or a fragment or epitope thereof.

[0372] Scheme 7. The use according to Scheme 6, wherein the pep27 peptide or fragment or epitope thereof comprises one or more mutation sites.

[0373] Scheme 8. The use according to Scheme 6 or 7, wherein the one or more mutation sites contained in the pep27 peptide or fragment or epitope thereof are amino acids containing a sulfur bond.

[0374] Scheme 9. The use according to any one of schemes 6-8, wherein the one or more mutation sites of the pep27 peptide or fragment or epitope thereof are freely selected from R133C, R135C, R136C or any combination thereof.

[0375] Option 10. The method according to any one of options 1 to 9, wherein the fusion protein comprises a sequence freely selected from SEQ ID NOs: 1-102 or a fragment thereof.

[0376] Option 11. The use according to any one of Options 1 to 10, wherein the fusion protein comprises a sequence freely selected from SEQ ID NOs: 6-10, 26-30, 45-48, and 58-61.

[0377] 12. The method of claim 1 , wherein the recombinant subunit vaccine is administered by intramuscular injection.

[0378] 13. The method of claim 1 , wherein the recombinant subunit vaccine is administered via intranasal spray.

[0379] 14. The use according to any one of claims 1 to 12, wherein the recombinant subunit vaccine is administered as a single dose or a series of doses spaced apart at intervals of weeks or months.

[0380] 15. The method of claim 1 , wherein the recombinant subunit vaccine is administered without an adjuvant.

[0381] 16. The method of claim 1 , wherein the recombinant subunit vaccine is administered with one or more adjuvants.

[0382] Scheme 17. The use according to any one of Schemes 1 to 16, wherein the recombinant subunit vaccine comprises a pharmaceutically acceptable adjuvant, and the adjuvant is one or more selected from a buffer, an osmotic pressure regulator, a stabilizer, and an antibacterial agent.

[0383] Scheme 18. Use of a soluble respiratory syncytial virus (RSV) surface antigen for preparing a reagent for use in a method for detecting antibodies against RSV from mammalian serum, the method comprising the step of contacting the serum with a soluble RSV surface antigen, the soluble RSV viral surface antigen comprising an F1 peptide or a fragment or epitope thereof having one or more mutation sites, and the mutation sites being amino acids containing sulfur bonds, the soluble RSV surface antigen being linked to collagen by in-frame fusion to form a disulfide-linked trimeric fusion protein.

[0384] Scheme 19. Use of a recombinant subunit vaccine comprising a soluble surface antigen from respiratory syncytial virus (RSV) in the preparation of neutralizing antibodies for patients infected with the RSV virus through passive immunization, the preparation comprising: immunizing a mammal, purifying the produced neutralizing antibodies, wherein the soluble RSV virus surface antigen comprises an F peptide or a fragment or epitope thereof having one or more mutation sites, and the mutation sites are amino acids containing sulfur bonds, wherein the soluble surface antigen is linked to collagen by in-frame fusion to form a disulfide-linked trimeric fusion protein.

[0385] Option 20. The use according to Option 19, wherein the neutralizing antibody comprises a polyclonal antibody and / or a monoclonal antibody, wherein the neutralizing antibody is a monoclonal antibody against the F protein or peptide.

[0386] Option 21. One or more polynucleotides encoding soluble RSV viral surface antigens, wherein the soluble RSV viral surface antigen comprises a sequence freely selected from SEQ ID NO: 1-102 or a fragment thereof.

[0387] Option 22. One or more vectors comprising one or more polynucleotides according to Option 21.

[0388] Option 23. A host cell comprising one or more polynucleotides according to Option 21 or one or more vectors according to Claim 22.

[0389] Scheme 24. The host cell according to Scheme 23 is GH-CHO.

[0390] Scheme 25. The vector according to Scheme 23 is pTPRIMER-TOD.

[0391] Example

[0392] The following examples are included for illustrative purposes only and are not intended to limit the scope of the present invention. In the following examples, unless otherwise stated, when referring to adjuvants such as Alum, aluminum agents, etc., it refers to aluminum adjuvants containing aluminum hydroxide; when referring to Trimer (e.g., DS-CAV1-Trimer or WT RSV F-Trimer or similar expressions), wherein Trimer refers to a trimer formed after fusion with the collagen C-terminal propeptide, wherein the collagen C-terminal propeptide used is the same as the collagen C-terminal propeptide used in other fusion proteins herein (e.g., SCB-N25C_A and SCB-N25C_A).

[0393] Example 1: Recombinant polypeptides comprising RSV F protein peptides

[0394] RSV F glycoprotein constructs were derived from RSV strains A2 (accession number AAC55970) and B Australian strain. The coding sequence for the F protein peptide residues 1-520 was codon-optimized, synthesized, and subcloned into the mammalian expression vector pTPRIMER-TOD, which encodes the Hind III and Bgl II sites of human α1 collagen C-propeptide. Figure 1 shows a schematic diagram of an exemplary RSV A2 strain recombinant polypeptide. A: SCB-N25_A fusion protein (SEQ ID NO: 1); B: SCB-N25C_A (SEQ ID NO: 2); C: SCB-N25A_A (SEQ ID NO: 139); D: SCB-N25T_A (SEQ ID NO: 140); E: SCB-N25Y_A (SEQ ID NO: 141); F: SCB-N25G_A (SEQ ID NO: 142); G: SCB-N25S_A (SEQ ID NO: 143) and K: 3.1 SCB-N25C_A (SEQ ID NO: 41). Figure 10 shows a schematic diagram of exemplary RSV B Australian strain recombinant polypeptides. A: SCB-N25_B fusion protein (SEQ ID NO:21); B: SCB-N25C_B (SEQ ID NO:22); C: SCB-N25A_B (SEQ ID NO:144); D: SCB-N25T_B (SEQ ID NO:145); E: SCB-N25Y_B (SEQ ID NO:146); F: SCB-N25G_B (SEQ ID NO:147), G: SCB-N25S_B (SEQ ID NO:148), and K: 3.1SCB-N25C_B (SEQ ID NO:54).

[0395] The recombinant polypeptides described in this example were used in the experiments in the following examples.

[0396] Example 2: Pre-fusion F protein expression of recombinant polypeptides containing RSV F protein peptides derived from RSV A2 strain

[0397] The expression level of pre-fusion F protein in the supernatant of HEK-293T cells cultured for 3 days was determined by measuring optical density using an ELISA kit (Fig. 2). HEK-293T cells were transiently transfected with the plasmid carrying the variants listed on the horizontal axis, and after three days, the culture supernatant was harvested and centrifuged to remove cells and cell debris.

[0398] 293T cells stably passaged in DMEM (10% FBS) were diluted to 0.75 million / mL, 0.5 mL of cells and 1.5 mL of DMEM were plated into six-well plates and cultured in a 37°C CO2 incubator overnight; 300 μL of DMEM (-FBS) was placed in a 1.5 mL centrifuge tube, 9 μL of FuGene 6 was added, mixed, and allowed to stand at room temperature for 5 minutes; 100 μL of the DMEM-FuGene6 mixture was placed in three 1.5 mL centrifuge tubes, and 1 μg of the recombinant plasmid was added to each well, mixed, and allowed to stand at room temperature for 20 minutes; 1 mL of culture medium was removed from each well of the 293T six-well plate, and then the above plasmid-FuGene 6 mixture was added to each well, shaken, and placed in an incubator for culture. After three days, the cell supernatant was taken to detect protein expression. The centrifuged supernatant was then analyzed at OD280 using Synagis and AM22 antibodies to determine the OD value. A: Comparison of high optical density (OD) values ​​of variants. B: Comparison of intermediate OD values ​​of variants. SCB-N25C_A shows higher expression levels of pre-fusion F protein than other variants. SCB-N20, disclosed in US Pat. No. 10,899,800 B2 and containing the E161P / S215P mutations, served as a control.

[0399] The expression level of prefusion F protein in CHO cell supernatants on day 3 was determined by measuring optical density using an ELISA kit (Figure 3). A: Comparison of high optical density (OD) values ​​of the variants is shown; B: Comparison of intermediate OD values ​​of the variants is shown. SCB-N25C_A shows high expression levels of prefusion F protein in the variant.

[0400] The expression level of the pre-fusion F protein in the CHO cell supernatant on day 7 was determined by measuring the optical density using an ELISA kit (Figure 4). A: shows a comparison of high OD values ​​between variants; B: shows a comparison of intermediate OD values ​​between variants. SCB-N25C_A showed high expression levels of the pre-fusion F protein among the variants.

[0401] Example 3: Production of recombinant polypeptides containing RSV F protein peptides

[0402] Provided herein are secreted forms of recombinant polypeptides comprising RSV F protein peptides as vaccine candidates.

[0403] The RSV F glycoprotein construct was derived from RSV A2 (accession number AAC55970) and B Australian strains. The sequence encoding residues 1 to 520 of the F protein peptide was codon-optimized, synthesized, and subcloned into the Hind III and Bgl II sites of a mammalian expression vector encoding human α1 collagen C propeptide. Schematic representations of exemplary recombinant polypeptides are shown in Figures 1 and 10.

[0404] The recombinant plasmid was transfected into GH-CHO (dfhr-) cells, and hypoxanthine-thymidine (HT) (Invitrogen) was selected. The gene was gradually amplified with an increase in MTX (Sigma) concentration to express the fusion protein in high titer under serum-free culture using CD007-4TM1 culture medium (Jianshun Biosciences). The exemplary recombinant polypeptide was affinity-bound with Endo180 and initially purified using a salt gradient elution, and then further purified on a Superdex 200 gel filtration column (GE Healthcare). The purity (Fig. 6) of the exemplary recombinant polypeptide comprising the RSV F peptide was determined according to the manufacturer's instructions (Sepax Technologies) by size exclusion chromatography (SEC-HPLC). The main peak area of ​​the SCB-N25_A fusion protein was 92.8%, and the main peak area of ​​the protein of SCB-N25C_A was 81.7%. The main peak area of ​​the protein of 3.1SCB-N25C_A was 88.58%.

[0405] Figure 5 shows expression levels of peptides expressed using an exemplary fusion peptide from serum-free fed-batch cell culture, as analyzed by 8% SDS-PAGE. SCB-N25C_A: Cell-free conditioned medium from days 1 to 13 was isolated under non-reducing and reducing conditions, followed by Coomassie blue staining. The theoretical molecular weight of the fusion protein is 91 kD for the monomer and 273 kD for the trimer. 3.1 SCB-N25_A: Cell-free conditioned medium from days 1 to 8 was isolated under non-reducing and reducing conditions, followed by Coomassie blue staining. Experimental results show that high levels of expression are achieved on day 3.

[0406] Figure 7 shows affinity kinetics experiments. Figure 7A, B, and E show binding studies of Sinagizumab and exemplary fusion peptides containing RSV F protein peptides by biolayer interferometry.

[0407] The affinity analysis detection instrument used in this experiment is the Fortebio Octet molecular interaction instrument, and the probes used are 5 Protein A probes, which need to be soaked in PBS before use.

[0408] Reagent preparation: Regeneration solution (0.01 M glycine solution): Accurately weigh 0.03 g of glycine, dissolve it in water to 40 mL, mix well, and adjust the pH to about 1.5 with 6 M hydrochloric acid. Store at room temperature.

[0409] Sample loading order: Take a clean 96-well test plate and load the sample in the following order, 200 μL / well.

[0410] Note: B: PBS; L1: 10 μg / mL Synagis; L2: 10 μg / mL D25; S1 = 40 μg / mL test protein sample; S2 = 20 μg / mL test protein sample; S3 = 10 μg / mL test protein sample; S4 = 5 μg / mL test protein sample; S5 = PBS; R: regeneration solution (0.01 M glycine solution); N: PBS.

[0411] After adding the above reagents and samples, open the data acquisition software, enter the sample and reagent information, and run the program. This experiment is divided into two groups. The first group can first measure the affinity between the test protein sample and the anti-sinagilide monoclonal antibody; the second group measures the affinity between the test protein sample and the D25 antibody. After the run is completed, use Octet data analysis software to analyze the Kon, Kdis, and KD results.

[0412] The binding affinity of sinagizumab to purified exemplary SCB-N25_A and SCB-N25C_A recombinant polypeptides is shown in Figure 7 and the labels therein. Figures 7C, D, and F show affinity kinetics studies of binding between D25 and exemplary fusion peptides comprising RSV F protein peptides. The corresponding KD, Kon, and Kdis from affinity experiments with antibody D25 are shown in the labels of Figure 7. SCB-N25C_A exhibited high affinity for both palivizumab and antibody D25.

[0413] Example 4: Functional Characterization of Recombinant Polypeptides Containing RSV F Protein Peptides

[0414] To evaluate the immunogenicity and protective efficacy of the exemplary recombinant polypeptides produced as described in Example 1, randomized BALB / c mice were immunized intramuscularly twice with one of three doses (1, 6, and 30 μg) of the exemplary fusion polypeptides containing different adjuvants on days 0 and 21. Another group immunized with PBS served as a control group.

[0415] 8A-8E show the results of experiments using immunizations with exemplary fusion peptides comprising RSV F protein peptides (as shown in FIG. 8A ).

[0416] Figure 8A shows a schematic diagram of the immunization experimental method: mice were immunized on days 0 and 21, and serum was collected on days 0 and 35. Six- to eight-week-old SPF-grade BALB / c female mice were randomly divided into 16 groups of 10 mice each. Each group received an intramuscular injection of 50 μL of PBS or antigen, followed by a booster immunization three weeks later. Two weeks after the second immunization, blood was collected from the orbital vein and centrifuged to obtain serum. Spleens from four mice in each group were also collected for Elispot experiments.

[0417] Figure 8B shows the serum anti-F IgG ELISA titer value for the purified exemplary fusion peptide, which includes RSV F protein peptide and adjuvant Alum, Alum+CpG 1018 or CAS-1. The animal serum immunized with the hRSV candidate vaccine is mixed with the hRSV A2 true virus, and Hep2 cells are added to the serum virus mixture for incubation. RSV A2 virus can infect Hep2 cells. After incubation for 3 to 4 days (depending on the Cytopathic Effect (CPE) situation, the CPE in the virus control well reaches 60% and above), the newly propagated virus can be captured by the Biotin-labeled Synagis monoclonal antibody (Synagis), and the color is developed by the SA-HRP secondary antibody. The absorbance value at OD450nm can indirectly reflect the virus proliferation. If the added serum sample to be tested contains neutralizing antibodies that can neutralize the hRSV virus, the neutralized virus can no longer infect cells, which will affect the absorbance value. The lower the OD450nm value, the higher the neutralizing antibody titer in the serum. Fusion proteins adjuvanted with Alum + CpG 1018 showed higher titers than the corresponding fusion proteins adjuvanted with Alum or CAS-1. SCB-N25C_A showed higher titers than the other antigens.

[0418] Figure 8C shows the competitive IgG titers of D25 and palivizumab that provide 50% inhibition of D25 and palivizumab binding to heat-inactivated RSV (HI-RSV) particles, as measured by serum sample dilutions. Values ​​are expressed as log2 and mean ± SEM. DCA: D25 was added as the coating antibody to a high-adsorption ELISA 96-well plate and coated overnight at 2-8°C. Serially diluted serum samples and a 1:1 SCB-N20-biotin (N20-biotin) antigen labeling mixture were then added. DCA in the immune serum competed with D25 for binding to the site zero site on the N20-biotin antigen-labeled F protein. A secondary antibody (SA-HRP) was subsequently added to recognize N20-biotin, and unbound components were removed by elution at each step. Finally, TMB was added for color development, and the reaction was terminated with H2SO4. The lower the OD450nm value, the higher the DCA titer of the competing antibody in the serum. PCA: Synagis (Nagis) is added as the coating antibody to a high-adsorption ELISA 96-well plate and coated overnight at 2-8°C. Serially diluted serum samples and a SCB-N20-biotin (N20-biotin) antigen-labeling mixture (1:1) are then added. PCA in the immune serum competes with Synagis for binding to Site II on the N20-biotin antigen-labeled F protein. A secondary antibody (SA-HRP) is then added to recognize N20-biotin. Unbound components are removed by elution at each step. Finally, TMB is added for color development, and the reaction is terminated with H2SO4. Lower OD450nm values ​​indicate higher titers of competing PCA antibodies in the serum. All antigens bound to Alum showed lower antibody reactivity than the other two adjuvants (DCA and PCA). When used in combination with Alum+CpG1018 adjuvants, DS-CAV1-Trimer and SCB-N20_A exhibited high DCA and PCA titers, with no significant differences between the two. SCB-N25_A performed the worst. None of the four candidate antigens exhibited effective DCA titers when used in combination with CAS-1 adjuvant. PCA titers were higher for SCB-N20_A and N25_A, while DS-CAV1-Trimer exhibited the lowest.

[0419] Figure 8D shows the results of the Elispot test. After the vaccine is immunized in mice, the spleen cells are stimulated to locally secrete cytokines, which are captured by specific monoclonal antibodies. The captured cytokines bind to the biotin-labeled secondary antibody and then to the alkaline phosphatase-labeled avidin. After incubation with BCIP / NBT substrate, blue-purple spots appear on the PVDF well plate, indicating that the cells have secreted specific cytokines. The spots are analyzed by the ELISpot enzyme-linked spot analysis system to obtain the results. The N25C_A antigen combined with the Alum adjuvant can produce a stronger Th1 cellular immune response. The antigen combined with the Alum+CpG1018 adjuvant both produced a lower Th2 cellular immune response. The antigen combined with the CAS-1 adjuvant both produced a higher Th1 and Th2 cellular immune response.

[0420] Serum was evaluated with enzyme-linked immunosorbent assay (ELISA). In brief, 96-well plates were coated overnight with the exemplary fusion peptide (in PBS) of 2 μg / mL purification at 4°C and blocked with 1mg / mL BSA. The plate was washed with PBST and subsequently incubated at room temperature for 2 hours with a serial 2-fold dilution (1:64 to 1:262,144) of serum. The antibody bound was detected at room temperature for 1 hour by HRP-conjugated goat anti-mouse IgG (SouthernBiotech). Enzymatic reaction was carried out with TMB (Thermo) and the absorbance at 450nm was recorded by adding 2M HCl to stop the enzymatic reaction. The PBS immune inoculation mouse serum using the same dilution was used as the negative control group, and the antibody titer was defined as the serum dilution that caused the ratio of OD RSV F trimer to OD PBS to be 2.0.

[0421] RSV microneutralization assays were performed using HeLa cells and RSV A2 strain. Serum was heat-inactivated at 56°C for 30 minutes and serially diluted in serum-free DMEM (50 μL / well) in a 96-well cell culture plate. An equal volume of virus (1,000 pfu / mL, prepared in serum-free DMEM) was added to the plate, and the serum / virus mixture was incubated at 37°C for 1 hour. Approximately 5 × 10 4 100 μL of DMEM supplemented with 10% FBS for each HeLa cell was added and incubated at 37°C until the positive control (virus only) well showed 100% CPE. The plate was washed with PBST and fixed with PBS containing 80% pre-cooled acetone for 10 minutes. Appropriate palivizumab was added to the wells, blocked with 1 mg / mL BSA for 1 hour, and incubated at room temperature for 2 hours. After three washes, HRP-conjugated goat anti-human IgG (SouthernBiotech) was added, the enzymatic reaction was performed, and the OD at 450 nm was recorded. The dilution that caused 50% inhibition of CPE formation was determined as the neutralizing antibody titer.

[0422] Since antigenic site II is exposed on the exemplary recombinant polypeptides, a competitive ELISA using palivizumab and D25 mAb was performed to determine whether the exemplary recombinant polypeptides induced antibodies directed against this site.

[0423] Use coated 5×10 6 Competitive ELISA was performed on 96-well ELISA plates containing 50 pfu / mL heat-inactivated RSV (HI-RSV, in 50 mM carbonate-bicarbonate buffer, pH 9.2) and palivizumab and D25 monoclonal antibody, and incubated overnight at 4°C. The uncoated surface was blocked with 1 mg / mL BSA. Two-fold dilutions of the serum mixture (1:32 to 1:4,096) were added to the wells together with an appropriate amount of palivizumab and D25 monoclonal antibody and incubated at room temperature for 2 hours. The bound palivizumab was detected using HRP-conjugated goat anti-human IgG (SouthernBiotech) and TMB substrate. The wells containing PBS-immunized mouse serum represent non-competitive positive controls, and the percentage inhibition is calculated as ((OD PBS-OD RSV F trimer) / OD PBS) × 100%. Competitive binding titers are expressed as the dilution that causes 50% inhibition.

[0424] Fig. 9 A and Fig. 9 B show the candidate vaccine immunogenicity experiment of 3.1SCB-N25C_A RSV using infected mice. From the test result shown in Fig. 9 B, RSV virus candidate vaccine (SCB-N25C_A and 3.1SCB-N25C_A) can obviously produce for hRSV A2 strain virus, hRSV B18537 strain virus after being used in combination with aluminum adjuvant. And the neutralizing antibody titer of 3.1SCB-N25C_A for hRSV A2 strain virus, hRSV B18537 strain virus also increases thereupon when dosage increases. When dosage is in same molar amount (SCB-N25C_A and 3.1SCB-N25C_A dosage 0.36ug corresponds to 0.137mg / L) and The neutralizing antibody titers against hRSV A2 strain virus in the SCB-N25C_A and 3.1SCB-N25C_A groups were significantly higher than those in the competing vaccines. The neutralizing antibody titers for RSV A2 and B18537 strains are shown in Figure 12.

[0425] FIG11 shows the ELISA affinity test of antibodies to RSV candidate vaccine antigens.

[0426] Affinity testing:

[0427] First, the antibody was diluted to 1 μg / mL in PBS and coated onto an ELISA plate at a volume of 100 μl / well. The plate was incubated overnight at 2-8°C. After incubation, the coating solution was discarded, and the plate was washed three times with 300 μl / well PBST to block the plate. Next, the protein to be tested was diluted to a concentration of 5 μg / mL in a three-fold gradient to the 11th well and added to the plate at a volume of 100 μl / well. The diluent was added to the 12th well and incubated at 37°C for 90 minutes. After incubation, the liquid in the well was discarded and the plate was washed three times with a volume of 300 μl / well PBST. Next, the Trimer-Tag rabbit polyclonal antibody was diluted to 1 μg / mL in diluent and added to the plate at a volume of 100 μl / well. The plate was incubated at 37°C for 60 minutes. After incubation, the liquid in the well was discarded and the plate was washed three times with a volume of 300 μl / well PBST. Next, dilute Goat Anti-Rabbit IgG-HRP in diluent at a 1:10,000 ratio and add 100 μl / well to the ELISA plate. Incubate at 37°C for 60 minutes. After incubation, discard the liquid in the wells and wash the plate three times with 300 μl / well of PBST. Finally, add 100 μl / well of the chromogenic substrate to the ELISA plate and incubate in the dark. After incubation, terminate with 100 μl / well of sulfuric acid solution and read the OD450 value of each well with a microplate reader. After the experiment is completed, export the data and process the data with software to obtain the results.

[0428] Figure 11 shows the use of four antibodies to recognize different antigenic epitopes: A: Clone 4D7 antibody (AntibodySystem); B: Clone AM 22 antibody (Creative Biolabs); C: Clone D26 antibody; D: Clone RSB1 antibody (AntibodySystem). Clone 4D7 antibody has stronger recognition of the post-fusion conformation. The stronger the signal recognized by this antibody, the closer the antigen is to the post-fusion conformation (such as WT-RSV-F-Trimer in Figure 11A); the remaining three antibodies have stronger recognition specificity for the pre-fusion conformation (such as Figure 9B, C, and D). Judging from the test results in Figure 11, compared with the wild-type RSV-F protein, the RSV virus candidate vaccine (SCB-N25C_A or SCB-N25C_B) antigen protein has a stronger affinity with the RSV F protein pre-fusion conformation-specific antibody, and a weaker affinity with the RSV F protein post-fusion conformation-specific antibody, which indicates that the RSV virus candidate vaccine (SCB-N25C_A or SCB-N25C_B) antigen protein has a larger proportion of RSV F protein in the pre-fusion conformation.

[0429] Figures 12A-12B show the neutralizing antibody titer detection of RSV A2 strain and B18537 strain. The experiment used mice not infected with RSV virus for immunogenicity verification.

[0430] Immunization program:

[0431] SPF-grade BALB / c female mice aged 6 to 8 weeks were randomly divided into 4 groups, with 10 mice in each group;

[0432] Each group of mice was immunized with 50 μL of RSV virus candidate vaccine by intramuscular injection, and immunized three times on days 0, 21, and 42; blood was collected from the orbital vein 2 weeks after the second (Day 35) and third (Day 56) immunizations, and serum was obtained by centrifugation.

[0433] Neutralizing antibody titer detection for RSV A2 and B18537 strains:

[0434] The serum of animals immunized with the hRSV candidate vaccine was mixed with the hRSV A2 real virus and the hRSV B18537 real virus, respectively, and Hep2 cells were added to the serum-virus mixture for incubation. The hRSV A2 virus and the hRSV B18537 virus can infect Hep2 cells. After 3 to 4 days of incubation (depending on the Cytopathic Effect (CPE) situation, the CPE in the virus control well reaches 60% or more), the newly proliferated viruses can be captured by the Biotin-labeled Synagis antibody, and the color is developed by the SA-HRP secondary antibody. The amount of virus proliferation is indirectly measured by the absorbance value at OD450nm. If the added serum sample to be tested contains neutralizing antibodies that can neutralize the hRSV virus, the neutralized virus can no longer infect cells, which will affect the absorbance value. The lower the OD450nm value, the higher the neutralizing antibody titer in the serum.

[0435] 12B shows the test results, the RSV virus candidate vaccine (SCB-N25C bivalent vaccine) can significantly enhance the production of neutralizing antibodies against hRSV A2 strain virus and hRSV B18537 strain virus after use in combination with aluminum adjuvant. And the neutralizing antibody titer against hRSV A2 strain virus and hRSV B18537 strain virus also increased with increasing dose of SCB-N25C bivalent vaccine.

[0436] 13A-13C show immunogenicity experiments of exemplary trimeric fusion peptide bivalent vaccines in infected mice.

[0437] Neutralizing antibody detection:

[0438] The results shown in Figure 13B strongly suggest that the SCB-N25C bivalent PreF trimer vaccine candidate elicits potent immune responses in infected mouse models, comparable to recently licensed RSV vaccine antigens. Furthermore, both unadjuvanted and adjuvanted SCB-N25C bivalent candidates elicited similar immunogenic responses in the studied mouse models. Neutralizing antibody titers against RSV strains A2 and B18537 are shown in Figures 12A-12B.

[0439] ELISpot assay:

[0440] After RSV immunization, spleen cells from mice stimulated with RSV A or B peptide libraries locally secrete cytokines such as IFN-γ, IL-2, IL-4, and IL-5. These cytokines are captured by specific monoclonal antibodies. The captured cytokines bind to a biotinylated secondary antibody and then to alkaline phosphatase-labeled avidin. After incubation with BCIP / NBT substrate, blue-purple spots appear on the PVDF plate, indicating the secretion of specific cytokines. Analysis of these spots using the ELISpot enzyme-linked spot assay system allows comparison of the immune responses of different groups of mice.

[0441] Figure 13C: Detection and evaluation: Splenocytes were collected 28 days after vaccination to assess antigen-specific T cell responses. Stimulated by RSV A and RSV BF protein peptide libraries, Th1 (IL-2, IFN-γ) and Th2 (IL-4, IL-5) cytokines were detected by ELISpot. The results showed that the overall cell-mediated immune (CMI) response was comparable between the no-adjuvant and aluminum-adjuvant groups, and was biased towards a Th1 phenotype in this animal model. This also reflects that Th1 cells play an active role in resisting RSV infection.

[0442] 14A-14B show immunogenicity experiments of exemplary trimeric fusion peptide bivalent vaccines in non-human primates.

[0443] 15A-15D show a mouse challenge experiment.

[0444] The neutralizing antibody detection method is shown in Figure 12 RSV A2 strain and B18537 strain neutralizing antibody titer detection. The test results of Figure 15B show that compared with the normal saline (PBS) group, three doses of aluminum adjuvanted bivalent SCB-N25C were vaccinated in uninfected animals, and a single dose of adjuvant-free or aluminum adjuvanted bivalent SCB-N25C_A&B vaccine was vaccinated in primer animals. High levels of neutralizing antibodies were induced. The formalin-inactivated (FI) vaccine FI-RSV induced low levels of neutralizing antibodies. In addition, the broad spectrum of bivalent vaccine immunity is better than that of monovalent vaccine. The neutralizing antibody titer (IU / ml) of the bivalent vaccine is about 3 times higher than that of the monovalent SCB-N25C_B; the neutralizing antibody titer (IU / ml) of the bivalent vaccine is about 2 times higher than that of the monovalent SCB-N25C_A (data not shown).

[0445] Viral load testing:

[0446] Add 1 mL of HEp2 cells (3.0 × 10⁵ / mL) to each well of a 12-well plate and incubate in a CO₂ incubator overnight to obtain a monolayer. Remove the sample from a -80°C refrigerator and thaw in a 37°C water bath. Grind the tissue twice in a TissueLyser II (QIAGEN) at 30 Hz for 1 minute 20 seconds. Add the ground tissue to a 15 mL centrifuge tube and transfer the remaining HBSS solution to the tube. Mix thoroughly and centrifuge at 4,000 rpm at 4°C for 10 minutes. Transfer the supernatant to a fresh centrifuge tube. After centrifugation, the supernatant (final tissue concentration in the supernatant was 100 mg / mL) was diluted 6-fold using experimental culture medium in three serial dilutions, as shown in Figure 1. After discarding 0.5 mL of culture medium from the 12-well plate, 0.05 mL of the tissue homogenate supernatant or its dilution was added to the plated cells in the 12-well plate. The cells were incubated on a shaker for 10 minutes and then incubated in a 37°C cell culture incubator for 4 hours to allow for full viral adsorption. The liquid in the 12-well plate was replaced with agarose-containing culture medium, which was allowed to stand at room temperature for 40 minutes. After the agar solidified, the cells were incubated in a 37°C cell culture incubator for 7 days. After 7 days, the cells were fixed with 3 mL / well of paraformaldehyde at room temperature for 4 hours, removed, rinsed with water, and then 0.25 mL / well of 0.5% crystal violet solution was added. The cells were shaken on a shaker for 15 minutes, rinsed with water to remove the crystal violet, and dried. The images were scanned and the number of plaques was counted to calculate the viral titer. Viral titer was expressed as Log10 (number of plaques per gram of lung tissue homogenate).

[0447] Figure 15C shows that compared with the PBS group, the formalin-inactivated (FI) vaccine FI-RSV reduced the RSV virus titer in the lung tissue. Both the unadjuvanted and adjuvanted SCB-N25C bivalent vaccines significantly reduced the RSV virus load in the lung tissue of infected animals, indicating that the vaccine induced a strong anti-RSV immune effect in vivo.

[0448] Pathological evaluation

[0449] HE staining analysis method:

[0450] After perfusion, lung tissue was fixed in 4% paraformaldehyde for at least 24 hours, dehydrated, and then sectioned at 4 μm thickness. The slides were placed in a staining rack in a 60-65°C oven for 1 hour. Once the paraffin melted to a transparent liquid, the slides were placed in the staining rack at room temperature for 10 minutes to cool. After cooling, the slides were stained with hematoxylin and eosin (HE) and mounted. Manual semi-quantitative scoring was performed.

[0451] Figure 15D shows that the formalin-inactivated (FI) vaccine FI-RSV exacerbated lung pathology compared to the PBS group, demonstrating a vaccine enhancement effect as expected. The unadjuvanted and adjuvanted bivalent vaccines SCB-N25C_A and SCB-N25C_B significantly reduced RSV viral load in the lung tissues of infected animals without significant enhancement of lung pathology.

[0452] 16A-16C show head-to-head immunogenicity experiments comparing exemplary trimerization fusion peptide vaccines with marketed RSV vaccines.

[0453] The neutralizing antibody titers of SCB-N25C_A group against hRSV A2 strain virus and hRSV B18537 strain virus were higher than those of and group (Figure 16B). And the ratio of neutralizing antibody titer to tuberculosis antibody titer was significantly better than and This suggests that SCB-N25C_A may be the best potential RSV vaccine ( FIG16C ).

[0454] Example 5: Head-to-head comparison of immunogenicity between SCB-N25C_A and marketed RSV vaccines

[0455] The neutralizing antibody detection method is shown in Figures 12A-12B. The neutralizing antibody titer of RSV A2 strain and B18537 strain was higher in the SCB-N25C_A group than in the and group (Figure 16B). The ratio of neutralizing antibody titer to tuberculosis antibody titer in the SCB-N25C_A group was significantly better than that in the and Group (Figure 16C). This demonstrates that SCB-N25C_A may be the best potential RSV vaccine.

[0456] Example 6: Electron microscopy to detect predicted structures

[0457] FIG. 17 shows electron microscopic images of RSV A2 and B strains.

[0458] Protein samples of SCB-N25C_A and SCB-N25C_B were applied to negatively stained grids that had been hydrophilized by glow discharge. The particles were allowed to settle for a period of time. Excess sample was removed with filter paper, and the grids were rinsed with deionized water to prevent salt ions in the sample buffer from interfering with subsequent experiments. The rinsed particles were then stained with the stain at room temperature. After staining, excess liquid was removed by touching filter paper to the edge of the grid, and the grid was allowed to air dry. Sample observation and electron microscopy data were collected on a Thermo Fisher Talos L120C 120 kV transmission electron microscope using a CETA direct electron counting detector. Data were collected in super-resolution mode using SerialEM software.

[0459] According to the test results of Figure 17, the vast majority of the SCB-N25C_A and SCB-N25C_B RSV virus candidate vaccine antigen protein forms exist in a circular form of monomer or polymer, which is the same as the RSV F protein post-fusion conformation reported in the literature, and is significantly different from the crutch shape of the wild-type RSV-F protein. This shows that the trimeric RSV virus candidate vaccine antigen protein announced herein has a larger proportion of RSV F protein in a pre-fusion conformation. It retains the main neutralizing antibody epitope ( V, IV, III, II, I), and the binding to the specific antibody after fusion was weak. The neutralizing antibody titer of SCB-N25C_A and SCB-N25C_B was about 10 times higher than that of the trimer after fusion of F; The expression of epitope II (D25 mAb) and epitope II (palivizumab) in the SCB-N25C vaccine candidate SCB-N25C_A or SCB-N25C_B was approximately 20-fold higher than that in the F postfusion conformation (data not shown).

[0460] Example 7: Clinical trial design

[0461] The SCB-N25C vaccine contains RSV F protein subunits from two major circulating strains, strain A (SCB-N25C_A) and strain B (SCB-N25C_B). SCB-N25C_A or SCB-N25C_B are recombinant RSV F-trimer proteins that are synthesized by combining the extracellular domain of the RSV F protein with the Trimer-Tag TMAfter preparation, each 0.5 mL dose will contain 90 μg or 360 μg of SCB-N25C_A and SCB-N25C_B total antigens in a 1:1 ratio, representing the SCB-N25C bivalent vaccine (SCB-1019). Two SCB-1019 vaccine dose levels will be tested in the study, each with or without alum:

[0462] Placebo: Normal saline (NaCl 0.9%). Administration route: im

[0463] Example 8: Affinity of SCB-1019T(A)(3.1SCB-N25C A) and SCB-1019T(B)(3.1SCB-N25C B) with RSV F protein monoclonal antibodies

[0464] The affinity kinetics test method is shown in Figure 7. Binding studies of exemplary fusion peptides of RSV F protein peptides were performed by biolayer interferometry. First, each mAb was immobilized on a protein A or AMC2 sensor, and then the sensor was immersed in different concentrations of the exemplary fusion peptide to measure the binding kinetics. The resulting curve was fitted to a 1:1 binding model by subtracting the buffer reference value to obtain K binding and K dissociation, and the KD values ​​are shown in Table 1. SCB-1019T (A) and SCB-1019T (B) were compared with the post-fusion control protein WT-F-Trimer and the commercial GSK vaccine F protein control. SCB-1019T (A) and SCB-1019T (B) showed strong binding affinity to each pre-fusion conformation-specific mAb, and very weak affinity to the post-fusion conformation-specific mAb 4D7.

[0465] Table 1 shows affinity kinetics. Binding studies using biolayer interferometry of exemplary fusion peptides of RSV F protein peptides were performed. Each mAb was first immobilized on a Protein A or AMC2 sensor, and then the sensor was immersed in various concentrations of the exemplary fusion peptide to measure binding kinetics. The resulting curves were fitted to a 1:1 binding model by subtracting the buffer reference value to obtain K. 缔合 and K 解离 KD values ​​are shown in the table. SCB-1019T(A) and SCB-1019T(B) were compared with the post-fusion control protein WT-F-Trimer and the commercial GSK vaccine F protein. SCB-1019T(A) and SCB-1019T(B) showed strong binding affinity to each pre-fusion conformation-specific mAb, while the post-fusion conformation-specific mAb 4D7 showed very weak affinity.

[0466] Table 1

[0467] Note: * indicates that the response RLU is extremely low and the affinity KD value is inaccurate.

[0468] Example 9: Immunogenicity of SCB-1019T bivalent vaccine in normal healthy naive mice

[0469] Figure 18A shows a schematic diagram of the experimental method: mice were randomly divided into 2 groups of 10 mice each, and each group of mice was immunized with RSV virus candidate vaccine by intramuscular injection according to the table below, and immunized twice, D0 and D21 immunization; blood was collected through the orbital vein on the 35th day, and serum was obtained by centrifugation. The bivalent vaccine is SCB-1019T (A) + SCB-1019T (B), the weight ratio of the dosage is 1: 1, and the aluminum agent is 75ug / dose. Figure 18B shows the neutralizing antibody titer values ​​induced by the bivalent trimerization fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses. The neutralizing antibody detection method is shown in Figure 12.

[0470] Compared with SCB-1019T without adjuvant, 18 μg SCB-1019T combined with adjuvant induced higher neutralizing antibody titers, showing a consistent trend for both A2 and B18537 strains, and the vaccine showed strong adjuvant dependence ( Figure 18B ).

[0471] Example 10: Immunogenicity of SCB-1019T bivalent vaccine in primed mice

[0472] Figures 19A-19B show the immunogenicity experiments of exemplary trimeric fusion peptide bivalent vaccines on infected mice. Figure 19A shows a schematic diagram of the experimental method: 6-8 week old SPF grade BALB / c female mice were infected with RSV virus by intranasal drip, and the mice developed natural immunity; 28 days later, the mice were randomly divided into 3 groups, 10 mice in each group, and each group of mice was immunized with RSV virus candidate vaccine and commercial GSK control vaccine 50μl by intramuscular injection according to the table below, and only one immunization was performed; on day 0, day 14, day 28

[0473] On day 56, blood was collected from the orbital vein and centrifuged to obtain serum. The bivalent vaccine was SCB-1019T (A) + SCB-1019T (B), with a weight ratio of 1:1 and an aluminum dose of 75 μg / dose. Figure 19B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses. The neutralizing antibody detection method is shown in Figure 12.

[0474] Both unadjuvanted and adjuvanted SCB-1019T induced strong neutralizing antibody immune responses, with no difference between the two formulations. There was also no difference compared to the commercial GSK vaccine (Figure 19B).

[0475] Example 11: Effectiveness of SCB-1019T bivalent vaccine in cotton rats challenged with toxic substances

[0476] Figures 20A-20D show a cotton rat challenge experiment. Figure 20A shows a schematic diagram of the experimental method: a total of 14 cotton rats, 5 of which were infected with RSV virus by intranasal drip, and the natural immunity was set as the first group; 2 groups of uninfected mice, each group of mice was immunized with 50 μL of RSV virus candidate vaccine and control vaccine by intramuscular injection according to the table below; at week 9, that is, on the 21st day after booster immunization, and 5 days after the challenge, blood was collected through the orbital vein and centrifuged to obtain serum. The mouse viral load and lung pathology sections were detected on the 68th day. The bivalent vaccine is SCB-1019T (A) + SCB-1019T (A), the weight ratio of the dosage is 1: 1, and the dose is 90 μg / antigen. Figure 20B shows the neutralizing antibody titer values ​​induced by the bivalent trimeric fusion peptide vaccine against hRSV A2 and hRSV B18537 true viruses. Figure 20C shows the pathological score. Figure 20D shows the lung viral load.

[0477] Neutralizing antibody detection methods are shown in Figure 12. Neutralizing antibody titer detection for RSV A2 and B18537 strains. The results of Figure 20B show that vaccination with the SCB-1019T bivalent vaccine induced high levels of neutralizing antibodies in both uninfected and infected cotton rats, compared to the saline (PBS) group.

[0478] The pathological evaluation method is shown in Figure 15. Figure 20C shows that compared with the PBS group, the SCB-1019T bivalent vaccine can significantly reduce the RSV viral load in the lung tissue of infected animals without obvious lung pathology enhancement.

[0479] The method for detecting viral load in the lungs of cotton rats is shown in Figure 15. Figure 20D shows that compared with the PBS group, both vaccines can significantly reduce the RSV viral load in the lung tissues of infected animals, indicating that the vaccine induces a strong anti-RSV immune effect in vivo.

[0480] The present invention is not intended to be limited in scope to the specific disclosed embodiments, which are provided for purposes of illustration, for example, of illustrating various aspects of the invention. Various modifications of the compositions and methods will be apparent from the description and teachings herein. Such variations may be implemented without departing from the true scope and spirit of the present disclosure and are intended to be within the scope of the present disclosure.

[0481] sequence

Claims

1. A fusion protein comprising a soluble RSV viral surface antigen connected to a collagen trimerization domain, wherein the soluble RSV viral surface antigen comprises a recombinant F peptide or a fragment or epitope thereof.

2. The fusion protein according to claim 1, wherein the RSV virus belongs to subtype A and / or subtype B.

3. The fusion protein according to claim 1 or 2, wherein the collagen trimerization domain is the collagen C-terminal propeptide.

4. The fusion protein according to any one of claims 1-3, wherein the collagen trimerization domain comprises the C-terminal polypeptide or fragment thereof of proα1(I), proα1(II), proα1(III), proα1(V), proα1(XI), proα2(I), proα2(V), proα2(XI) or proα3(XI).

5. The fusion protein according to any one of claims 1-4, wherein the collagen trimerization domain comprises the sequence of any one of SEQ ID NO: 103-118 or an amino acid sequence having at least 90% identity thereto, capable of forming inter-polypeptide disulfide bonds and trimerizing the fusion protein.

6. The fusion protein according to any one of claims 1 to 5, wherein the recombinant F peptide or its fragment or epitope has one or more mutation sites, and the F peptide or its fragment or epitope is a sulfur-bonded amino acid or a sulfur-bonded amino acid derivative at the one or more mutation sites. 7 . The fusion protein according to claim 6 , wherein the recombinant F peptide or fragment or epitope thereof comprises an F2 peptide or fragment or epitope thereof and an F1 peptide or fragment or epitope thereof.

8. The fusion protein according to claim 6 or 7, wherein the recombinant F peptide or a fragment or epitope thereof comprises a pep27 peptide.

9. The fusion protein according to any one of claims 6 to 8, wherein the recombinant F peptide or a fragment or epitope thereof comprises one or more mutation sites in the F2 peptide and / or the pep27 peptide.

10. The fusion protein according to any one of claims 6 to 9, wherein the recombinant F peptide or fragment or epitope thereof comprises amino acid substitutions at one or more or all of amino acid residues 106, 108, 133, 135, 136.

11. The fusion protein according to any one of claims 6 to 10, wherein the amino acid containing a sulfur bond is cysteine.

12. The fusion protein according to any one of claims 6 to 11, wherein the recombinant F peptide or fragment or epitope thereof comprises the amino acid substitutions R106C, R108C, R133C, R135C and R136C.

13. The fusion protein of any one of claims 6-12, wherein the recombinant F peptide or fragment or epitope thereof comprises the sequence of any one of SEQ ID NOs: 11-20, 31-40, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 11-20, 31-40.

14. A fusion protein according to any one of claims 6-13, wherein the fusion protein comprises the sequence of any one of SEQ ID NOs: 1-10, 21-30 or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 1-10, 21-30.

15. The fusion protein according to any one of claims 1 to 5, wherein the recombinant F peptide or a fragment or epitope thereof comprises an F1 peptide and an F2 peptide of the F peptide, wherein the F1 peptide and the F2 peptide are connected by an artificially introduced connector, and the artificially introduced connector is an amino acid sequence CGGG (SEQ ID NO: 138). 16 . The fusion protein according to claim 15 , wherein the F2 peptide comprises an amino acid sequence from amino acid residue No. 26 to No. 105 in the F0 precursor or an amino acid sequence from amino acid residue No. 1 to No. 105 in the F0 precursor. 17 . The fusion protein according to claim 15 , wherein the F1 peptide comprises an amino acid sequence from amino acid residue 105 to any one selected from amino acid residues 513 to 524 in the F0 precursor.

18. The fusion protein of any one of claims 15-17, wherein the F0 precursor comprises the sequence of SEQ ID NO: 67 or 69, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

19. The fusion protein of any one of claims 15-18, wherein the recombinant F peptide or fragment or epitope thereof comprises the sequence of any one of SEQ ID NOs: 49-50, 62-63, or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs: 49-50, 62-63.

20. A fusion protein according to any one of claims 15-19, wherein the fusion protein comprises the sequence of any one of SEQ ID NOs:41-48, 54-61 or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence of any one of SEQ ID NOs:41-48, 54-61.

21. A polynucleotide encoding the fusion protein according to any one of claims 1-20.

22. A vector comprising the polynucleotide according to claim 21.

23. A host cell comprising the polynucleotide according to claim 21 or the vector according to claim 22.

24. An immunogenic composition comprising the fusion protein according to any one of claims 1-20.

25. The immunogenic composition of claim 24, comprising one or more adjuvants or comprising no adjuvant.

26. The immunogenic composition of claim 25, wherein the adjuvant is an aluminum agent.

27. according to the immunogenic composition described in any one in claim 24-26, it is multivalent, comprises two or more described fusion proteins, and it respectively comprises the fusion protein of soluble RSV virus surface antigen of different RSV virus subtype or virus strain connected with collagen trimerization domain.

28. immunogenic compositions according to claim 27, it comprises the fusion protein that the soluble RSV viral surface antigen of RSV A hypotype is connected with collagen trimerization structural domain, and the fusion protein that the soluble RSV viral surface antigen of RSV B hypotype is connected with collagen trimerization structural domain.

29. The immunogenic composition of claim 28, wherein the fusion protein of a soluble RSV viral surface antigen of RSV A subtype connected to a collagen trimerization domain comprises a sequence of any one of SEQ ID NOs: 1-10, 41-48 or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a sequence of any one of SEQ ID NOs: 1-10, 41-48.

30. The immunogenic composition of claim 28 or 29, wherein the fusion protein of a soluble RSV viral surface antigen of RSV subtype B connected to a collagen trimerization domain comprises a sequence of any one of SEQ ID NOs: 21-30, 54-61 or an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a sequence of any one of SEQ ID NOs: 21-30, 54-61.

31. A method for preventing or treating respiratory syncytial virus (RSV) infection, comprising administering to a subject a fusion protein according to any one of claims 1-20, a polynucleotide according to claim 21, a vector according to claim 22, a host cell according to claim 23, or an immunogenic composition according to any one of claims 24-30.

32. The method of claim 31, wherein the immunization is performed by intramuscular injection or by intranasal spray.

33. The method according to claim 31 or 32, wherein the immunization is performed as a single dose or a series of doses separated by intervals of weeks or months.