A nano-magnesium oxide-based polymerase hot start method

Abstract

This invention discloses the use of nano-magnesium oxide particles as a PCR amplification modifier in hot-start PCR, and also discloses a polymerase hot-start PCR reagent based on nano-magnesium oxide. The magnesium ion release of the nano-magnesium oxide is temperature-dependent, with a release rate of less than 5% below 25°C and a release rate of more than 90% above 95°C. It activates DNA polymerase, initiates PCR amplification, and improves the specificity and amplification efficiency of the PCR reaction. It is suitable for conventional PCR, long-fragment PCR, and amplification of templates with high GC content, and has broad application prospects.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to the use of magnesium oxide particles as a PCR enhancer in hot-start PCR, specifically to a polymerase hot-start method based on nano-magnesium oxide and its dedicated kit. Background Technology

[0002] Polymerase chain reaction (PCR) is a core technique in molecular biology, widely used in gene cloning, disease diagnosis, and forensic identification. In conventional PCR reactions, magnesium ions are an essential cofactor for DNA polymerase, and their concentration directly affects polymerase activity and primer annealing specificity. However, under room temperature or low temperature conditions, free magnesium ions can cause premature activation of DNA polymerase, leading to non-specific primer binding and primer dimer formation, severely reducing the specificity and amplification efficiency of the PCR reaction.

[0003] Hot-start PCR technology is a key approach to solving the above problems. Its core principle is to inhibit the activity of DNA polymerase (such as Taq polymerase) in the initial low-temperature stage of the PCR reaction (such as room temperature loading and 4°C incubation) to avoid non-specific binding of primers to the template and primer dimer formation. When the reaction enters the high-temperature pre-denaturation stage (around 95°C), the enzyme activity is released by temperature triggering, so that amplification only starts after specific annealing, thereby reducing impurities.

[0004] Existing hot-start PCR techniques mainly include chemically modified enzyme methods, antibody inhibition methods, and ligand-binding methods. However, these methods have the following drawbacks: chemical modification methods require covalent modification of the enzyme, which is costly and may affect enzyme activity; antibody inhibition methods require the preparation of specific antibodies for each enzyme, resulting in poor versatility; ligand-binding methods require the addition of aptamers or small molecule inhibitors to the system, making the operation complex; more importantly, all of the above methods depend on the specific type of enzyme and cannot achieve the broad applicability of hot-start PCR. Therefore, improving traditional hot-start PCR reaction techniques has become an urgent need in this field. Summary of the Invention

[0005] To address the aforementioned problems of existing hot-start PCR technologies, based on their working principles, we optimized the components of the PCR reaction system by introducing nano-magnesium oxide to replace magnesium salts as the magnesium ion donor. This effectively controls the timely release of magnesium ions, thereby developing a novel PCR reaction system and a hot-start method for DNA polymerase. Specifically, this invention includes the following technical solutions.

[0006] The first aspect of the present invention is to provide the use of magnesium oxide particles as a PCR amplification enhancer / synergist in hot-start PCR.

[0007] Preferably, the magnesium oxide particles are nano-magnesium oxide with a particle size of 10-100 nm, more preferably 12-80 nm, more preferably 15-70 nm, more preferably 18-60 nm, more preferably 20-50 nm, for example, about 20 nm.

[0008] In one embodiment, the amount of the magnesium oxide particles used in the PCR reaction system is a final concentration of 1-10 mM, preferably 2-9 mM, preferably 3-8 mM, preferably 4-7 mM, more preferably 5-6 mM, for example, about 5 mM, and it is stored in the form of lyophilized powder or suspension.

[0009] It should be understood that, in describing numerical characteristics herein, the terms "about," "approximately," or "around" refer to a range that reasonably fluctuates around the stated value. The range of numerals used in this invention includes both the numeral itself and any number within that range.

[0010] The magnesium ion release of the above-mentioned nano-magnesium oxide is temperature-dependent. The release rate is no more than 5% below 25°C, preferably no more than 3%, preferably no more than 1%, and more preferably about 0%. The release rate is no less than 90% above 95°C, preferably no less than 92%, preferably no less than 95%, preferably no less than 98%, and more preferably 100%.

[0011] The PCR amplification described above can be selected from the following group of PCR reactions: conventional PCR, nested PCR, and qPCR such as RT-qPCR.

[0012] A second aspect of the present invention is to provide a PCR reagent comprising the nano-magnesium oxide as described in claim 2, but excluding a solution containing free magnesium ions or a magnesium salt that releases magnesium ions upon dissolution in water, such as a buffer solution that does not contain magnesium ions, so as to prevent free magnesium ions at room temperature / room temperature from causing premature activation of DNA polymerase, leading to non-specific primer binding and primer dimer formation, thereby reducing the specificity and amplification efficiency of the PCR reaction.

[0013] Furthermore, in addition to containing nano-magnesium oxide, the above-mentioned PCR reagent also includes conventional PCR reaction system components, namely template DNA, primers, DNA polymerase, dNTPs, and buffer, and the buffer does not contain free magnesium ions.

[0014] Preferably, the above-mentioned PCR reagent also contains a PCR enhancer, which is selected from the group consisting of betaine, DMSO, BSA, and mixtures of two or more of them.

[0015] The DNA polymerases mentioned above are magnesium-dependent DNA polymerases, selected from Taq DNA polymerase, high-fidelity DNA polymerase, and polymerases for long-fragment PCR.

[0016] In one embodiment, the above-mentioned PCR reagent is suitable for highly specific amplification of long DNA fragments (≥5 kb), templates with high GC content (GC content ≥60%), and templates with low concentration.

[0017] When the above PCR reagents are used for PCR amplification reactions, the denaturation temperature of the PCR thermal cycle is 94-98℃ and the denaturation time is 10-30 s. Under these conditions, the reaction rate of nano-magnesium oxide with water is significantly improved, and the concentration of magnesium ions released within 10 seconds is sufficient to activate the polymerase.

[0018] The method for using the above PCR reagents for polymerase hot-start includes the following steps:

[0019] (1) Preparation of PCR reaction system: Add magnesium oxide particles to the conventional PCR reaction system, wherein the conventional PCR reaction system contains template DNA, primers, DNA polymerase, dNTPs, and buffer, and the buffer does not contain free magnesium ions;

[0020] (2) Perform PCR thermal cycling: During the high-temperature denaturation stage, nano-magnesium oxide reacts with water in the system to generate magnesium hydroxide. Under the synergistic effect of alkaline conditions and high temperature in the PCR buffer, magnesium ions are released, which activate DNA polymerase activity and start PCR amplification. Under normal temperature conditions, nano-magnesium oxide does not release magnesium ions, and DNA polymerase is inactive, thus avoiding non-specific amplification.

[0021] A third aspect of the present invention is to provide a PCR kit or PCR instrument / device, which is a polymerase hot-start PCR kit or PCR instrument / device based on nano-magnesium oxide, characterized in that it comprises or uses the PCR reagent as described in claim 6.

[0022] In one embodiment, the PCR reagents contained in or used in the above-mentioned PCR kit or PCR instrument / device include the following components: PCR buffer free of free magnesium ions; DNA polymerase; dNTPs; primer mixture; nano magnesium oxide solid suspension; and positive control template.

[0023] Furthermore, in addition to the PCR reagents and commonly used biological and chemical reagents for preparing the PCR reaction system, the aforementioned PCR kit may also include at least one of the following items: a carrying tool, the space of which is divided into a defined space for accommodating one or more containers, 96-well plates, or strips, such as kits, vials, test tubes, and the like, each containing a single component for the method of the present invention; and an instruction manual, which may be written on the vials, test tubes, and the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper document with an operation demonstration video app download window, such as a QR code. The instruction manual may also be in a tangible or intangible multimedia form, such as a USB flash drive or cloud storage.

[0024] This invention is the first to use nano-magnesium oxide to replace free magnesium ions in the traditional PCR reaction system. This allows magnesium ions to be generated and DNA polymerase activity activated only during PCR amplification at 94-98℃ thermal denaturation. This results in a PCR reagent with DNA polymerase activation that is temperature-dependent on denaturation, effectively suppressing the defect of non-specific amplification at low temperatures in the PCR reaction system and improving the specificity and product purity of the PCR reaction. The polymerase hot-start method based on nano-magnesium oxide developed in this invention is simple to operate, low in cost, and suitable for conventional PCR, long-fragment PCR, and amplification of templates with high GC content, showing broad application prospects. Attached Figure Description

[0025] Figure 1 Agarose gel electrophoresis images show the effect of different concentrations of nano-magnesium oxide on the product specificity of PCR amplification of mouse genomic DNA using a Taq DNA polymerase-based PCR reaction system. Lines 1-8: Conventional Mg²⁺ + Line 1 (2 mM MgSO4): Amplified products with sizes approximately 1k, 2k, 3k, 4k, 5k, 6k, 7k, and 8k. Lines 9-16: 0 mM nano-MgSO4: Amplified products with sizes approximately 1k, 2k, 3k, 4k, 5k, 6k, 7k, and 8k. Lines 17-24: 5 mM nano-MgSO4: Amplified products with sizes approximately 1k, 2k, 3k, 4k, 5k, 6k, 7k, and 8k. Line 25: 10 mM nano-MgSO4, D2000 Marker. Bands 17-24 are clearly single, bright, and exhibit the best specificity.

[0026] Figure 2This image shows agarose gel electrophoresis photographs illustrating the effect of different concentrations of nano-magnesium oxide on the product specificity of PCR amplification of mouse genomic DNA using a high-fidelity DNA polymerase (Phusion) reaction system. Lines 1-8: conventional Mg²⁺ group (2 mM MgSO₄), with amplified product sizes of approximately 1kJ, 2kJ, 3kJ, 4kJ, 5kJ, 6kJ, 7kJ, and 8kJ; Lines 9-16: 0 mM nano-magnesium oxide group, with amplified product sizes of approximately 1kJ, 2kJ, 3kJ, 4kJ, 5kJ, 6kJ, 7kJ, and 8kJ; Lines 17-24: 5 mM nano-magnesium oxide group, with amplified product sizes of approximately 1kJ, 2kJ, 3kJ, 4kJ, 5kJ, 6kJ, 7kJ, and 8kJ; Line 25: 10 mM nano-magnesium oxide, D2000 Marker. The bands in Lines 17-24 are single, bright, and exhibit the best specificity. Detailed Implementation

[0027] To overcome the drawbacks of existing hot-start PCR techniques, such as high cost, complex operation, and strong enzyme dependence, this invention develops a polymerase hot-start method and PCR reagent based on nano-magnesium oxide, achieving broad-spectrum, high-efficiency, and low-cost hot-start PCR. This PCR reagent utilizes the characteristic that nano-magnesium oxide is a solid particle at room temperature and does not release magnesium ions, thus inhibiting DNA polymerase at room temperature. During the high-temperature denaturation stage of PCR, nano-magnesium oxide reacts with water to generate magnesium hydroxide, which slowly releases magnesium ions under the synergistic effect of alkaline buffer and high temperature, activating polymerase activity and achieving broad-spectrum, high-efficiency hot-start PCR. This method requires no modification to the polymerase and is applicable to various magnesium-dependent DNA polymerases, including Taq polymerase, high-fidelity polymerase, and long-fragment polymerase, significantly reducing non-specific amplification and primer dimer formation, and improving the specificity and amplification efficiency of the PCR reaction.

[0028] Nanomaterials, due to their unique physicochemical properties, have shown promising applications in PCR enhancement. For example, gold nanoparticles and carbon nanotubes can improve the sensitivity and specificity of PCR reactions. However, existing nanomaterials mostly function by enhancing thermal conductivity or through non-specific adsorption, and there are no reports on utilizing the temperature-responsive ion release characteristics of nanomaterials to achieve hot-start PCR. This invention is the first to propose using the temperature-responsive magnesium ion release characteristics of nano-magnesium oxide to achieve broad-spectrum hot-start of any magnesium ion-dependent polymerase, filling the gap in the universality and ease of operation of existing technologies.

[0029] The technical solution of this invention is based on the temperature response characteristics of nano-magnesium oxide (MgO) in PCR reaction system solutions: 1. Room temperature stage (≤25℃): Nano-magnesium oxide is a solid particle, suspended in the solution in a colloidal state. It is insoluble in water and does not release magnesium ions. There are no free magnesium ions in the PCR reaction system, and the DNA polymerase is in an inactive "dormant" state, avoiding non-specific primer binding and primer dimer formation. 2. High temperature denaturation stage (94-98℃): Nano-magnesium oxide reacts with water in the PCR system to generate magnesium hydroxide (Mg(OH)2), as shown in the following reaction formula:

[0030] MgO + H₂O → Mg(OH)₂

[0031] Magnesium hydroxide is a typical sparingly soluble hydroxide with extremely low solubility in pure water at room temperature; its solubility at 25°C is approximately 9.6 mg / L, corresponding to a magnesium ion concentration of only about 0.16 mM. However, under the synergistic effect of alkaline conditions (pH 8.3–8.8) and high temperature (>90°C) in PCR buffer, the solubility equilibrium of magnesium hydroxide shifts to the right, releasing sufficient magnesium ions (>1.5 mM) to meet the concentration requirements for activating DNA polymerase and initiating PCR amplification. Therefore, nano-magnesium oxide exhibits the characteristic of "thermally controlled release of DNA polymerase activity" in PCR reaction systems.

[0032] Nanoscale magnesium oxide solid particles are in a near-solution suspension state in the PCR reaction system buffer, and can be rapidly converted into magnesium hydroxide during the high-temperature denaturation stage above 90°C.

[0033] The lower limit of the average particle size of magnesium oxide solid particles is 10 nm, preferably 12, 15, 18 or 20 nm; the upper limit is 100 nm, preferably 80, 70, 60 or 50 nm. If the average particle size is less than 10 nm, the price of magnesium oxide nanoparticles is too high, resulting in increased costs; on the other hand, if the average particle size of magnesium oxide nanoparticles is greater than 100 nm, the reaction rate of magnesium oxide reacting with water to convert into magnesium hydroxide tends to decrease, which may lead to a prolonged PCR amplification time.

[0034] In a specific embodiment of the present invention, the lower limit of the amount of magnesium oxide used in the PCR reaction system, expressed as a final concentration, is 1 mM, preferably 1.0, 1.5, 1.8, 2.0, 2.2, 2.5, 2.8, or 3.0 mM; the upper limit is 10 mM, preferably 9, 8, 7, or 6 mM. If the amount of magnesium oxide nanoparticles used is less than 1 mM, the activation effect on DNA polymerase will be insufficient, which may lead to a prolonged PCR amplification time. On the other hand, if the amount of magnesium oxide nanoparticles used is greater than 10 mM, it will increase the cost of PCR reagents, and excessively high magnesium ion concentration will lead to a decrease in PCR specificity and / or product purity.

[0035] The PCR reagents and polymerase hot-start method of the present invention have broad applicability. Since all known DNA polymerases in traditional PCR reaction systems depend on magnesium ions as cofactors, by controlling the temperature-responsive release of magnesium ions, it can be applied to any magnesium ion-dependent polymerase without the need for modification or optimization for specific enzymes.

[0036] In general, the beneficial effects of this invention are mainly reflected in the following aspects:

[0037] 1. Broad-spectrum applicability: This invention does not rely on the modification of specific polymerases or antibodies, and is applicable to all magnesium ion-dependent DNA polymerases, including Taq polymerases, high-fidelity polymerases, long-fragment polymerases, etc., truly achieving "plug and play".

[0038] 2. High specificity: No free magnesium ions at room temperature, completely avoiding non-specific amplification and primer dimers, especially suitable for amplification of long fragments and high GC templates.

[0039] 3. Simple operation: No chemical modification of polymerase or addition of antibodies is required. Simply add nano magnesium oxide directly to the conventional PCR system. The steps are simple and do not require any changes to the original PCR procedure.

[0040] 4. Low cost: Nano magnesium oxide is inexpensive (approximately a few yuan per gram), reducing costs by more than 50% compared to commercial hot-start enzyme kits.

[0041] 5. Good compatibility: It can be used in conjunction with PCR enhancers such as betaine, DMSO, and BSA to further improve amplification efficiency and is suitable for complex templates.

[0042] To make the present invention more apparent and understandable, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0043] Example

[0044] The embodiments involve the addition amount, content and concentration of various substances. Unless otherwise specified, the "parts" mentioned therein refer to "parts by weight"; unless otherwise specified, the percentage content refers to the mass percentage content.

[0045] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-35°C).

[0046] Example 1: Effect of nano magnesium oxide concentration on the specificity of PCR amplification of mouse genomic DNA

[0047] Materials and Methods

[0048] Template: Mouse genomic DNA (50 ng / μL), extracted by Nantong Maijie Biotechnology Co., Ltd.

[0049] Polymerase: Taq DNA polymerase, Nantong Maijie Biotechnology Co., Ltd.

[0050] dNTPs: 2.5 mM each, Thermo Fisher Scientific, Product No.: R0192

[0051] Buffer: 10×PCR Buffer A contains Tris-HCl pH 8.8, KCl, Triton X-100, etc.

[0052] Nano-sized magnesium oxide: average particle size 20 nm, purchased from Maclean, catalog number: M675492

[0053] Primers for amplifying mouse gene fragments at kJ / k (1k, 2k, 3k, 4k, 5k, 6k, 7k, and 8k) are shown in the table below:

[0054] PCR primers: primers for the target gene

[0055] Primer name sequence 1k-F GGCGTACAAGTGGTGAGTGA 1k-R CCCCATGCAGCCTCCTTAAA 2k-F TTGCTAGGATTGGGTGCCTG 2k-R GATCATGGAGCTGAGGTCGG 3k-F GGCGTACAAGTGGTGAGTGA 3k-R AGAGCCCCTGACAATCAAGC 4k-F AGCTACAGGAGGGTCGCTTA 4k-R GATCATGGAGCTGAGGTCGG 5k-F CGCGGAACTCGTCTGGAGAT 5k-R TTCCCAAAGGGCAACTCCGT 6k-F CGGCTCGCTCTTCCCTTACA 6k-R AAGGGGCGTGGCAGAGATAC 7k-F CAGGCTTAGCAGCCGTTGTG 7k-R AGGTGGGGAAGGCAGTTCAC 8k-F CTTTCGCTGTTGCACACGGT 8k-R TCACACAACCGGCTCACCTT

[0056] PCR reaction program: 95℃ for 5 min; 95℃ for 20 s, 60℃ for 20 s, 72℃ for 30 s, 35 cycles; 72℃ for 10 min.

[0057] Experimental Groups:

[0058] Control group 1 (CK-1): 2 mM MgSO4 (conventional hot start simulation)

[0059] Control group 2 (CK-2): 0 mM nano magnesium oxide

[0060] Experimental group 1: 5 mM nano magnesium oxide

[0061] PCR reaction system:

[0062] Element Volume (μL) 10×PCR Buffer A (self-prepared, magnesium-free) 2 dNTPs (10 mM) 0.4 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 0.4 Taq DNA polymerase (2.5 U / μL) 0.2 Mouse genomic DNA 1 Nano magnesium oxide suspension Final concentration 5 mM <![CDATA[ddH2O]]> Supplement to 20

[0063] Product detection: 2% agarose gel electrophoresis, GoldView staining.

[0064] Experimental results

[0065] Electrophoresis results as follows Figure 1As shown in the figure, control group 1 showed multiple non-specific bands with obvious primer dimers; control group 2 showed no amplified bands; experimental group 1 (5 mM magnesium oxide nanoparticles) produced a single bright target band without primer dimers; experimental group 2 (10 mM magnesium oxide nanoparticles, Marker) showed a slightly weaker band, possibly due to excessive magnesium ion concentration inhibiting polymerase. The results indicate that 5 mM magnesium oxide nanoparticles is the optimal concentration, effectively achieving hot-start and improving specificity.

[0066] Example 2: Broad applicability of the nano-magnesium oxide hot-start method to different polymerases

[0067] Template: Mouse genomic DNA (50 ng / μL), extracted by Nantong Maijie Biotechnology Co., Ltd.

[0068] Polymerase: High-fidelity DNA polymerase (Phusion), Thermo Fisher Scientific, Catalog No.: F530S

[0069] dNTPs: 2.5 mM each, Thermo Fisher Scientific, Product No.: R0192

[0070] Buffer: 10×PCR Buffer B (containing Tris-HCl pH 8.8, KCl, Triton X-100, etc.)

[0071] Nano-sized magnesium oxide: average particle size 20 nm, purchased from Maclean, catalog number: M675492

[0072] Primers for amplifying mouse gene fragments at kJ / k (1k, 2k, 3k, 4k, 5k, 6k, 7k, and 8k) are shown in the table below:

[0073] PCR primers: primers for the target gene

[0074] Primer name sequence 1k-F GGCGTACAAGTGGTGAGTGA 1k-R CCCCATGCAGCCTCCTTAAA 2k-F TTGCTAGGATTGGGTGCCTG 2k-R GATCATGGAGCTGAGGTCGG 3k-F GGCGTACAAGTGGTGAGTGA 3k-R AGAGCCCCTGACAATCAAGC 4k-F AGCTACAGGAGGGTCGCTTA 4k-R GATCATGGAGCTGAGGTCGG 5k-F CGCGGAACTCGTCTGGAGAT 5k-R TTCCCAAAGGGCAACTCCGT 6k-F CGGCTCGCTCTTCCCTTACA 6k-R AAGGGGCGTGGCAGAGATAC 7k-F CAGGCTTAGCAGCCGTTGTG 7k-R AGGTGGGGAAGGCAGTTCAC 8k-F CTTTCGCTGTTGCACACGGT 8k-R TCACACAACCGGCTCACCTT

[0075] PCR reaction program: 95℃ for 5 min; 95℃ for 20 s, 60℃ for 20 s, 72℃ for 30 s, 35 cycles; 72℃ for 10 min.

[0076] PCR reaction system:

[0077] Element Volume (μL) 10×PCR Buffer B (self-prepared, magnesium-free) 2 dNTPs (10 mM) 0.4 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 0.4 Phusion polymerase (2.5 U / μL) 0.2 Mouse genomic DNA 1 Nano magnesium oxide suspension Final concentration 5 mM <![CDATA[ddH2O]]> Supplement to 20

[0078] Product detection: 2% agarose gel electrophoresis, GoldView staining.

[0079] Experimental results

[0080] like Figure 2As shown, the PCR amplification results are similar to those of Taq DNA polymerase. Phusion polymerase can efficiently amplify the target fragment in a magnesium oxide nanoparticle hot-start system without any extraneous bands. This indicates that the method of the present invention does not depend on a specific polymerase and has broad applicability.

[0081] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Based on the above embodiments, any modifications, equivalent substitutions, or improvements made by those skilled in the art within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of magnesium oxide particles as a PCR amplification enhancer / synergist in hot-start PCR.

2. The use as described in claim 1, characterized in that, The magnesium oxide particles are nano-magnesium oxide with a particle size of 10-100 nm.

3. The use as described in claim 1, characterized in that, The magnesium oxide particles used in the PCR reaction system have a final concentration of 1-10 mM.

4. The use as described in claim 1, characterized in that, The PCR amplification is selected from the following group of PCR reactions: conventional PCR, nested PCR, qPCR such as RT-qPCR.

5. A PCR reagent, characterized in that, The PCR reagent contains the nano-magnesium oxide as described in claim 2, but does not contain a solution containing free magnesium ions or a magnesium salt that releases magnesium ions when dissolved in water, such as a buffer solution that does not contain magnesium ions.

6. The PCR reagent as described in claim 5, characterized in that, In addition to the nano-magnesium oxide as described in claim 2, the PCR reagent also includes conventional PCR reaction system components, namely template DNA, primers, DNA polymerase, dNTPs, and buffer, and the buffer does not contain free magnesium ions.

7. The PCR reagent as described in claim 6, characterized in that, The PCR reagent also contains a PCR enhancer, which is selected from the group consisting of betaine, DMSO, BSA, and mixtures of two or more of them.

8. The PCR reagent as described in claim 6, characterized in that, The DNA polymerase is a magnesium-dependent DNA polymerase, selected from Taq DNA polymerase, high-fidelity DNA polymerase, and long-fragment PCR polymerase.

9. The PCR reagent as described in claim 6, characterized in that, When the PCR reagent is used for PCR amplification reaction, the denaturation temperature of the PCR thermal cycle is 94-98℃, and the denaturation time is 10-30 s.

10. A PCR kit or PCR instrument / device, characterized in that, It includes or uses the PCR reagent as described in claim 6.

Images