Use of eds1 protein and its encoding gene in regulating plant disease resistance

Abstract

This application discloses the application of the EDS1 protein and its encoding gene in regulating plant disease resistance, belonging to the field of genetic engineering technology. The technical problem this application aims to solve is: how to regulate clubroot resistance in plants. To this end, this application provides the application of the EDS1 protein, or substances regulating the expression of the EDS1 protein encoding gene, or substances regulating the content of the EDS1 protein, in regulating plant clubroot resistance; the EDS1 protein can be a protein with the amino acid sequence being sequence 2. This application is the first confirmation of EDS1's participation in the *Cladophora brassicae* infection cycle, and the obtained susceptible materials can be utilized as a potential breeding resource. The discovery and enrichment of breeding resources will greatly accelerate the breeding process of clubroot-resistant cruciferous plants and strengthen disease control. Furthermore, clubroot resistance can be achieved by overexpressing EDS1 in cruciferous plants through transgenic or other means.

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, specifically relating to the application of EDS1 protein and its encoding gene in regulating plant disease resistance. Background Technology

[0002] Cruciferous crops are not only important sources of oil but also crucial vegetable crops. Clubroot is a prevalent disease in crops, especially cruciferous crops, primarily caused by *Platycodon brassicae*, a member of the Oomycetes. After infection, numerous irregularly shaped (e.g., finger-like, spherical, or short rod-like) tumors of varying sizes (from as small as a grain of rice to as large as an egg) gradually grow on the taproot or lateral roots of vegetable seedlings. Tumors on the taproot are large and few, while those on the fibrous and lateral roots are small and numerous, and tend to grow in clusters. If vegetables are infected during the seedling stage, the taproot usually swells and develops tumors first; if mature plants are infected, the lateral roots usually swell and develop tumors first. In the early stages of the disease, the surface of the tumors is relatively smooth, but in later stages, the surface becomes rough and prone to cracking. With co-infection by other pathogens, rotting and a foul odor may occur in the later stages. Affected vegetables typically exhibit stunted growth, wilting due to water loss, and eventual death of the seedlings. In the early stages of the disease, leaves in the lower and middle parts of the seedlings or at the base of the roots wilt at midday and recover in the morning and evening. In the later stages, the wilting of leaves in the lower and middle parts of the seedlings or at the base of the roots becomes irreversible, even in the morning and evening, and the leaves in these areas gradually turn yellow and wither, eventually leading to the death of the entire seedling. Clubroot is highly contagious, easily affecting vegetables from the seedling stage to the later stages. Once infected, if not controlled promptly, it can cause stunted growth and stunted development, or in severe cases, yellowing, wilting, and death of the seedlings, ultimately leading to varying degrees of yield reduction, and in extreme cases, complete crop failure.

[0003] The main methods for preventing and controlling clubroot disease are as follows: (1) Selecting disease-resistant varieties: Currently, there are clubroot-resistant varieties of Chinese cabbage, rapeseed, kale, radish, etc. Using resistant varieties is one of the most economical and effective measures for preventing and controlling clubroot disease. (2) Implementing crop rotation: Rotate cruciferous vegetables (mustard greens, cabbage, cauliflower, Chinese cabbage, bok choy, etc.) with non-cruciferous vegetables (garlic, leeks, celery, onions, tomatoes, etc.). (3) Strengthening cultivation management: Strengthen drainage by opening ditches and cultivate strong seedlings. Pay attention to opening ditches and draining water in the field to avoid waterlogging. Planting should be done on sunny days. Remove diseased plants in time and take them out of the field to burn or cover them with lime and bury them deeply. Do not throw them on the field ridges or in the irrigation ditches. Pay attention to the combined use of nitrogen, phosphorus, and potassium. (4) Adjusting soil pH: Apply lime appropriately to acidic soils, applying 50 to 100 kg of lime per mu to make the soil slightly alkaline. The pathogen of clubroot prefers to live in moist, acidic soil environments, especially in cool, low-lying, waterlogged acidic soils. Generally, clubroot is more likely to occur when the soil pH is below 6.5; it is less likely to occur when the pH exceeds 7.2. (5) Chemical control: For fields with mild disease, 75% chlorothalonil at 1000 times dilution, 70% thiophanate-methyl at 1000 times dilution, or 80% carbendazim at 600 to 800 times dilution can be used for root irrigation during the seedling stage. The irrigation should be repeated every 10 days for 24 consecutive treatments. However, the control of clubroot still faces many challenges. For example, the disease is highly contagious, has multiple transmission routes, causes great damage and losses, and is difficult to control, and is known as the "cancer" of cruciferous crops. Meanwhile, because clubroot bacteria can survive in the soil for many years, and the number of known clubroot resistance genes is small and the mechanism research is weak, coupled with the emergence of new virulent strains in the field, the resistance of existing clubroot resistance genes has been lost. Discovering efficient and broad-spectrum clubroot resistance genes has become a huge challenge for clubroot resistance breeding.

[0004] The discovery of disease-resistant genes is of great significance for the control of clubroot disease. Traditional disease control methods often rely on the heavy use of pesticides, which not only increases agricultural production costs but may also pollute the environment. Utilizing disease-resistant genes for disease control can reduce pesticide use and lower the risk of environmental pollution. With increasing awareness of food safety and environmental protection, green agriculture has become an important direction for future agricultural development. The discovery and application of disease-resistant genes is one of the important means to promote green agricultural development. By breeding disease-resistant varieties, dependence on pesticides can be reduced, and the quality and safety of agricultural products can be improved. In addition, the discovery of disease-resistant genes can help to better understand the pathogenesis of diseases and the disease resistance mechanisms of crops, providing a scientific basis for developing more effective disease control strategies.

[0005] Arabidopsis thaliana, a model plant belonging to the Brassicaceae family, is of great significance for guiding disease-resistant breeding by utilizing the Arabidopsis-Platycota interaction research system to discover clubroot resistance genes. Summary of the Invention

[0006] The technical problem this application aims to solve is: how to regulate clubroot resistance in plants. Specifically, the technical problem this application aims to solve is: how to regulate clubroot resistance in cruciferous plants.

[0007] To address the aforementioned technical problems, this application provides the use of EDS1 protein, a substance regulating the expression of the EDS1 protein-encoding gene, or a substance regulating the content of EDS1 in any of the following:

[0008] A1) Application in regulating plant resistance to clubroot disease;

[0009] A2) Application in the preparation of products that regulate plant clubroot resistance;

[0010] A3) Application in regulating resistance to *Plantema rubrum* in plants;

[0011] A4) Application in the preparation of products that regulate resistance to *Cladosporium brassicae* in plants;

[0012] A5) Applications in plant breeding or plant-assisted breeding;

[0013] A6) Application in the preparation of plant breeding or plant-assisted breeding products;

[0014] The EDS1 protein may be any of the following proteins:

[0015] a1) The amino acid sequence is that of the protein shown in SEQ ID NO.2;

[0016] a2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are associated with plant clubroot resistance.

[0017] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0018] In this application, the indicators for plant breeding may include clubroot resistance.

[0019] In this application, the purpose of plant breeding may include cultivating plants with altered resistance to clubroot disease. Specifically, the purpose of plant breeding includes cultivating plants with reduced resistance to clubroot disease and / or cultivating plants with increased resistance to clubroot disease.

[0020] In this application, the regulation may be to increase, promote, or adjust.

[0021] In this application, the regulation may also be a reduction, suppression, or downregulation.

[0022] In this application, the protein may be derived from Arabidopsis thaliana.

[0023] In this application, SEQ ID NO.2 consists of 623 amino acid residues.

[0024] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0025] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0026] Further, the connection described in a3) may be a peptide bond formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2). Alternatively, the connection described in a3) may be a peptide bond formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0027] Furthermore, in the aforementioned application, the substance regulating the expression of the EDS1 protein-encoding gene or the substance regulating the content of the EDS1 protein can be a biological material, which can be any of the following:

[0028] B1) Nucleic acid molecules that inhibit or reduce the expression of the EDS1 protein-encoding gene;

[0029] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0030] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0031] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0032] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0033] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0034] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0035] B8), a nucleic acid molecule encoding the EDS1 protein;

[0036] B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

[0037] Furthermore, in the aforementioned applications, B1) the nucleic acid molecule may be RNA encoding a gene that targets the EDS1 protein or DNA encoding the RNA;

[0038] Furthermore, in the aforementioned application, the nucleic acid molecule described in B8) can be any one of the following DNA molecules described in g1)-g3):

[0039] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.1;

[0040] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3;

[0041] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant clubroot resistance.

[0042] B1) The target sequence of the nucleic acid molecule may be the first to 20th positions of SEQ ID NO.4 and / or the first to 20th positions of SEQ ID NO.5.

[0043] In some embodiments of this application, the expression cassette described in B2) may be an expression cassette for transcribing the sgRNA of the gene encoding the EDS1 protein described above.

[0044] The recombinant vector described in B3) may be pHEE401E-EDS1. The pHEE401E-EDS1 vector can transcribe sgRNA targeting the DNA molecule shown in SEQ ID NO.3 and encode the effector protein of the CRISPR / Cas9 system: the Cas9 protein.

[0045] Furthermore, in the aforementioned application, the expression cassette (B9) refers to a DNA sequence encoding the EDS1 protein that can express the protein in a host cell. This DNA sequence may include not only a promoter that initiates transcription of the EDS1 protein encoding gene, but also a terminator and / or enhancer sequence that terminates transcription of the EDS1 protein encoding gene.

[0046] Furthermore, in the aforementioned applications, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0047] Furthermore, in the aforementioned applications, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0048] Furthermore, in the aforementioned applications, the transgenic plant organs may be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0049] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0050] Furthermore, in the aforementioned application, the plant is selected from dicotyledonous plants.

[0051] Furthermore, in the aforementioned application, the dicotyledonous plant is selected from plants of the Brassicaceae family.

[0052] Furthermore, in the aforementioned application, the cruciferous plant is selected from the Arabidopsis genus.

[0053] Furthermore, in the aforementioned application, the Arabidopsis species is selected from Arabidopsis thaliana.

[0054] This application also provides a method for regulating clubroot resistance in plants, the method comprising regulating clubroot resistance in recipient plants by regulating the expression level of the EDS1 gene encoding the aforementioned EDS1 protein in the recipient plant and / or regulating the content of the aforementioned EDS1 protein in the recipient plant.

[0055] Furthermore, in the method described, the regulation may be a reduction, suppression, or downregulation.

[0056] Furthermore, the method includes reducing the clubroot resistance of the recipient plant by reducing the expression level of the gene encoding the EDS1 protein in the recipient plant and / or reducing the content of the EDS1 protein in the recipient plant, wherein the recipient plant contains the gene encoding the EDS1 protein.

[0057] Furthermore, the method achieves the purpose of reducing the expression level of the gene encoding the EDS1 protein in the recipient plant and / or reducing the content of the EDS1 protein in the recipient plant through the manner described in M1) or M2) below.

[0058] M1) The gene encoding the EDS1 protein in the recipient plant was knocked out using the CRISPR / Cas9 system. The recipient plant contains the gene encoding the EDS1 protein.

[0059] M2-1) The genome sequence shown in SEQ ID NO.3 on two homologous chromosomes of the recipient plant is modified as follows: a thymine deoxyribonucleotide (T) is inserted between positions 882 and 883 of SEQ ID NO.3 to knock out the EDS1 gene, that is, to knock out the gene encoding the EDS1 protein in the recipient plant.

[0060] M2-2) The genome sequence shown in SEQ ID NO.3 on two homologous chromosomes of the recipient plant was altered as follows: 298 deoxynucleotides from position 585 to position 882 of the sequence shown in SEQ ID NO.3 were deleted, thereby knocking out the EDS1 gene, that is, knocking out the gene encoding the EDS1 protein in the recipient plant.

[0061] Furthermore, M1) can be achieved by introducing the nucleic acid molecules and Cas protein encoding genes described in B1) above into the recipient plant.

[0062] Furthermore, in the method, the gene encoding the EDS1 protein may be any one of the following g1)-g3):

[0063] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.1;

[0064] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3;

[0065] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant clubroot resistance.

[0066] Furthermore, in the method described in B1), the target sequence of the nucleic acid molecule may be the first to 20th positions of SEQ ID NO.4 and / or the first to 20th positions of SEQ ID NO.5.

[0067] Furthermore, in the method described in B1), the nucleic acid molecule and the gene encoding the Cas protein are introduced into the recipient plant in the form of a vector.

[0068] In some embodiments of this application, the vector containing the nucleic acid molecule described in B1) and the gene encoding the Cas protein may be pHEE401E-EDS1. The pHEE401E-EDS1 vector can transcribe sgRNA targeting the DNA molecule shown in SEQ ID NO.3 and encode the effector protein of the CRISPR / Cas9 system: the Cas9 protein.

[0069] Furthermore, in the method, the plant is selected from dicotyledonous plants.

[0070] Furthermore, in the method, the dicotyledonous plant is selected from plants of the Brassicaceae family.

[0071] Furthermore, in the method, the cruciferous plant is selected from Arabidopsis thaliana plants.

[0072] Furthermore, in the method, the Arabidopsis species is selected from Arabidopsis thaliana.

[0073] This application also provides a method for obtaining a target Arabidopsis thaliana with reduced clubroot resistance. The method may include obtaining a target Arabidopsis thaliana with reduced clubroot resistance by reducing the expression level of the gene encoding the EDS1 protein in the recipient plant and / or reducing the content of the EDS1 protein in the recipient Arabidopsis thaliana, wherein the recipient Arabidopsis thaliana contains the gene encoding the EDS1 protein.

[0074] Furthermore, in the method, reducing the expression level of the gene encoding the EDS1 protein in the recipient Arabidopsis thaliana and / or reducing the content of the EDS1 protein in the recipient Arabidopsis thaliana can be achieved by the method described in N1) or N2) below.

[0075] N1) The gene encoding the EDS1 protein in the recipient Arabidopsis thaliana was knocked out using the CRISPR / Cas9 system. The recipient Arabidopsis thaliana contains the gene encoding the EDS1 protein.

[0076] N2) By performing any of the following mutations on the genome sequence in the recipient Arabidopsis thaliana:

[0077] N2-1) The genome sequence shown in SEQ ID NO.3 on the two homologous chromosomes of the recipient Arabidopsis thaliana was modified as follows: a thymine deoxyribonucleotide (T) was inserted between positions 882 and 883 of SEQ ID NO.3, thereby knocking out the EDS1 gene, that is, knocking out the gene encoding the EDS1 protein in the recipient Arabidopsis thaliana.

[0078] N2-2) The genome sequence shown in SEQ ID NO.3 on the two homologous chromosomes of the recipient Arabidopsis thaliana was modified as follows: 298 deoxynucleotides from position 585 to position 882 of the sequence shown in SEQ ID NO.3 were deleted, thereby knocking out the EDS1 gene, that is, knocking out the gene encoding the EDS1 protein in the recipient Arabidopsis thaliana.

[0079] Furthermore, the method described in N1) can be achieved by introducing the nucleic acid molecule described in B1) and the gene encoding the Cas protein into the recipient Arabidopsis thaliana.

[0080] The aforementioned EDS1 protein and biological materials are also protected under this application.

[0081] In this application, the pathogen of clubroot disease is Plasmodiophora brassicae.

[0082] The plants with reduced resistance to clubroot obtained in this application can be used to study the disease resistance mechanism of *Cladophora brassicae*.

[0083] The plants with enhanced clubroot resistance obtained in this application can be used for breeding plants resistant to Brassica clubroot.

[0084] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0085] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0086] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0087] The beneficial technical effects achieved by this application are as follows:

[0088] This application provides the first evidence of EDS1's involvement in the infection cycle of *Cladosporium brassicae*, and the obtained susceptible materials can be utilized as a potential breeding resource. The discovery and enrichment of breeding resources will greatly accelerate the breeding process of clubroot-resistant cruciferous plants and strengthen disease control. Furthermore, overexpression of EDS1 in cruciferous plants through transgenics or other means can achieve clubroot resistance.

[0089] Secondly, the diversity of organisms determines that "negative-effect" biomaterials prepared using bioengineering techniques have significant utilization value, and not all are meaningful only if they have "positive effects." After silencing the EDS1 gene, Arabidopsis thaliana became more susceptible to *Platycorrhiza brassicae* infection, resulting in susceptible materials with "negative effects." The plant's resistance to clubroot is a species-cascade response involving many pathways. The susceptible materials we obtained can be used to study which genes involved in the *Platycorrhiza brassicae* infection cycle after EDS1 gene silencing make Arabidopsis thaliana more susceptible to *Platycorrhiza brassicae* infection. Therefore, confirming EDS1's involvement in the *Platycorrhiza brassicae* infection cycle provides new ideas and methods for revealing and applying EDS1-related genes involved in clubroot resistance research. The susceptible materials can be used as germplasm materials with EDS1 gene loss of function. Attached Figure Description

[0090] Figure 1 Sequencing mutation site diagrams for the EDS1 gene knockout mutants eds1-1 and eds1-2. The difference between the eds1-1 mutant and the wild-type Arabidopsis thaliana Est-1 genome sequence is the insertion of a thymine deoxyribonucleotide (T) between positions 882 and 883 of the EDS1 gene (SEQ ID NO:3), thus knocking out the EDS1 gene. The difference between the eds1-2 mutant and the wild-type Arabidopsis thaliana Est-1 genome sequence is the deletion of a 298 bp deoxyribonucleotide between positions 585 and 882 of the EDS1 gene (SEQ ID NO:3), thus knocking out the EDS1 gene.

[0091] Figure 2This study analyzed the resistance of transgenic Arabidopsis thaliana lines to clubroot disease. Figure A shows the results of inoculation of wild-type Arabidopsis thaliana Est-1, EDS1 gene knockout mutants (eds1-1 and eds1-2) with *Plasmodiophora* fungus collected from Dayi County, Sichuan Province. Symptoms were observed and photographed 21 days after inoculation. A Canon EOS 6D Mark II SLR camera was used to photograph the entire plant (white bar indicates 1 cm); a stereomicroscope was used to photograph the roots (red bar indicates 1 mm). Figures B and C show the disease index and incidence rate of wild-type Arabidopsis thaliana Est-1, EDS1 gene knockout mutants (eds1-1 and eds1-2) 21 days after inoculation with *Plasmodiophora*. The experiment was conducted in triplicate, with at least 12 Arabidopsis thaliana plants inoculated each time. Different letters in the figures indicate statistically significant differences (P < 0.05, mean ± SE, one-way ANOVA, Tukey's post-test). Detailed Implementation

[0092] EDS1 encodes a lipase-like protein that plays a crucial role in the plant immune signaling network. This application uses Arabidopsis thaliana as a model plant to verify the contribution of the EDS1 gene to clubroot resistance. Results showed that the EDS1 gene knockout mutant in Arabidopsis thaliana exhibited significantly reduced resistance to *Platycodon brassicae* compared to wild-type Arabidopsis thaliana Est-1. This indicates that the EDS1 gene functions in plant resistance to *Platycodon brassicae*, and that the EDS1 protein and its encoding gene can provide new gene resources for clubroot resistance breeding in cruciferous crops.

[0093] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0094] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0095] The pCBC-DT1T2 and pHEE401E vectors used in the following examples are disclosed in the literature “Ge, Z. et al. LLG2 / 3 areco-receptors in BUPS / ANX-RALF signaling to regulate Arabidopsis pollen tubeintegrity. Current Biology 29, 3256-3265.e5 (2019).”. These materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The aforementioned biological materials are only for repeating the experiments of this application and may not be used for other purposes.

[0096] The Agrobacterium GV3101 used in the following examples is owned by the applicant and is described in the literature "Liang, X. et al. Ligand-triggered de-repression of Arabidopsis heterotrimeric G proteins coupled to immune receptor kinases. Cell Research 28, 529-543 (2019)". It is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only used to repeat the relevant experiments of this application and may not be used for other purposes.

[0097] The Plasmodiophora brassicae fieldisolate Dayi (PbDy) and Arabidopsis thaliana Est-1 from Dayi County, Sichuan Province, used in the following examples are owned by the applicant and described in the literature “Wang W. et al. Wei Tsing, apericycle-expressed ion channel, safeguards the stele to confer clubroot resistance. Cell 186, 2656-2671 (2023).”. These biological materials are available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. These biological materials are only used to replicate the relevant experiments of this application and may not be used for other purposes.

[0098] The amino acid sequence of the EDS1 protein in the following examples is SEQ ID NO:2, the nucleotide sequence of its encoding gene is positions 1 to 1872 of SEQ ID NO:1, and its genome sequence is positions 1 to 2140 of SEQ ID NO:3.

[0099] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0100] The following examples used GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA combined with Tukey's test was used. Different letters indicate that there is a significant difference between the two groups of data (P < 0.05), and the same letters indicate that there is no significant difference between the two groups of data (P > 0.05).

[0101] Example 1: Analysis of resistance to clubroot bacteria in EDS1 knockout Arabidopsis thaliana

[0102] The genomic sequence of the EDS1 gene in Arabidopsis thaliana is a DNA molecule with the nucleotide sequence of SEQ ID NO:3, and its coding sequence (CDS) is a DNA molecule with the nucleotide sequence of SEQ ID NO:1, encoding the EDS1 protein with the amino acid sequence of SEQ ID NO:2.

[0103] I. Obtaining EDS1 knockout Arabidopsis

[0104] 1. Construction of EDS1 knockout vector

[0105] 1) Knockout target design

[0106] The target sites for knocking out the EDS1 gene were designed using the website http: / / skl.scau.edu.cn / . The target site sequences are as follows (5' to 3'):

[0107] Target 1: CTATCTTCAGTCACGCACTTGGG (SEQ ID NO:4), where positions 1 to 20 are the target sites and positions 21 to 23 are the PAM sequence;

[0108] Target 2: CTAAGTCCTTATAGACCCGCCGG (SEQ ID NO:5), where positions 1 to 20 are the target sites and positions 21 to 23 are the PAM sequence.

[0109] 2) Primer design

[0110] Primers were designed based on the target sequence, as follows (5' to 3'):

[0111] Target1-BsF:ATATATGGTCTCGATTGCTATCTTCAGTCACGCACTTGTT;

[0112] Target1-F0:TGCTATCTTCAGTCACGCACTTGTTTTAGAGCTAGAAATAGC;

[0113] Target2-R0:AACGCGGGTCTATAAGGACTTAGCAATCTCTTAGTCGACTCTA C;

[0114] Target2-BsR:ATTATTGGTCTCGAAACGCGGGTCTATAAGGACTTAGC.

[0115] 3) PCR amplification

[0116] Four-primer PCR amplification was performed using the pCBC-DT1T2 vector as a template. A 50 μL reaction mixture was prepared with the following components: 25 μL 2×KOD Buffer, 10 μL 2 mM dNTPs, 1 μL KOD DNA Polymerase, 1.5 μL pCBC-DT1T2, 1.5 μL Target1-BsF, 1.5 μL Target2-BsR, 1.5 μL Target1-F0, 1.5 μL Target2-R0, and 6.5 μL ddH2O. The reaction conditions were: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 2 min, annealing at 55℃ for 30 s, extension at 68℃ for 30 s / kbp, final extension at 68℃ for 10 min, and storage at 4℃ for 2 min. PCR products were recovered by agarose gel electrophoresis.

[0117] 4) Enzyme digestion and ligation

[0118] The PCR fragment was ligated into the pHEE401E vector using a cut-and-ligate method to obtain the recombinant vector pHEE401E-EDS1, i.e., the EDS1 knockout vector. A 15 μL reaction mixture was prepared as follows: 2 μL of the PCR product from step 3, 2 μL of the pHEE401E vector, 1.5 μL of 10×T4 DNA ligase buffer, 1.5 μL of 10×BSA, 1 μL of Bsa I, 1 μL of T4 DNA ligase, and 6 μL of ddH2O. The reaction conditions were: 37℃ for 5 h, 50℃ for 5 min, 80℃ for 10 min, and storage at 4℃ for 2 min.

[0119] 5) Reaction product conversion and coating

[0120] Add 15 μL of the reaction product to 100 μL of *E. coli* DH 5α competent cells, place on ice for 30 min, heat shock at 42°C for 90 s, incubate on ice for 2 min, add 500 μL of LB medium, and incubate at 37°C in a shaker for 1 h. Spread the bacterial culture evenly on LB agar plates containing 50 mg / L kanamycin. Invert the plates and incubate overnight at 37°C.

[0121] 6) Cloning identification

[0122] Following colony PCR, PCR-positive single colonies were selected and sent to a sequencing company for routine Sanger sequencing. Sequencing results showed that the recombinant vector pHEE401E-EDS1 was obtained by replacing the fragment between the BsaI restriction sites of the pHEE401E vector with the DNA molecule shown in SEQ ID NO:6. pHEE401E-EDS1 can express sgRNA and Cas9 protein targeting target sites 1 and 2.

[0123] 2. Obtaining transgenic Arabidopsis thaliana

[0124] 1) Agrobacterium-mediated transformation

[0125] The pHEE401E-EDS1 plasmid was introduced into Agrobacterium GV3101 strain via electroporation. The specific steps are as follows: 1 μL of plasmid was added to 100 μL of Agrobacterium GV3101 competent cells, transferred to an electroporation cuvette, and electroporated at 2500V / 6ms. Then, 500 μL of LB medium was added, and the mixture was incubated at 28℃ in a shaker for 1 h. The bacterial culture was then evenly spread onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L gentamicin. The plates were inverted and incubated at 28℃ for 48 h to screen for positive colonies.

[0126] 2) Agrobacterium-mediated genetic transformation in Arabidopsis thaliana

[0127] Agrobacterium GV3101 carrying the pHEE401E-EDS1 plasmid was streaked onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L gentamicin, and incubated at 28°C for 48 h. Single colonies were picked and transferred to 2 mL of LB liquid medium containing 50 mg / L kanamycin and 50 mg / L gentamicin, and incubated overnight at 28°C in a shaker for 12 h.

[0128] Inoculate 2 mL of bacterial culture into 300 mL of LB liquid medium containing the corresponding antibiotics (50 mg / L kanamycin and 50 mg / L gentamicin) and incubate at 28 °C in a shaker for 12 h.

[0129] Collect bacterial cells by centrifugation at 4000 rpm for 10 min at room temperature, resuspend in 5% sucrose aqueous solution, and adjust OD. 600 Add 0.017% Silwet L-77 solution to a concentration between 0.8 and 1.0, and mix thoroughly.

[0130] Est-1 Arabidopsis thaliana with good growth after about 8 weeks in a long-day plant culture room (temperature 23℃, relative humidity 60%, light cycle of 16h light and 8h darkness) was selected. Agrobacterium was transformed by the flower dip method. The specific operation was as follows: the mature pods were cut off, the inflorescence was soaked in the bacterial solution for 5 minutes for transformation, and after 24 hours of dark culture, it was cultured under normal light.

[0131] After the seeds mature, they are surface disinfected with 30% 84 disinfectant for 10 minutes, sterilized by washing with ddH2O 5 times, and spread evenly on 1 / 2 MS plates containing 25 mg / L hygromycin and 50 mg / L carbenicillin. They are then treated at 4℃ for 48 hours. The plates are then transferred to a plant culture chamber (temperature 22℃, relative humidity 60%, photoperiod of 16 hours light and 8 hours dark). After 10 to 12 days, healthy seedlings (T0 generation) are selected and transplanted into a plant culture room for conventional cultivation.

[0132] 3) Obtaining EDS1 knockout Arabidopsis

[0133] Transgenic T0 generation Arabidopsis thaliana was continuously self-pollinated to obtain T2 generation transgenic lines. T2 generation transgenic Arabidopsis thaliana plants grown in a plant culture room for approximately 4 weeks were selected, and 1-2 leaves were taken from each plant. Genomic DNA was extracted using the CTAB method. The target sequence was amplified using primers EDS1-crispr-F and EDS1-crispr-R. The PCR products were sent to a sequencing company for routine Sanger sequencing, identifying two different mutation forms of EDS1 knockout Arabidopsis thaliana mutants. Figure 1 They were named eds1-1 and eds1-2, respectively. The primer sequences (5' to 3') are as follows:

[0134] EDS1-crispr-F:GTGGAAATGGCTGTGAGGAG;

[0135] EDS1-crispr-R:GGGCTTGACACTTTGGCTTG.

[0136] The EDS1 knockout in Arabidopsis thaliana eds1-1 and eds1-2 represents a homozygous mutation in the EDS1 gene (the same mutation occurred on both chromosomes). The mutation is described as follows:

[0137] Compared to wild-type Arabidopsis thaliana Est-1, the eds1-1 mutant exhibits the following genomic changes on two homologous chromosomes of Arabidopsis thaliana as shown in SEQ ID NO.3: a thymine deoxyribonucleotide (T) is inserted between positions 882 and 883 of SEQ ID NO.3, thereby knocking out the EDS1 gene, that is, knocking out the gene encoding the EDS1 protein in Arabidopsis thaliana Est-1.

[0138] Compared to wild-type Arabidopsis thaliana Est-1, the eds1-2 mutant exhibits the following genomic changes on two homologous chromosomes of Arabidopsis thaliana as shown in SEQ ID NO.3: 298 deoxynucleotides from position 585 to position 882 of the sequence shown in SEQ ID NO.3 are deleted, thereby knocking out the EDS1 gene, that is, knocking out the gene encoding the EDS1 protein in Arabidopsis thaliana Est-1.

[0139] II. Analysis of resistance to *Platycorrhizal fungus* in EDS1 knockout Arabidopsis thaliana

[0140] 1. Inoculation with *Cladosporium brassicae*

[0141] Twenty-four wild-type Arabidopsis thaliana Est-1, 24 EDS1 knockout Arabidopsis thaliana eds1-1, and 24 eds1-2 mutant lines were taken and planted in holes, four lines per hole, in a short-day plant culture chamber (temperature 23℃, relative humidity 60%, photoperiod 10h light and 14h dark). After the plants emerged and grew for 20 days, a root drenching experiment was conducted to investigate the infection of *Platycodon brassicae*. The experiment was repeated three times, with each inoculation consisting of at least 12 wild-type Arabidopsis thaliana Est-1, eds1-1, and eds1-2 mutant lines. The specific steps are as follows:

[0142] 1) Chop the root tissue of Chinese cabbage containing *Cladosporium brassicae* from Dayi County, Sichuan Province, add an appropriate amount of water, and grind it using a tissue homogenizer.

[0143] 2) Filter with 8 layers of gauze and transfer the filtrate into a clean Erlenmeyer flask.

[0144] 3) Measure the spore concentration of *Plasmodiophora brassicae* in the bacterial culture using a hemocytometer.

[0145] 4) Dilute the concentration of *Plantochoria brassicae* to 1×10⁻⁶. 7 The bacterial culture was diluted to 1 mL using a pipette and then applied to the roots of Arabidopsis thaliana for inoculation.

[0146] 2. Disease index and incidence rate statistics

[0147] On day 21 after Arabidopsis thaliana root inoculation with *Plasmodiophora brassicae*, the incidence rate and disease index were statistically analyzed using the *Plasmodiophora brassicae* grading system. The statistical criteria for the *Plasmodiophora brassicae* grading system in Arabidopsis thaliana are as follows:

[0148] Grade 0, no symptoms, intact root system;

[0149] Grade 1, with small nodules on the lateral roots, but no symptoms on the main root;

[0150] Grade 2, fewer lateral roots, small lumps on the main root;

[0151] Grade 3, with large lumps on the lateral roots and main root;

[0152] Grade 4, the main root is completely swollen and rotten.

[0153] The formulas for calculating the incidence rate and disease index are as follows:

[0154] Incidence rate = (Number of diseased plants / Total number of inoculated plants) × 100%

[0155] Disease index = (∑(Disease level × Number of diseased plants at each level)) / (Total number of inoculated plants × Highest disease level 4)) × 100

[0156] Symptoms, disease index, and incidence rate of plants 21 days after inoculation with *Cladosporium brassicae* are as follows: Figure 2 As shown in Figure AC, the results indicate that wild-type Arabidopsis thaliana Est-1, after inoculation with *Cladosporium brassicae*, exhibited resistance, meaning root development was generally normal, with only a few plants showing mild symptoms. However, in the context of the resistant material Est-1, the EDS1 gene knockout mutants eds1-1 and eds1-2 showed susceptibility, characterized by root swelling and destruction of lateral roots. Specifically, the lateral roots of the eds1-1 mutant were completely damaged, leaving only a single swollen taproot; the lateral roots of the eds1-2 mutant were damaged, with only a few remaining. These results demonstrate that the EDS1 gene mediates resistance in Arabidopsis thaliana to *Cladosporium brassicae*, providing a new gene resource for breeding plants with resistance to clubroot disease.

[0157] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The use of the EDS1 protein, or a substance regulating the expression of the gene encoding the EDS1 protein, or a substance regulating the content of the EDS1 protein, in any of the following: A1) Application in regulating plant resistance to clubroot disease; A2) Application in the preparation of products that regulate plant clubroot resistance; A3) Application in regulating resistance to *Plantema rubrum* in plants; A4) Application in the preparation of products that regulate resistance to *Cladosporium brassicae* in plants; A5) Applications in plant breeding or plant-assisted breeding; A6) Application in the preparation of plant breeding or plant-assisted breeding products; The EDS1 protein is any of the following proteins: a1) A protein whose amino acid sequence is SEQ ID NO.2; a2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are related to plant disease resistance. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

2. Use according to claim 1, characterized in that, The substance that regulates the expression of the EDS1 protein-encoding gene or the substance that regulates the content of the EDS1 protein is a biological material, and the biological material is any one of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the EDS1 protein-encoding gene as described in claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8) A nucleic acid molecule encoding the EDS1 protein as described in claim 1; B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

3. The application according to claim 2, characterized in that, B1) The nucleic acid molecule is either RNA that targets the gene encoding the EDS1 protein or DNA that encodes the RNA; B8) The nucleic acid molecule is any one of the following (g1)-g3): g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.1; g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.3; g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant disease resistance.

4. The application according to any one of claims 1-3, characterized in that, The plants were selected from dicotyledonous plants.

5. A method for regulating plant resistance to clubroot disease, characterized in that, The method includes regulating clubroot resistance in recipient plants by controlling the expression level of the EDS1 gene encoding the EDS1 protein of claim 1 in the recipient plant and / or controlling the content of the EDS1 protein in the recipient plant.

6. The method according to claim 5, characterized in that, The method includes reducing clubroot resistance in recipient plants by decreasing the expression level of the gene encoding the EDS1 protein and / or reducing the content of the EDS1 protein in the recipient plants, wherein the recipient plants contain the gene encoding the EDS1 protein.

7. The method according to claim 6, characterized in that, The purpose of reducing the expression level of the gene encoding the EDS1 protein in the recipient plant and / or reducing the content of the EDS1 protein in the recipient plant is achieved through the method described in M1) or M2) below. M1) The gene encoding the EDS1 protein in the recipient plant was knocked out using the CRISPR / Cas9 system. The recipient plant contains the gene encoding the EDS1 protein. M2) The genome sequence in the recipient plant will be mutated by any of the following methods: M2-1) The genome sequence shown in SEQ ID NO.3 on two homologous chromosomes of the recipient plant is modified as follows: one thymine deoxyribonucleotide is inserted between positions 882 and 883 of SEQ ID NO.3; M2-2) The genome sequence shown in SEQ ID NO.3 on two homologous chromosomes of the recipient plant was modified as follows: 298 deoxynucleotides from position 585 to position 882 of the sequence shown in SEQ ID NO.3 were deleted.

8. A method for obtaining Arabidopsis thaliana with reduced clubroot resistance, characterized in that, The method includes obtaining a target Arabidopsis thaliana with reduced clubroot resistance by reducing the expression level of the gene encoding the EDS1 protein in the recipient Arabidopsis thaliana and / or reducing the content of the EDS1 protein in the recipient Arabidopsis thaliana, wherein the recipient Arabidopsis thaliana contains the gene encoding the EDS1 protein.

9. The method according to claim 8, characterized in that, The reduction of the expression level of the gene encoding the EDS1 protein in the recipient Arabidopsis thaliana and / or the reduction of the content of the EDS1 protein in the recipient Arabidopsis thaliana are achieved by the method described in N1) or N2) below. N1) The gene encoding the EDS1 protein in the recipient Arabidopsis thaliana was knocked out using the CRISPR / Cas9 system. The recipient Arabidopsis thaliana contains the gene encoding the EDS1 protein. N2) By performing any of the following mutations on the genome sequence in the recipient Arabidopsis thaliana: N2-1) The genome sequence shown in SEQ ID NO.3 on the two homologous chromosomes of the recipient Arabidopsis thaliana was modified as follows: one thymine deoxyribonucleotide was inserted between positions 882 and 883 of SEQ ID NO.3; N2-2) The genome sequence shown in SEQ ID NO.3 on the two homologous chromosomes of the recipient Arabidopsis thaliana was modified as follows: 298 deoxynucleotides from position 585 to position 882 of the sequence shown in SEQ ID NO.3 were deleted.

10. The EDS1 protein as described in claim 1 and the biomaterials as described in claims 2-4.

Images