A SNP molecular marker related to arrow leek pea fiber content and application thereof

Abstract

This invention discloses a SNP molecular marker associated with fiber content in *Vaccaria buergeriana* and its application. The SNP molecular marker is located at 203,487,839 bp on chromosome 5 of the *Vaccaria buergeriana* genome, where an A / T base polymorphism exists. This marker can be used for marker-assisted selection of fiber content traits in *Vaccaria buergeriana*. By detecting the genotype at this locus, the fiber content of *Vaccaria buergeriana* plants can be predicted earlier without relying on post-harvest chemical determination, thereby significantly shortening the breeding cycle, reducing breeding costs, and improving selection efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetic breeding technology, specifically relating to an SNP molecular marker related to the fiber content of arrowhead pea and its application. Background Technology

[0002] Arrowhead pea (Vicia sativa L.) is a resilient and fast-growing legume that serves multiple functions, including forage, green manure, and ecological restoration, and is widely cultivated in many parts of my country. Fiber content is a core indicator of the balance between forage quality and plant resilience. Neutral detergent fiber (NDF) is a key indicator for measuring the total fiber content of forage, comprising cellulose, hemicellulose, and lignin; its content directly reflects the fiber level. Forage with excessively high fiber content is coarse and reduces feed intake; appropriate fiber content promotes intestinal motility in livestock and poultry, improving digestibility and palatability.

[0003] With the large-scale development of animal husbandry, breeding arrowhead pea varieties with suitable fiber content has become an industry demand. However, current breeding faces technical bottlenecks: fiber content is a typical quantitative trait controlled by multiple genes, with significant differences in fiber content among different germplasms, and genotype effects are dominant; traditional phenotypic identification has a long cycle (3-5 years), is easily affected by the environment, and is difficult to screen accurately; research on the molecular mechanisms related to arrowhead pea is lacking, and there is a lack of precise loci that can be used for marker-assisted breeding.

[0004] SNP markers are dense, stable, and can be detected with high throughput, making them widely used in quality breeding of leguminous crops. However, their application in the selection of fiber content traits in arrowhead peas is currently lacking. Therefore, identifying SNP sites significantly associated with fiber content and establishing molecular detection methods is of great significance for shortening the breeding cycle, accelerating the development of varieties with suitable fiber content, filling technological gaps, and ensuring feed supply security. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker closely related to the fiber content of arrowhead pea and its application, so as to achieve efficient and rapid screening of arrowhead pea germplasm with low fiber content.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] In a first aspect, the present invention claims protection for an SNP molecular marker related to the fiber content of arrowhead pea (Vicia sativa L.), the SNP molecular marker comprising the nucleotide sequence shown in SEQ ID NO:1, wherein the SNP site at 803 bp in the nucleotide sequence has an A / T polymorphism.

[0008] Furthermore, the SNP site corresponds to the 203,487,839 bp base on chromosome 5 of the *Vaccinium bracteatum* genome, and the Genbank accession number for chromosome 5 of the *Vaccinium bracteatum* genome is CM038796.1.

[0009] Furthermore, if the SNP locus genotype is AA, then the tested arrowhead pea is a high-fiber material; if the SNP locus genotype is TT, then the tested arrowhead pea is a low-fiber material.

[0010] Secondly, the present invention claims protection for primer pairs for detecting the above-mentioned SNP molecular markers, said primer pairs being composed of the upstream primer shown in SEQ ID NO:2 and the downstream primer pair shown in SEQ ID NO:3.

[0011] Furthermore, the primer pairs were used to perform PCR amplification of the genomic DNA of the *Vaccinium bracteatum* to be tested, and the amplification products were sequenced. If the genotype of the SNP site was AA, the *Vaccinium bracteatum* to be tested was a high-fiber material; if the genotype of the SNP site was TT, the *Vaccinium bracteatum* to be tested was a low-fiber material.

[0012] Thirdly, the present invention claims protection for a kit for detecting the fiber content of arrowhead peas, comprising the aforementioned primer pair.

[0013] Fourthly, this invention claims protection for a method for identifying or assisting in the identification of fiber content in arrowhead peas, comprising the following steps:

[0014] (1) Extract genomic DNA from the arrowhead peas to be tested;

[0015] (2) Detect the genotype of the above SNP sites;

[0016] (3) Determine the fiber content of arrow peas based on the genotype of the SNP locus: if the genotype of the SNP locus is AA, the arrow pea to be tested is a high fiber content material; if the genotype of the SNP locus is TT, the arrow pea to be tested is a low fiber content material.

[0017] Furthermore, the method for detecting the SNP site genotype in step (2) is as follows: PCR amplification of the genomic DNA of the target arrowhead pea is performed, and the amplification product is sequenced using the Sanger sequencing method.

[0018] Fifthly, the present invention claims protection for a method for breeding arrow peas with low fiber content, comprising: detecting the genotype of the aforementioned SNP locus during the breeding process, and selecting arrow pea individuals with the SNP locus genotype TT as low fiber content materials for subsequent breeding.

[0019] Sixthly, the present invention claims protection for the use of the aforementioned SNP molecular marker, the aforementioned primer pair, or the aforementioned kit in any of the following:

[0020] (a) To identify or assist in the identification of the fiber content of arrowhead peas;

[0021] (b) Screening or assisted screening of arrowhead pea germplasm resources with low fiber content;

[0022] (c) Prepare a product for detecting the fiber content of arrowhead peas;

[0023] (d) Marker-assisted breeding of low-fiber arrow pea.

[0024] In the technical solution of this invention, the arrowhead pea includes cultivated arrowhead pea and its closely related germplasm.

[0025] In a specific embodiment of the present invention, the PCR amplification reaction system is as follows: the amplification system consists of 5 μL of 2×PCRMasterMix, 1 μL of 100 ng / μL genomic DNA, 1 μL each of 10 μM upstream and downstream primers, and water is used to make up the volume to 10 μL.

[0026] In a specific embodiment of the present invention, the PCR amplification program is as follows: 98℃ for 30s; 98℃ for 10s, 57℃ for 30s, 72℃ for 60s, for a total of 35 cycles; 72℃ for 2min.

[0027] This invention utilizes whole-genome sequencing of *Vicia sativa* (arrow-footed pea). Based on the sequencing results, genome-wide association analysis (GWAS) and phenotypic analysis were employed to select SNP markers associated with neutral detergent fiber (NDF) content in *Vicia sativa* from SNPs with allele frequencies >5%. The resulting SNP was located at 203,487,839 bp on chromosome 5 of the *Vicia sativa* genome (this site exhibits A / T polymorphism). The results showed that when this site contained an A base, the NDF content in *Vicia sativa* hay was 28.84%; when it contained a T base, the NDF content was 23.86%, with a highly significant difference (P < 0.01).

[0028] The beneficial effects of this invention are:

[0029] This invention investigates and statistically analyzes the phenotypic content of neutral detergent fiber in 93 *Vaccaria buergeriana* (arrow-spotted pea) resource populations. Combined with GWAS analysis of resequencing genotype data, major loci of low fiber content were identified, and molecular markers associated with *Vaccaria buergeriana* fiber content were developed. These markers can rapidly screen *Vaccaria buergeriana* materials with low fiber content, shorten the breeding cycle, improve selection efficiency, and reduce detection costs, providing key technical support for the quality improvement of *Vaccaria buergeriana*. Attached Figure Description

[0030] Figure 1 A distribution map of neutral detergent fiber content in 93 *Vaccinium bracteatum* germplasm resource populations.

[0031] Figure 2 GWAS results for neutral detergent fiber content in 93 *Vaccinium bracteatum* germplasm populations. A is the Manhattan plot, and B is the QQ plot.

[0032] Figure 3 This is a sequencing peak diagram of the molecular marker PCR amplification results; where A is the AA genotype sample and B is the TT genotype sample.

[0033] Figure 4 A comparison chart of neutral detergent fiber content in samples with two different genotypes (AA and TT). Detailed Implementation

[0034] This invention provides a SNP molecular marker related to the fiber content of *Vicia sativa*, wherein the SNP molecular marker comprises an SNP site located at 203,487,839 bp on chromosome 5 of the *Vicia sativa* genome, exhibiting A / T polymorphism. In this invention, when the SNP site is an A base, the neutral detergent fiber content of *Vicia sativa* hay is 28.84%, classifying it as a high-fiber material; when the SNP site is a T base, the neutral detergent fiber content of the hay is 23.86%, classifying it as a low-fiber material.

[0035] The SNP molecular marker developed in this invention is correlated with the fiber content of arrowhead peas, and the SNP molecular marker contains the nucleotide sequence shown in SEQ ID NO:1. The method for determining the neutral detergent fiber content described in this invention is preferably the polyester mesh bag method (DB37T3372-2018).

[0036] This invention also provides a primer pair for amplifying the SNP molecular marker described in the above-mentioned technical solution. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, specifically: 5'-GAAGGAAGGTAGTGTAGTATGGG-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3, specifically: 5'-CGAACAAATAGACAGGGTGA-3'. The target fragment amplified using this primer pair is 987 bp in size, and its nucleotide sequence is shown in SEQ ID NO:1, containing the target SNP site.

[0037] The present invention also provides the application of the SNP molecular markers or primer pairs described in the above technical solutions in screening low-fiber arrow pea germplasm and assisting in the creation of low-fiber arrow peas.

[0038] In this invention, the arrowhead pea preferably includes cultivated arrowhead pea and its closely related germplasm.

[0039] This invention also provides a method for screening arrowhead pea germplasm with low fiber content, comprising the following steps:

[0040] Using the primer pairs described in the above technical solution, PCR amplification of the genomic DNA of *Vaccaria spp.* is performed. If the sequencing verification target site of the PCR amplification product is A, then the *Vaccaria spp.* plant is a high-fiber material; if the sequencing verification target site of the PCR product is T, then the *Vaccaria spp.* plant is a low-fiber material.

[0041] In this invention, the preferred PCR amplification reaction system is: 5 μL of 2×PCR MasterMix, 1 μL of 100 ng / μL genomic DNA, 1 μL each of 10 μM forward and reverse primers, and water to bring the volume to 10 μL; the preferred PCR amplification program is: 98℃ for 30s; 98℃ for 10s, 57℃ for 30s, 72℃ for 60s, for a total of 35 cycles; 72℃ for 2min.

[0042] This invention utilizes the aforementioned primer pairs to perform PCR amplification on different *Vaccinium bracteatum* genotypes, preferably detecting the target PCR products by agarose gel electrophoresis and identifying the target PCR products using Sanger sequencing. This invention does not have specific limitations on the method of obtaining the *Vaccinium bracteatum* genomic DNA to be tested; conventional extraction methods in the industry are acceptable. In this embodiment, the CTAB method is preferably used to extract *Vaccinium bracteatum* leaf DNA. The specific steps are as follows: Take 0.1 g of fresh leaves, grind them into powder using liquid nitrogen, add 500 μL of CTAB extraction solution preheated to 65℃, and incubate in a water bath for 30 min; add 500 μL of chloroform-isoamyl alcohol (24:1), vortex to mix, centrifuge and collect the supernatant; add an equal volume of isopropanol to precipitate the DNA, wash with 75% ethanol, dissolve in ddH2O, and detect the DNA concentration using an Eppendorf BioSpectrometer basic analyzer.

[0043] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides an SNP molecular marker related to the fiber content of arrowhead peas and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0045] Example 1: Detection of neutral detergent fiber content in a population of arrowhead pea germplasm resources

[0046] Ninety-three accessions of *Vaccaria spp.* were used as samples, and all germplasm was planted at the Baima Experimental Base of Nanjing Agricultural University under routine field management. Hay samples were collected at the initial flowering stage, and the neutral detergent fiber content was determined using the polyester mesh bag method (DB37T3372-2018). Each sample was replicated three times, and the average value was taken as the phenotypic value.

[0047] The distribution of neutral detergent fiber content in 93 *Vaccinium bracteatum* germplasm resource populations is shown in the figure below. Figure 1 As shown.

[0048] Data analysis results show that the neutral detergent fiber content of arrowhead peas is continuously distributed. The median neutral detergent fiber content of hay in the population is 24.55%, the average is 25.77%, and the variation range is wide (14.68%-39.1%), which is consistent with the genetic characteristics of quantitative traits.

[0049] Example 2: Extraction and GWAS analysis of leaf DNA from a *Vaccinium bracteatum* resource population

[0050] Total DNA was extracted from the leaves of 93 *Vaccaria spp.* in Example 1 using the CTAB method. After extraction, the resource population was resequencing to obtain genotype data.

[0051] SNP variation analysis was performed on the genotype data using the GATK software toolkit. After obtaining the SNP variation data, a generalized linear model (LM) was used in GEMMA software to perform GWAS analysis on the genotype data and the neutral detergent fiber content phenotypic data. The analysis results are as follows: Figure 2 As shown in the figure. The results showed that the SNP marker (Chr5-203487839) located on chromosome 5 was significantly associated with the neutral detergent fiber content of *Vigna arvense* hay (-log). 10 (p) > 5), indicating an A / T base difference at this site.

[0052] Example 3: Development of specific molecular markers associated with fiber content trait in arrowhead pea.

[0053] For the variant site Chr5-203487839 obtained in Example 2, upstream primer F and downstream primer R were designed using Primer 3.0 software in conjunction with the *Pistacia chinensis* genome sequence. The nucleotide sequence of upstream primer F is shown in SEQ ID NO:2, specifically: 5'-GAAGGAAGGTAGTGTAGTATGGG-3'; the nucleotide sequence of downstream primer R is shown in SEQ ID NO:3, specifically: 5'-CGAACAAATAGACAGGGTGA-3'. The target fragment amplified using this primer pair was 987 bp in size, and its nucleotide sequence is shown in SEQ ID NO:1, containing the target SNP site.

[0054] Example 4: Application of molecular markers in low-fiber breeding of arrowhead pea.

[0055] Materials with different neutral detergent fiber contents were randomly selected from the *Vicia sativa* germplasm of Example 1, and genomic DNA was extracted from the leaves. Using the genomic DNA as a template, PCR amplification was performed using the specific molecular marker primer pair (upstream primer F and downstream primer R) designed in Example 3. The PCR reaction system (10 μL system) consisted of: 1 μL DNA template (concentration 100 ng / μL), 1 μL each of upstream and downstream primers (concentration 10 μM), 5 μL 2×PCR MasterMix, and 2 μL ddH2O. The PCR amplification program was as follows: 98℃ for 30 s; 98℃ for 10 s, 57℃ for 30 s, 72℃ for 60 s, for a total of 35 cycles; 72℃ for 2 min. The PCR products were detected by 1% agarose gel electrophoresis, and the successfully amplified products were verified by Sanger sequencing.

[0056] Test results as follows Figure 3 As shown in the figure. Sequencing revealed that materials with the target site being A base had an average neutral detergent fiber content of 28.84%; materials with the target site being T base had an average neutral detergent fiber content of 23.86%, with a highly significant difference between the two (P<0.01), indicating that this molecular marker has excellent screening effect. Figure 4 ).

[0057] In summary, by utilizing the SNP molecular markers described in this invention that are closely associated with the neutral detergent fiber content of arrowhead peas, germplasm with low fiber content can be rapidly screened, fiber content levels can be predicted, the efficiency of arrowhead pea quality breeding can be significantly improved, and reliable technical support can be provided for the breeding of low-fiber arrowhead pea varieties.

[0058] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

[0059] sequence list

[0060] SEQ ID NO:1

[0061] (A / T)ATGCATTTGCATAGTCGAGTCTCATTCGAATTGCATTATGAAGCTATTGTTGGCTATTTCGTTGTTTGTTGAATGTTGTGTTGTAGTTGTTGAAGTAGTGATTATCGTATGATTCTTTATCTAATATATTAGTTGTCATACTTTTGCTTATATTTTTTGATATCTCACCCTGTCTATTTGTTCG。

Claims

1. A SNP molecular marker associated with the fiber content of arrowhead pea, characterized in that, The SNP molecular marker comprises a nucleotide sequence as shown in SEQ ID NO:1, wherein the SNP site at 803 bp in the nucleotide sequence exhibits A / T polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP site corresponds to the 203,487,839 bp base on chromosome 5 of the arrowhead pea genome, and the Genbank accession number for chromosome 5 of the arrowhead pea genome is CM038796.

1.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, If the genotype of the SNP locus is AA, then the arrowhead pea to be tested is a high-fiber material; if the genotype of the SNP locus is TT, then the arrowhead pea to be tested is a low-fiber material.

4. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair consists of the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:

3.

5. The primer pair according to claim 4, characterized in that, The primer pairs were used to amplify the genomic DNA of the target arrowhead pea by PCR, and the amplification products were sequenced. If the genotype of the SNP site was AA, the target arrowhead pea was a high-fiber material; if the genotype of the SNP site was TT, the target arrowhead pea was a low-fiber material.

6. A reagent kit for detecting the fiber content of arrowhead peas, characterized in that, It contains the primer pair as described in claim 4 or 5.

7. A method for identifying or assisting in the identification of fiber content in arrowhead peas, characterized in that, Includes the following steps: (1) Extract genomic DNA from the arrowhead peas to be tested; (2) Detect the genotype of the SNP site in claim 1; (3) Determine the fiber content of arrow peas based on the genotype of the SNP locus: if the genotype of the SNP locus is AA, the arrow pea to be tested is a high fiber content material; if the genotype of the SNP locus is TT, the arrow pea to be tested is a low fiber content material.

8. The method according to claim 7, characterized in that, The method for detecting the SNP site genotype in step (2) is as follows: PCR amplification of the genomic DNA of the target arrowhead pea is performed, and the amplification product is sequenced using the Sanger sequencing method.

9. A method for breeding arrowhead peas with low fiber content, characterized in that, include: During the breeding process, the genotype of the SNP locus described in claim 1 is detected, and individuals of the arrow pea with the SNP locus genotype TT are selected as low-fiber materials for subsequent breeding.

10. The use of any of the SNP molecular markers of claims 1-3, any of the primer pairs of claims 4-5, or the kit of claim 6 in any of the following: (a) To identify or assist in the identification of the fiber content of arrowhead peas; (b) Screening or assisted screening of arrowhead pea germplasm resources with low fiber content; (c) Prepare a product for detecting the fiber content of arrowhead peas; (d) Marker-assisted breeding of low-fiber arrow pea.

Images