Molecular marker for identifying body shape of largemouth bass and application thereof
By screening for the SNP site g.1907.G>C on intron 4 of the cathepsin Bb (ctsbb) gene, the problem of lacking effective molecular markers in bighead carp body size breeding was solved, enabling rapid and accurate screening and breeding of bighead carp body size, improving breeding efficiency, cultivating superior varieties, and promoting the development of the bighead carp aquaculture industry.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-15
- Publication Date
- 2026-06-26
AI Technical Summary
The lack of effective molecular markers in existing technologies for genetic improvement of bighead carp body size leads to low breeding efficiency and makes it difficult to meet market demand for high-quality bighead carp varieties.
The SNP site g.1907.G>C on intron 4 of the cathepsin Bb (ctsbb) gene was screened out. Primer pairs (SEQ ID NO.9~SEQ ID NO.10) were designed for PCR amplification and Sanger sequencing to determine the body type genotype of bighead carp. Kits and identification methods are provided for rapid and accurate screening and breeding of bighead carp body type.
This method enables rapid and accurate screening of bighead carp body shape, improves breeding efficiency, cultivates superior varieties with large head proportions and rapid growth, enhances the economic benefits of aquaculture, and uncovers key metabolic pathways and genes related to the growth, body shape, and skeletal development of bighead carp.
Smart Images

Figure CN122279055A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding technology for aquatic animals, specifically relating to a molecular marker for identifying the body size of bighead carp and its application. Background Technology
[0002] Bighead carp ( Hyphalmichthys nobilis The bighead carp, also known as the silver carp or bighead carp, belongs to the order Cypriniformes and is one of the "four major freshwater fish" in my country. Its annual production has been increasing year by year, and it occupies an important position in the aquaculture industry. The head of the bighead carp is an important ingredient in traditional dishes, and the size of the head directly affects its market value and the economic benefits of aquaculture. Therefore, there is an urgent market demand for bighead carp varieties that grow quickly and have a large head proportion.
[0003] Currently, genetic improvement of bighead carp mainly focuses on growth traits, while research on genetic improvement of skeletal morphology and body shape is relatively scarce. Fish body shape is a crucial commercial characteristic determining their market value, and skeletal morphology directly affects body development. Skeletal deformities not only affect the appearance and growth of bighead carp but also reduce their survival rate and aquaculture efficiency. In existing technologies, the relationship between skeletal morphology, growth, and body shape in bighead carp remains unclear. Key genes and pathways regulating skeletal morphology in bighead carp have not been fully explored, and there is a lack of effective molecular markers for genetic improvement of body shape. This results in low efficiency in targeted breeding of bighead carp based on body shape, making it difficult to meet market demand for high-quality bighead carp varieties.
[0004] Therefore, screening molecular markers related to the body shape of bighead carp (especially key traits such as body weight and head-to-body ratio), clarifying their regulatory mechanisms, and establishing efficient molecular breeding methods are of great significance for promoting the development of the bighead carp genetic breeding industry and improving the economic benefits of aquaculture. Summary of the Invention
[0005] Technical problem solved: To address the above-mentioned technical problems, this invention provides a molecular marker for identifying the body shape of bighead carp and its application, which can quickly and accurately screen out bighead carp individuals with excellent body shape, providing technical support for molecular marker-assisted breeding of bighead carp and improving breeding efficiency.
[0006] Technical solution: In a first aspect, the present invention provides a molecular marker for identifying the body size of bighead carp. The molecular marker is a SNP site on the cathepsin Bb (ctsbb) gene, which is located on intron 4 of the ctsbb gene. Its nucleotide sequence exhibits a G / C polymorphism at position 1907 (named g.1907.G>C). The genotype of the SNP site is significantly correlated with the body weight of bighead carp (P<0.05), and the body weight of bighead carp individuals with the genotype CC is significantly higher than that of individuals with the genotype GC.
[0007] In a second aspect, the present invention provides a primer pair for amplifying a product containing the molecular marker described in the first aspect, the nucleotide sequences of said primer pair being shown in SEQ ID NO.9 to SEQ ID NO.10: SEQ ID NO.9:GAAACTCGCCAAACATACA; SEQ ID NO. 10: GATTTAGTCCAGTAGTCCCAC.
[0008] Thirdly, the present invention provides a kit for identifying the body size of bighead carp, the kit comprising the primer pair described in the second aspect.
[0009] Fourthly, the present invention provides a method for identifying the body size of silver carp, the specific process of which is as follows: Using the genomic DNA of the bighead carp to be tested as a template, PCR amplification was performed using the primer pairs described in the second aspect, followed by Sanger sequencing to determine the genotype of the SNP site. The weight of bighead carp individuals with the genotype CC was significantly higher than that of individuals with the genotype GC.
[0010] Fifthly, the present invention provides the application of the molecular markers described in the first aspect in assisted bighead carp breeding.
[0011] In a sixth aspect, the present invention provides the application of the molecular markers described in the first aspect in the genetic improvement of body size in bighead carp.
[0012] Beneficial effects: 1) The SNP molecular marker (g.1907.G>C) obtained by the present invention is significantly correlated with the weight of bighead carp, which can quickly and accurately screen out bighead carp individuals with excellent body shape (large weight), solve the problem of lack of effective molecular markers in the existing bighead carp body shape breeding, and improve the targeting and efficiency of breeding; 2) The molecular marker of the present invention can be applied to molecular marker-assisted breeding of bighead carp. By directional selection of individuals with the genotype CC, the genetic improvement process of bighead carp body shape can be accelerated, and superior varieties with large head proportion and fast growth can be bred to improve the economic benefits of aquaculture. At the same time, the marker can also be used for early identification of bighead carp body shape traits, reduce aquaculture costs, and promote the high-quality development of the bighead carp aquaculture industry. 3) In the process of screening molecular markers, this invention also discovered 8 key metabolic pathways and 5 key genes related to the growth, body size and skeletal development of bighead carp, providing a theoretical basis for in-depth research on the body size regulation mechanism of bighead carp and providing a reference for molecular breeding of other fish. Attached Figure Description
[0013] Figures 1-6 This is a normal distribution diagram of the growth traits of a single family of bighead carp, in which... Figures 1-6These are the growth traits: body weight, body height, body length, head height, head-to-body ratio, and head width. Figure 7 This is a partial electrophoresis image from a paternity test. The individual indicated by the arrow in the image does not belong to this family group, and its genotyping results do not match those of the male and female parents. Figures 8-9 This is a schematic diagram of the chromosome coverage depth of the sample, where, Figure 8 For the largest group of samples, Figure 9 This is a very small sample size; Figure 10 This is a distribution map of the ED association values of high-quality SNPs on chromosomes; Figure 11 This is the distribution of high-quality InDel ED association values on chromosomes; Figure 12 GO classification statistics for the corresponding genes in the candidate regions; Figure 13 A KEGG classification statistical graph of the corresponding genes in the candidate region; Figure 14 This is a partial peak diagram of the ctsbb gene sequence of the GC genotype bighead carp in this invention at position 1907; Figure 15 This is a partial peak diagram of the ctsbb gene sequence of the CC genotype bighead carp in this invention at position 1907. Figure 16 This is a partial peak diagram of the ctsbb gene sequence of the GG genotype bighead carp in this invention, at position 1907. Detailed Implementation
[0014] The present invention will be described in detail below with reference to specific embodiments: Example 1 A population was constructed using female and male bighead carp parents with significant differences in head size. Body size traits were measured and statistically analyzed. Simultaneously, SNPs and Indel-related regions obtained from genome sequencing of extreme individuals were analyzed to identify key pathways and genes regulating body size and growth, providing reference and theoretical guidance for molecular breeding of bighead carp. Specific methods included: 1.1 Measurement of silver carp A single family was constructed using female (4F22) and male (D18C) bighead carp parents with significant differences in head size. In November 2022, 281 six-month-old offspring from this single family were collected from the Zhangduhu base in Wuhan as the experimental population. After anesthetizing the live fish in the experimental population, the weight of each bighead carp was measured using an electronic balance. Morphological parameters such as body length, head length, body depth, head height, and head width were measured using vernier calipers, and the head-to-body ratio (head length / body length) was calculated. Detailed morphological data for each individual were recorded (specific data are shown in Table 1), and the distribution is shown in the figure below. Figures 1-6 As shown.
[0015] Table 1. Morphological measurements of silver carp , From Table 1 and Figures 1-6 It can be seen that the morphological data follow a normal distribution, indicating that the growth index measurements are accurate and consistent with the characteristics of quantitative traits.
[0016] 1.2 DNA Extraction Partial tail fins were cut from 281 silver carp and preserved in alcohol. DNA was extracted and purified using a genomic DNA extraction kit (TIANGEN, DP324). DNA concentration was detected using Nanodrop, and DNA integrity was assessed using 1% agarose gel electrophoresis.
[0017] 1.3 Paternity Testing DNA was extracted from 281 silver carp and preserved. Forty-two extremely large and forty-two extremely small individuals were selected for paternity testing. Polyacrylamide gel electrophoresis was performed using laboratory-designed primers Hysd293 (SEQ ID NO.17–SEQ ID NO.18) and Hysd792 (SEQ ID NO.19–SEQ ID NO.20). Partial results of the paternity testing are shown below. Figure 7 As shown: Among the 84 offspring, individuals numbered 281-256 are not ♀4F22×♂D18C offspring and are therefore excluded.
[0018] Hysd293-F (SEQ ID NO. 17): AACGAACTCATTTCCAGACCAG; Hysd293-R (SEQ ID NO. 18): GCCACATACATAAAGTACATCCC; Hysd792-F (SEQ ID NO. 19): ATAACTGAATCATTCCATCGCC; Hysd792-R (SEQ ID NO. 20): AGCCTAACCTGCCCTTTACTTG.
[0019] 1.4 Genome sequencing and analysis After excluding heterologous individuals, 30 extremely large and 30 extremely small individuals were selected for DNA pool sequencing. The pool numbered LB for the extremely large group and LS for the extremely small group. Sequencing was performed using the Illumina HiSeq platform. Libraries were constructed, and raw data were obtained after sequencing. After data quality control (removal of adapters and low-quality data), clean reads were obtained for subsequent analysis. The sequencing data from the two pools are shown in Table 2, and the alignment results with the genome are shown in Table 3. Chromosome coverage depth of the sequencing samples is shown in Table 4. Figures 8-9 .
[0020] Table 2. Statistical Evaluation of Sample Sequencing Data , Table 3. Comparison Results Statistics , From Table 2 and Table 3 and Figure 8 and Figure 9 It can be seen that a total of 69.90 Gbp of data was obtained, and the CleanBases obtained after filtering was 68.97 Gbp. The Q30 reached over 90%, and the average sequencing depth per sample was 43.07X. The average alignment efficiency between the samples and the reference genome was 98.54%, the average coverage depth was 39.00X, and the genome coverage was 96.55% (at least one base covered).
[0021] 1.5 Association Analysis of SNPs and InDel Before the association analysis, the SNPs were first filtered according to the following criteria: first, SNPs with multiple genotypes were filtered out; second, SNPs with read support less than 4 were filtered out; and third, SNPs with the same genotype across pools were filtered out. Finally, 1,964,541 high-quality, reliable SNPs were obtained.
[0022] The Euclidean Distance (ED) algorithm is a method that uses sequencing data to identify significantly different markers between pools and to assess regions associated with traits. A larger ED value indicates a greater difference in the marker between the two pools. In the analysis, SNP loci with genotypic differences between the two pools were used to determine the depth of each base in different pools, and the ED value for each locus was calculated. To eliminate background noise, the original ED values were exponentially multiplied. In this project, the square of the original ED was used as the association value to eliminate background noise. Then, the DISTANCE method was used to fit the ED values. The distribution of the association values is shown below. Figure 10 As shown: the median+3SD of the fitted values of all sites was taken as the association threshold for analysis, which was calculated to be 0.10. According to the association threshold, a total of 5 regions were obtained, with a total length of 21.10 Mb, containing a total of 5062 genes, of which 138 genes were non-synonymous mutation SNP sites, as detailed in Table 4.
[0023] Table 4. SNP-related area information statistics table
[0024] Before performing association analysis using InDel, the InDel values were first filtered using the same criteria as in SNP analysis, resulting in 703,055 high-quality, reliable InDel sites. The analysis employed the same analytical method (ED method) as used in SNP association analysis. The InDel association value distribution is shown below. Figure 11 As shown: the median+3SD of the fitted values of all sites was taken as the association threshold for analysis, which was calculated to be 0.12. Based on the association threshold, a total of 3 regions were obtained, with a total length of 17.84 Mb, containing 4205 genes, of which 61 genes were at the frameshift mutation InDel site. The intersection of the association results of SNP and InDel corresponding regions was taken, and the intersection is shown in Table 5.
[0025] Table 5. Statistics on the intersection information of SNP and InDel correlation regions
[0026] 1.6 Gene Annotation within Candidate Regions BLAST software was used to perform deep annotation of coding genes within candidate regions using multiple databases (NR, Swiss-Prot, GO, KEGG, COG). Detailed annotation enabled rapid screening of candidate genes. A total of 1820 genes were annotated within the candidate regions, including 120 genes with non-synonymous mutations in the pooled regions and 61 frameshift mutations. Gene annotation results from various databases are shown in Table 6.
[0027] Table 6. Statistical analysis of gene function annotation results in SNPs and InDels within candidate regions. , Genes were classified using GO analysis and according to cellular component, molecular function, and biological process. The statistical results of GO classification for genes in the candidate regions are shown below. Figure 12 In cellular components, the top three categories of genes are cells, cell parts, and organelles; in molecular functional classification, the three most common categories are binding, catalytic activity, and transporter activity; in biological processes, the three main categories include cellular processes, metabolic processes, and single-organism processes.
[0028] The KEGG annotation results of the corresponding genes in the candidate regions are classified according to pathway type, as shown in the classification diagram below. Figure 13 As shown: The first-level entries for gene annotation are Metabolism, Cellular Process, Environmental Information Processing, Organismal Systems, Genetic Information Processing, and Human Diseases; the second-level entries for gene annotation include Purine metabolism, MAPK signaling pathway, Calcium signaling pathway, Wnt signaling pathway, and mTOR signaling pathway, etc.
[0029] Based on combined genome and transcriptome sequencing results and literature reports, eight key metabolic pathways related to growth, body size and skeletal development of bighead carp were screened (including the regulation of the actin cytoskeleton, calcium signaling pathway, Wnt signaling pathway, MAPK signaling pathway, neuroactive ligand-receptor interaction, intestinal immune network of IgA production, cytokine-cytokine receptor interaction and purine metabolism) and five key genes (tyrosine 3-monooxygenase (Th), transcription activator Myb subtype 2 (myb), Wnt family member 5b (Wnt5b), cathepsin Bb (ctsbb), and Xα1 type collagen (col10a1a)).
[0030] 1.7 SNP site screening Based on previous laboratory work, it was inferred that the genes cathepsin Bb (ctsbb) and Xα1 type collagen (col10a1a) play a greater role in body size. To verify this inference, an association analysis of SNP sites and body size was performed on these two genes. The sequences of these two genes were amplified using primers and then subjected to Sanger sequencing. The primer sequences are shown in Table 7. Table 7 Primers for amplification of the two genes , Ten silver carp individuals (electronic tags: CB22, CB28(B), ABBC, CE67, BC39, BDCD, CCC2 / C532, B5E9, D71A, DDD6, in that order) were selected and PCR amplification was performed using the primers mentioned above. The amplified products were then sequenced by Sanger sequencing to identify SNP sites.
[0031] The results showed that the Xα1 type collagen (col10a1a) gene was relatively conserved in the bighead carp sequence, and no SNP sites were found; however, the cathepsin Bb (ctsbb) gene had a G / C polymorphism at intron 4, i.e., sequence 1907 (g.1907.G>C), which is a candidate SNP site.
[0032] The Sanger sequencing peak diagram for this SNP site is as follows: Figures 14-16 As shown: in, Figure 14 This is a partial sequencing peak diagram of the ctsbb gene sequence of the GC genotype bighead carp in this invention. At this site, both G and C base characteristic peaks appear simultaneously, and the heterozygous double peaks are clearly distinguishable, indicating that it is a GC heterozygous genotype. Figure 15 This is a partial sequencing peak diagram of the ctsbb gene sequence of the CC genotype bighead carp in this invention. This site shows only a single C base characteristic peak, and the peak shape is pure without any impurities, indicating that it is a CC homozygous genotype. Figure 16 This is a partial sequencing peak diagram of the ctsbb gene sequence of the GG genotype bighead carp in this invention. This site shows only a single G base characteristic peak, with a regular peak shape and no interfering peaks, and is determined to be a GG homozygous genotype.
[0033] Association analysis (chi-square test) was performed between this SNP locus (g.1907.G>C) and the body weight trait of 281 experimental individuals. The results showed that this SNP locus was significantly associated with the body weight of bighead carp (P<0.05), and the body weight of bighead carp with genotype CC was significantly higher than that of individuals with genotype GC. Therefore, this SNP locus was identified as a molecular marker for genetic improvement of body size in bighead carp.
[0034] 1.8 SNP site verification Both extremely large and extremely small individuals with n tails were randomly selected. The base type at position 1907 of intron 4 of the cathepsin Bb (ctsbb) gene was then examined. Statistical analysis was performed to correlate the base type with the trait, and a significant correlation was found. Furthermore, the base type was consistent with the morphology, proving that the selected SNP sites were usable.
[0035] Example 2: Application of molecular markers in the genetic improvement of body size in bighead carp The SNP molecular marker (g.1907.G>C) obtained in Example 1 was used for the selection and breeding of superior silver carp varieties. The specific method is as follows: 1) Sample collection: Select individuals of silver carp to be bred (including fry, juveniles or adults), collect a small number of tissue samples (such as fin rays), and extract genomic DNA; 2) SNP site detection: The primer pair (SEQ ID NO.9~SEQ ID NO.10) in Example 1 was used to amplify the extracted genomic DNA by PCR. The amplification products were sequenced by Sanger sequencing to detect the genotype of the g.1907.G>C site in the ctsbb gene. 3) Individual selection: Select bighead carp individuals with genotype CC as breeding parents or selection subjects, and eliminate individuals with genotype GC; 4) Targeted breeding: Selected superior individuals are raised separately, and feeding management is strengthened to cultivate superior bighead carp varieties with larger body weight and higher head proportion.
[0036] The above methods can quickly screen out high-quality silver carp individuals, improve breeding efficiency, shorten the breeding cycle, cultivate silver carp varieties that meet market demands, and significantly improve the economic benefits of aquaculture.
[0037] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A molecular marker for identifying the body shape of Aristichthys nobilis, characterized in that: The molecular marker is a SNP site on the Cathepsin Bb gene, which is located on intron 4 of the Cathepsin Bb gene, and the nucleotide sequence has a G / C polymorphism at position 1907, named g.1907.G>C; the genotype of the SNP site is significantly related to the body weight of the bighead carp, and the body weight of the bighead carp with the genotype CC is significantly higher than that of the bighead carp with the genotype GC.
2. A primer pair for amplifying a product comprising the molecular marker of claim 1, characterized in that: The nucleotide sequences of the primer pair are shown in SEQ ID NO. 9-10.
3. A kit for identifying the size of a bighead carp, characterized by: The kit comprises the primer pair of claim 2.
4. A method for identifying the size of a bighead carp, characterized by, The specific process is as follows: The genomic DNA of the bighead carp to be tested is used as a template, the primer pair of claim 2 is used for PCR amplification, and then Sanger sequencing is performed to determine the genotype of the SNP site, and the body weight of the bighead carp with the genotype CC is significantly higher than that of the bighead carp with the genotype GC.
5. The application of the molecular marker of claim 1 in assisting the breeding of bighead carp.
6. The application of the molecular marker of claim 1 in the genetic improvement of the body shape of bighead carp.