A method for identifying mutations in the piorp1 gene of phytophthora infestans and their effect on resistance to fluazuron
By detecting PiORP1 gene mutations in pathogenic Phytophthora infestans using PCR amplification and enzyme digestion, the problem of rapidly identifying resistance to fluthiazopyrone was solved, enabling early warning and scientific drug use guidance, delaying the development of resistance, and extending the lifespan of the drug.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-25
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of fluthiazopyrone resistance caused by mutations in the PiORP1 gene of Phytophthora infestans, leading to a decline in the effectiveness of chemical control measures and making it difficult to effectively delay the development of resistance.
The mutation at nucleotide 2344 of the PiORP1 gene was identified by analyzing the size of the DNA fragments in the digested product using PCR amplification combined with restriction endonuclease SmlI digestion. The mutation was then detected by primer pairs SEQ ID NO:1 and SEQ ID NO:2 to identify T homozygous, A/T heterozygous, or wild-type mutations, thereby determining the resistance of pathogenic Phytophthora to OSBP inhibitor fungicides.
This technology enables rapid, accurate, and high-throughput detection of the occurrence and development of resistance genes to fluthiazopyrone in pathogenic Phytophthora, providing early warning, guiding scientific drug use to delay the development of resistance, and extending the lifespan of the drug.
Smart Images

Figure CN122279091A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology and relates to a method for identifying pathogenic Phytophthora PiORP1 gene mutations and their application in the detection of fluthiazopyrone resistance. Specifically, it discloses a method for rapidly identifying pathogenic Phytophthora PiORP1 gene mutations and their resistance to fluthiazopyrone. Background Technology
[0002] Phytophthora infestans is a devastating oomycete that primarily infects Solanaceae crops such as potatoes and tomatoes, causing late blight. While its host range is relatively specific, its pathogenicity is high. Phytophthora infestans mainly spreads through the production of numerous spores. These zoospores are dispersed in the field by wind, rain, and irrigation water, and can also be spread over long distances through infected seed potatoes and seedlings, resulting in rapid spread and extreme difficulty in control.
[0003] Chemical control is a key measure in combating late blight caused by Phytophthora blight, especially effective in rapidly suppressing outbreaks during epidemic periods. However, this pathogen readily develops resistance through frequent mutations. Historically, resistance to highly effective agents like metalaxyl has emerged and spread rapidly, leading to a significant decline in the efficacy of many traditional fungicides and posing a persistent control challenge. To address this challenge, global agrochemical companies are actively developing next-generation fungicides with novel mechanisms of action. These new agents aim to overcome existing resistance and, through scientific rotation and blending with agents possessing different mechanisms of action, integrate into integrated resistance management strategies, ultimately providing more sustainable crop health protection.
[0004] Fluoxazolylpyrone is the first piperidinylthiazolium isoxazoline fungicide with a novel mechanism of action, exerting its fungicidal effect by inhibiting the oxidized sterol-binding protein (OSBP) of pathogens. It exhibits excellent preventative, curative, and sporulation-inhibiting effects against diseases caused by various oomycete pathogens, including *Phytophthora infestans* (causing potato late blight), *Phytophthora infestans* (causing cucumber downy mildew), and *Phytophthora tumefaciens* (causing tobacco black shank). As a novel OSBP inhibitor, fluoxazolylpyrone is effective at extremely low dosages and possesses excellent systemic conductivity and rain washout resistance, providing long-lasting protection for crops. These characteristics make it a key agent for controlling oomycete diseases. However, its single site of action poses a high risk of resistance. Although not currently experiencing large-scale outbreaks, local monitoring has revealed that mutations in its target gene ORP1 can lead to moderate to high levels of resistance. Therefore, it is essential to continuously monitor the development of drug resistance, conduct early warning through technologies such as molecular detection, and strictly implement strategies for rotating and mixing with drugs with different mechanisms of action in order to delay the development of resistance and extend the lifespan of this important drug.
[0005] Molecular detection methods play a crucial role in monitoring pathogen resistance, with their core advantage being the ability to provide early, accurate, and efficient early warning. Compared to traditional methods relying on pathogen isolation, culture, and biological phenotypic determination, molecular detection technologies (such as PCR, AS-PCR, CAPS-PCR, dCAPS-PCR, qPCR, LAMP, or gene sequencing-based methods) can directly and rapidly detect specific gene mutations associated with resistance from field samples. For example, in monitoring fluoxetine resistance, it is possible to directly target and detect mutations at key sites in the ORP1 gene of Phytophthora infestans. ORP1 is an oxidosterol-binding-protein related protein (ORP). This technology can detect resistance before it reaches a significant scale in the field and before it causes a significant decline in field control efficacy, thus achieving true early warning. This not only significantly shortens the testing cycle but also substantially improves the throughput and accuracy of monitoring, providing direct scientific basis for developing forward-looking resistance management strategies. It guides farmers and regulatory authorities to scientifically rotate pesticides, thereby effectively delaying the development of resistance and extending the lifespan of valuable pesticides. Summary of the Invention
[0006] The purpose of this invention is to provide a method for identifying mutations in the PiORP1 gene of pathogenic Phytophthora and its resistance to fluthiazopyrone.
[0007] The objective of this invention can be achieved through the following technical solutions:
[0008] In a first aspect, the present invention claims protection for a method for detecting a nucleotide mutation at position 2344 of the pathogenic fungus PiORP1 gene, the method comprising the following steps:
[0009] (a) Using the genomic DNA of the pathogenic fungus to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2 to obtain the amplification product;
[0010] (b) The amplification product obtained in step (a) was digested with the restriction endonuclease SmlI;
[0011] (c) Analysis of enzyme digestion products:
[0012] If the enzyme digestion product shows two DNA fragments of 59 bp and 150 bp, it indicates that the nucleotide at position 2344 of the PiORP1 gene of the pathogenic fungus being tested is a T homozygous mutation.
[0013] If the enzyme digestion product shows three DNA fragments of 59 bp, 150 bp and 209 bp, it indicates that the nucleotide at position 2344 of the PiORP1 gene of the pathogenic fungus being tested is an A / T heterozygous mutation.
[0014] If the enzyme digestion product contains only a 209 bp DNA fragment, it indicates that the 2344th nucleotide of the PiORP1 gene of the pathogenic fungus being tested is wild-type.
[0015] The mutation at nucleotide 2344 causes the amino acid at position 757 of the PiORP1 protein to change from asparagine to leucine, isoleucine, or phenylalanine.
[0016] Furthermore, the annealing temperature for PCR amplification in step (a) of the above method is 60°C.
[0017] Secondly, the present invention seeks protection for the application of the above-described method in identifying the resistance of pathogenic Phytophthora to OSBP inhibitor fungicides.
[0018] Thirdly, the present invention claims protection for a method for identifying the resistance of pathogenic Phytophthora to OSBP inhibitor fungicides. The method is used to detect the nucleotide mutation at position 2344 of the PiORP1 gene of Phytophthora. If it is an A / T heterozygous or T homozygous mutation, it indicates that the pathogenic Phytophthora has or is a candidate to have resistance to OSBP inhibitor fungicides.
[0019] Fourthly, the present invention claims protection for a primer pair for detecting a nucleotide mutation at position 2344 of the pathogenic fungus PiORP1 gene, the primer pair being composed of DNA molecules shown in SEQ ID NO:1 and SEQ ID NO:2.
[0020] Fifthly, the present invention claims protection for a kit for identifying resistance of pathogenic Phytophthora indicum to OSBP inhibitor fungicides, the kit comprising the aforementioned primer pair and restriction endonuclease SmlI; the primer pair being used to amplify a fragment containing nucleotide 2344 of the pathogenic Phytophthora PiORP1 gene, and the SmlI being used to recognize an enzyme cleavage site created or destroyed by an A→T mutation at that site.
[0021] Sixthly, the present invention claims protection for at least one application of the above-described method in monitoring drug-resistant populations of Phytophthora infectivity, early warning of resistance evolution, and guidance on field application of fungicides, to measure and monitor the occurrence and development trend of resistance of Phytophthora infectivity to OSBP inhibitor fungicides, thereby guiding scientific application of fungicides in the field.
[0022] In a seventh aspect, the present invention seeks protection for a pathogenic fungus PiORP1 gene, the nucleotide sequence of which is shown in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.
[0023] Eighthly, the present invention claims protection for a pathogenic Phytophthora PiORP1 protein, the amino acid sequence of which is shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
[0024] Ninthly, the present invention claims protection for the use of the above-described gene or protein in the preparation of a kit for identifying resistance to pathogenic Phytophthora.
[0025] In this invention, the drug resistance refers to resistance to OSBP inhibitor fungicides. The OSBP inhibitor fungicide is fluthiazopyrone.
[0026] This invention, through sequence comparison of susceptible and resistant strains, discovered that four adjacent nucleotide positions (positions 2339, 2342, 2343, and 2344) in three resistant strains exhibited different combinations of mutations or single nucleotide polymorphisms. The different mutation sites of the PiORP1 gene found in the three pathogenic Phytophthora resistant strains are shown below:
[0027] (1) Resistant strain CQ-22-6: The nucleotide at position 2339 from the 5' end is homozygous C, the nucleotide at position 2342 is homozygous A, the nucleotide at position 2343 is heterozygous A / C, and the nucleotide at position 2344 is heterozygous A / T; the protein PiORP1 has a heterozygous asparagine and leucine at position 757 from the amino terminus.
[0028] (2) Resistant strain YN-22-12: The nucleotide at position 2339 from the 5' end is C / T homozygous, the nucleotide at position 2342 is A / G homozygous, the nucleotide at position 2343 is A homozygous, and the nucleotide at position 2344 is A / T heterozygous; the protein PiORP1 has an amino acid at position 757 from the amino terminus that is a heterozygous combination of asparagine and isoleucine.
[0029] (3) Resistant strain HUB-23-3: The nucleotide at position 2339 from the 5' end is homozygous C, the nucleotide at position 2342 is homozygous A, the nucleotide at position 2343 is heterozygous A / T, and the nucleotide at position 2344 is heterozygous A / T; the protein PiORP1 has a heterozygous asparagine and phenylalanine amino acid at position 757 from the amino terminus.
[0030] The beneficial effects of this invention are:
[0031] The molecular detection method provided by this invention has broad coverage, good detection stability, and short detection cycle. It can be used for high-throughput detection of the occurrence and development of resistance genes of pathogenic Phytophthora in the field to fluthiazopyrone, enabling early warning of resistant strains, guiding scientific drug use, and delaying the occurrence of drug resistance. Attached Figure Description
[0032] Figure 1 The sequence comparisons were performed between the susceptible strain and three different resistant strains; among them, CQ-22-6, YN-22-12, and HUB-23-3 were resistant strains.
[0033] Figure 2 The EC50 results of fluthiazopyridine were obtained from transformants with four different mutation types.
[0034] Figure 3 The diagram shows the effect of the dCAPS method in detecting bacterial resistance; where A is a schematic diagram of the difference in enzyme digestion sites between sensitive and resistant strains; B is an electrophoresis diagram of PCR products using the genomes of three sensitive strains and three resistant strains as templates before and after enzyme digestion. Detailed Implementation
[0035] To make the objectives and advantages of this invention clearer, the invention will now be described in detail with reference to the following embodiments. The following embodiments are only used to more clearly illustrate the technical solutions and content of this invention, and should not be construed as limiting the scope of protection of this invention. Any modifications, equivalent substitutions, and improvements made within the principles of this invention should be included within the scope of protection of this invention.
[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0037] Unless otherwise specified, all reagents, consumables and other experimental materials used in the following examples can be obtained from conventional commercial sources.
[0038] In the following examples, "resistant strains" refers to pathogenic *Phytophthora* strains resistant to the fungicide fluthiazopyrone; "sensitive strains" refers to pathogenic *Phytophthora* strains sensitive to the fungicide fluthiazopyrone.
[0039] Example 1: Sensitivity determination of pathogenic Phytophthora in fluthiazopyrone
[0040] 1. Three susceptible strains, strain numbers: CQ-22-11, YN-22-10, and HUB-23-10; three resistant strains, strain numbers: CQ-22-6, YN-22-12, and HUB-23-3.
[0041] 2. Rye medium (RSA): Weigh 60 g of rye, soak it in 1 L of water for 2 h, then autoclave at 121 ℃ for 20 min. Continue to crush the rye grains using a juicer, then filter through 4 layers of gauze. Collect the filtrate to remove solid precipitate, and then add water to the supernatant to 1 L. Add 4 g of sucrose and 2.7 g of agar powder to each 200 mL Erlenmeyer flask, dispense, and autoclave again at 121 ℃.
[0042] 3. Experimental steps:
[0043] 1) Prepare a stock solution of fluthiazopyrone (dissolved in DMSO) and store it for a long time in a -20°C refrigerator.
[0044] 2) The sensitivity of pathogenic *Phytophthora* strains to the tested agents was determined using the mycelial growth rate method. Mycelial cakes were created from the edge of *Phytophthora* colonies cultured for 5-7 days using a 5 mm diameter punch, with the mycelial side facing down, and placed in the center of the petri dish. These were inoculated onto rye V8 plates with different concentration gradients and incubated in the dark at 18°C for 5-7 days. Colony diameter was measured using the cross-hatching method to standardize the process. Each treatment was repeated three times. The growth inhibition rate of different agent concentration gradients on the tested wild-type *Phytophthora* was calculated. The virulence regression equation for the tested strains was obtained using Microsoft Excel, and the effective inhibitory concentration (EC50) for different strains was calculated. 50 The resistance fold was calculated. A series of RSA media containing different concentrations of fluoxetine were prepared for the assay. For sensitive strains, the concentration gradients were 0, 0.00025, 0.0005, 0.001, and 0.002 μg / mL; for moderately resistant strains, the concentration gradients were 0, 0.01, 0.02, 0.04, and 0.08 μg / mL; and for highly resistant strains, the concentration gradients were 0, 0.5, 1, 2.5, and 5 μg / mL.
[0045] Inhibition rate = (Control colony diameter - Treated colony diameter) / (Control colony growth diameter - Original mycelium cake length 5 mm)
[0046] Resistance ratio = strain EC 50 / Average EC of susceptible strains 50
[0047] 2. Results
[0048] Table 1. EC50 of six pathogenic *Phytophthora* strains to fluoxetine. 50 and resistance multiple
[0049]
[0050] The test results showed that the resistance multiples of the three resistant strains were 60-1266 times that of the sensitive strains.
[0051] Example 2: Discovery of mutation sites in the PiORP1 gene and protein of pathogenic Phytophthora infestans
[0052] 1. Three susceptible strains, strain numbers: CQ-22-11, YN-22-10, and HUB-23-10; three resistant strains, strain numbers: CQ22-6, YN-22-12, and HUB-23-3.
[0053] 2. Green pea culture medium (PEA): Take 120 g of peas and add no more than 1 L of deionized water. First, autoclave at 121℃ for 20 min, then filter through gauze to obtain the supernatant. Add water to make up to 1 L, dispense, and autoclave at 121℃ for 20 min for later use.
[0054] 3. Experimental steps:
[0055] 1) Preparation of mycelial samples
[0056] The pathogenic Phytophthora was cultured in the dark at 18°C for 5-6 days using RSA culture. Mycelial blocks of 5 mm x 5 mm were cut with a sterile scalpel and placed in green bean liquid culture medium. The mycelium was then cultured in the dark at 18°C for 5-6 days. The mycelium was collected and the water was squeezed out for later use.
[0057] 2) DNA extraction from strain mycelial samples
[0058] Take 20 mg of fresh mycelial sample, add liquid nitrogen and grind into a fine powder. Then, use the Tiangen Novel Plant Genomic DNA Extraction Kit (Cat: DP320) to extract DNA according to the operating procedures described in the product instructions.
[0059] 3) Amplification of the PiORP1 gene of Phytophthora infestans
[0060] The full-length PiORP1 gene of pathogenic Phytophthora infestans was amplified using primers PiORP1-F (5'-ATGCAAGCGCTTCAGGACGCGC-3') and PiORP1-R (5'-TCAATGTCCTCCAGCCGCACTG-3').
[0061] The PCR reaction system is as follows:
[0062] 50 μL PCR reaction system:
[0063] 2x Taq Master Mix 25 μL
[0064] PiORP1-F2 μL
[0065] PiORP1-R2 μL
[0066] DNA 50 ng
[0067] Add ddH2O to a final volume of 50 μL.
[0068] The PCR reaction conditions are as follows:
[0069]
[0070] 4) PCR amplification fragment sequencing
[0071] The PCR products of the six strains were subjected to Sanger sequencing. The full-length of the pathogenic *Phytophthora indicum* PiORP1 was 2921 bp. The sequencing results of the susceptible strains were consistent, as shown in SEQ ID NO:3; the sequencing results of the resistant strains were shown in SEQ ID NO:4-6. The cDNA encodes 948 amino acids. The amino acid encoding of the susceptible strains was consistent, as shown in SEQ ID NO:7; the encoding results of the resistant strains were shown in SEQ ID NO:8-10.
[0072] 5) Sequence alignment and translation
[0073] The sequence alignment results were analyzed using Bioedit software, and the results are shown in Table 2. Figure 1 :
[0074] Table 2. Gene sequence types of six pathogenic Phytophthora strains, PiORP1
[0075]
[0076] In susceptible strains, PiORP1 is homozygous for C at nucleotide position 2339 from the 5' end, homozygous for A at nucleotide position 2342, homozygous for A at nucleotide position 2343, and homozygous for A at nucleotide position 2344 (as shown in SEQ ID NO:3); the protein PiORP1 is asparagine at amino terminus 757 (as shown in SEQ ID NO:7).
[0077] The resistant strain CQ-22-6 has a homozygous C at nucleotide position 2339 from the 5' end, a homozygous A at nucleotide position 2342, an A / C heterozygous at nucleotide position 2343, and an A / T heterozygous at nucleotide position 2344 (as shown in SEQ ID NO:4); the protein PiORP1 has a heterozygous asparagine and leucine at amino terminus 757 (as shown in SEQ ID NO:8).
[0078] In the resistant strain YN-22-12, nucleotide 2339 from the 5' end is C / T homozygous, nucleotide 2342 is A / G homozygous, nucleotide 2343 is A homozygous, and nucleotide 2344 is A / T heterozygous (as shown in SEQ ID NO:5); in protein PiORP1, amino acid 757 from the amino terminus is a heterozygous combination of asparagine and isoleucine (as shown in SEQ ID NO:9).
[0079] The resistant strain HUB-23-3 has a C homozygous nucleotide at position 2339 from the 5' end, an A homozygous nucleotide at position 2342, an A / T heterozygous nucleotide at position 2343, and an A / T heterozygous nucleotide at position 2344 (as shown in SEQ ID NO:6); the protein PiORP1 has an asparagine and phenylalanine heterozygous amino acid at position 757 from the amino terminus (as shown in SEQ ID NO:10).
[0080] Example 3: Genetic experiments to verify the function of the mutation site
[0081] It should be noted that whether a single-point mutation of a drug target mediates drug resistance requires supporting genetic evidence. Currently, stable genetic transformation systems for *Phytophthora infestans* face technical challenges, with extremely low protoplast regeneration efficiency, and no efficient single-point mutation transformation schemes available for routine use by those skilled in the art, either domestically or internationally. Directly using *Phytophthora infestans* as a host for mutation site function verification is not only time-consuming and difficult to guarantee success rates, but may also result in insufficient transformants for phenotypic analysis. Therefore, this embodiment uses *Phytophthora sojae*, a model species of the same genus *Phytophthora*, as a substitute host. *Phytophthora sojae* possesses a mature PEG-mediated protoplast transformation system with high transformation efficiency and good reproducibility, making it an internationally recognized platform for *Phytophthora* gene function research. Although the two are different species, *Phytophthora* microorganisms share high homology in the regulation of conserved drug resistance-related pathways. Numerous published studies have confirmed that gene function data obtained from *Phytophthora sojae* can reliably infer similar functions of homologous genes in *Phytophthora infestans*. Therefore, the functional verification results of the mutation sites obtained through genetic transformation of Phytophthora in soybean in this embodiment are sufficient to reasonably support the technical effect of the mutations described in the claims in the identification of resistance to Phytophthora in pathogenic fungi. Based on these results, those skilled in the art can directly and without doubt predict their corresponding functions in pathogenic fungi. The experimental design conforms to conventional practice in the field and there is no problem of insufficient disclosure.
[0082] 1. Carrier Construction
[0083] Donor Vector Construction: Based on the mutation site to be verified, a homologous substitution vector in the CRISPR / Cas9 system was constructed. Primers were designed to amplify 1000 bp upstream and 1000 bp downstream of the ORP1 mutation site. Using homologous recombinase (ClonExpressUltraOneStepCloningKit-C115), the homologous arm sequences of SEQ ID NO:3-SEQ ID NO:6 were ligated into the cloning vector pCE-Zero vector (EcoRV digestion). The ligation product was transformed into competent E. coli cells, and the clone was verified by amplification and sequencing using universal primers M13F / M13R.
[0084] sgRNA expression vector construction: PsORP1-specific sgRNA sequences with a total score greater than 0.5 were designed and selected. The secondary structure of the selected sgRNAs was analyzed using RNA structure analysis tools. The sgRNA with the weakest secondary structure (sg2381: 5'-GCCATGCTCAACACAAACAA-3') was selected and sent to a company to synthesize sgRNA sequences containing NheI and BsaI restriction sites. The sgRNA sequences were then ligated into plasmid PYF515. Recombinant vectors were constructed using homologous recombination (ClonExpressUltraOneStepCloningKit-C115) to transfer the target fragment into the vectors, which were then transformed into competent *E. coli* cells. Positive clones were verified by sequencing using primer M13F.
[0085] 2. PEG-mediated genetic transformation of Phytophthora soybeanis
[0086] (1) Preparation before the experiment: The standard strain of Phytophthora soybean P6497 was inoculated on a 10% V8 plate and cultured in the dark at 25°C for 3 days. Then, liquid culture was carried out (strict aseptic operation). Ten small pieces (5 mm2) were cut with a scalpel and placed in liquid NPB liquid medium. Three bottles were cultured at one time. Two 200 ml empty conical flasks were sterilized in advance (about 70 ml of liquid NPB in each bottle). The culture was allowed to stand for 3 days, and the mixture was shaken once every 12 hours (to prevent the growth of aerial mycelia).
[0087] (2) Place the experimental materials in a clean bench for ultraviolet sterilization for at least 30 minutes in advance;
[0088] (3) After liquid culture, the mycelium was filtered through a single layer of filter cloth and rinsed with 0.8 M mannitol for the first time. Then, the mycelium was collected into a 50 ml BD tube and mannitol was added to 35 ml. The second rinse was performed at 60 rpm / min for 10 min.
[0089] (4) Prepare the enzyme solution and PEG, and pre-cool the PEG on ice;
[0090] (5) Transfer the mycelium into the sterile filtered enzyme solution, 60 rpm / min, 40-50 min, generally 42 min, and observe whether the mycelium has fully lysed. Pre-cool the centrifuge at 4℃.
[0091] (6) After enzymatic hydrolysis, the protoplasts were filtered through a magic filter cloth, and the filtrate was transferred into a clean 50 ml BD tube. The tube was centrifuged at 1500 rpm at 4℃ for 4 min, and the supernatant was discarded.
[0092] (7) Rinse with W5 (to remove impurities) twice. For the first rinse, add 5 ml of W5, gently aspirate and mix, then bring the volume up to 35 ml, 1500 rpm, 4℃, 4 min, and discard the supernatant. Add 7 ml of W5, gently aspirate and mix, place on ice for 30 min, centrifuge again at 1500 rpm for 4 min, and discard the filtrate.
[0093] (8) Add MMG buffer to resuspend the protoplasts and let stand at room temperature for 10 min (adjust the MMG volume according to the protoplast concentration).
[0094] (9) Add the plasmid to a 50 ml tube and calculate the required volume based on the requirement of 35,000 ng of plasmid.
[0095] (10) Add 1 ml of protoplast to each plasmid centrifuge tube and place on ice for 10 min;
[0096] (11) Add PEG in two portions, 870 µL each time, for a total of 1.74 ml. Each time PEG is added, slowly rotate the centrifuge tube and drop PEG along the wall. Rotate for 30 s to ensure that PEG is fully mixed with the plasmid. Place on ice for 20 min.
[0097] (12) Add 200 µL of A (50 mg / ml ampicillin) + PM to the liquid and mix well;
[0098] (13) Add 2 ml PM to the centrifuge tube, slowly invert to mix, and incubate on ice for 2 min;
[0099] (14) Add 8 ml PM, slowly invert to mix, and incubate on ice for 2 min;
[0100] (15) Finally, add 10 ml of PM, seal the BD tube with sealing film, and incubate overnight in the dark at 25°C on a slant.
[0101] (16) After 14 h, centrifuge at 2000 rpm for 5 min, discard most of the supernatant, and mix a small portion by shaking.
[0102] (17) Add 200 µL of ampicillin (50 mg / ml) and 150 µL of G418 (50 mg / ml) to 200 ml of PM medium.
[0103] (18) Add PM to each BD tube to bring the volume to 30 ml, mix thoroughly, pour into a 90 mm × 20 mm culture dish, seal by blowing, and incubate in the dark at 25°C;
[0104] (19) After culturing for 3 days, when suspected transformants grow out of the colony, cover with 10% V8 medium containing 200 µL ampicillin (50 mg / ml) and 200 µL G418 (50 mg / ml);
[0105] (20) After culturing for another 3 days, the suspected transformants that grew were picked and collected on V8 resistance plates; and their sensitivity to fluoxetine was measured to verify the transformants. Finally, DNA was extracted from these transformants for sequencing verification.
[0106] 3. Determination of drug sensitivity in mutants
[0107] Four different mutant types of transformants were obtained using gene editing technology and screening with fluoxetine. These include PiORP1N757 (replacing the ORP1 gene of a susceptible pathogenic *Phytophthora indicum* with the ORP1 gene of *Phytophthora sacchariformis* P6497), PiORP1N757I (replacing the ORP1 gene of a fluoxetine-resistant pathogenic *Phytophthora indicum* with the ORP1 gene of *Phytophthora sacchariformis* P6497, resulting in a homozygous A-T mutation at nucleotide position 2344, i.e., amino acid position 757 of PiORP1 changes from asparagine to leucine), and PiORP1N757L (replacing the ORP1 gene of a fluoxetine-resistant pathogenic *Phytophthora indicum* with the ORP1 gene of *Phytophthora sacchariformis* P6497, resulting in a homozygous A-T mutation at nucleotide position 2343). Homozygous mutations of A-C and A-T at nucleotide position 2344 (i.e., amino acid position 757 of PiORP1 changes from asparagine to isoleucine), and PiORP1N757F (resulting from replacing the ORP1 gene of the pathogenic Phytophthora glomerulone-resistant strain with the ORP1 gene of Phytophthora soybean P6497, resulting in homozygous mutations of A-T at nucleotide position 2343 and A-T at nucleotide position 2344, i.e., amino acid position 757 of PiORP1 changes from asparagine to phenylalanine), were used to verify resistance by replacing the ORP1 gene of the pathogenic Phytophthora glomerulone-resistant strain with the ORP1 gene of Phytophthora soybean P6497. The EC50 of fluthiazopyrone was determined for four different mutation types of transformants. Figure 2As shown, the N757I mutation type can induce more than 100 times the resistance, while N757L and N757F can induce more than 1000 times the resistance. This fully demonstrates that the presence of N757I, N757L, and N757F in Phytophthora virosa ORP1 can significantly enhance the resistance of Phytophthora virosa to fluoxetine.
[0108] Example 4: Detection method for mutation sites in pathogenic Phytophthora.
[0109] 1. Primer design
[0110] By comparing the PiORP1 gene of the susceptible and resistant strains, it was found that the different point mutations carried by the three resistant strains all exhibited an A2344T base mutation in the PiORP1 gene. Therefore, restriction enzyme sites could be designed based on this base difference. A mismatched base was introduced into the upstream primer (SEQ ID NO: 1), thus setting one SmlI restriction site (5'-CTYRAG-3'). This resulted in the susceptible strain amplified fragment having no restriction site, while the resistant strain amplified fragment had one restriction site. After amplification with both upstream and downstream primers, the band size was 209 bp. After SmlI digestion, the PCR product of the susceptible strain as the template remained 209 bp. Since the resistant strain was a heterozygous mutant, it should have two different genotypes, leading to three different bands of 59 bp, 150 bp, and 209 bp in subsequent enzyme digestion (e.g., ...). Figure 3 (As shown). The primer sequences involved in the dCAPS detection method are as follows:
[0111] Upstream primer: 5'-CGGTTTCGTGCTCTGGCATGCCAGTATGAGCGTGAAATCCAACGCCAT
[0112] GCTTAACACAC-3' (SEQ ID NO: 1)
[0113] Downstream primer: 5'-TCTTGTCTTTGAACACCATGTTGC-3' (SEQ ID NO: 2).
[0114] sequence list
[0115] SEQ ID NO:1
[0116] CGGTTTCGTGCTCTGGCATGCCAGTATGAGCGTGAAATCCAACGCCATGCTTAACACAC
[0117] SEQ ID NO:2
[0118] TCTTGTCTTTGAACACCATGTTGC
[0119] SEQ ID NO:3
[0120]
[0121] SEQ ID NO:4
[0122]
[0123] SEQ ID NO:5
[0124]
[0125] SEQ ID NO:6
[0126]
[0127] SEQ ID NO:7
[0128] MQALQDAQQRFNDLVNNDWPERVPVEAMPDYDPRYMKEGFLQKKGQRLKGWKRRWFVCDGRTLSYYISRKDRKPNAVIPLEGCTVQDGGLSETWNSPRIYLTDPATGIMYCLSAEEGIVVTQWLDVLRVAVARVNNGTSESNAQASSQNNSRKQHRLQTAPSSSDDEDSRAHLKRAASLGPSQARAVTLKSASSVGTSNASATNGDNKRTTRLTSAPSSVSNAASTPAPPSHQHHQHRPHRTKTQRLPTTISLENELSHGLDVLEALLGHNSTGSSIRNHVAFRPLGAVNGVLRSIGTDSTSGKQYARASVVLPVSSEVAAILLADHARRAEWDVHFPHSAHVATFDDATDLVHLSSGSFAQIQQTKPFVAPHVAATACALCAALFSGASTWEALLTAMVYAAAVGGIVSSIDYSTLTTPRDLVLLRHVRESAAPDSQDSSDDKSEDEMGKSVVLILEKSVVNELKPISSGSVRAHVGLSGWLLEPVDSGHATLATYITDLDVKGWLSPATRQSFLLSRLDCVSVLSEYVNQAQLCGSELGFGGGLDDDGEGEYETRSVGYEDASEASGLGGFADGELSTIFHPKTYMRGMMPLPSGGLKLIDKEIAKKQGGVVKDVIKSAGAKILEGKSAVSLSLPVRIFEPRTNLERVCDLMLYAPTFLNTAYAQNDALERFKYVISFAVAGLHHSIGQLKPFNPILGETFQSTLNDGTDVSCEHTSHHPPISNFQFTGEKYSIAGFVLWHASMSVKSNAMLNTNKGPVRVTFPDTEGLPGTTIEYNLPYLQIGGLLWGDRTVDIMGNMVFEDKKNRLQCELRLNPDAKSGMGGMFSSSKTPTDSLRGVILDTSASPPREICDVSGSWLHDLVFGNKTYWSINSFQSGYMVPYPEDRILASDSRYREDLHYLAAGDLDESQEWKVKLEVLQRADRKARLDGRRPNHWSFRSAAGGH*
[0129] SEQ ID NO:8
[0130] MQALQDAQQRFNDLVNNDWPERVPVEAMPDYDPRYMKEGFLQKKGQRLKGWKRRWFVCDGRTLSYYISRKDRKPNAVIPLEGCTVQDGGLSETWNSPRIYLTDPATGIMYCLSAEEGIVVTQWLDVLRVAVARVNNGTSESNAQASSQNNSRKQHRLQTAPSSSDDEDSRAHLKRAASLGPSQARAVTLKSASSVGTSNASATNGDNKRTTRLTSAPSSVSNAASTPAPPSHQHHQHRPHRTKTQRLPTTISLENELSHGLDVLEALLGHNSTGSSIRNHVAFRPLGAVNGVLRSIGTDSTSGKQYARASVVLPVSSEVAAILLADHARRAEWDVHFPHSAHVATFDDATDLVHLSSGSFAQIQQTKPFVAPHVAATACALCAALFSGASTWEALLTAMVYAAAVGGIVSSIDYSTLTTPRDLVLLRHVRESAAPDSQDSSDDKSEDEMGKSVVLILEKSVVNELKPISSGSVRAHVGLSGWLLEPVDSGHATLATYITDLDVKGWLSPATRQSFLLSRLDCVSVLSEYVNQAQLCGSELGFGGGLDDDGEGEYETRSVGYEDASEASGLGGFADGELSTIFHPKTYMRGMMPLPSGGLKLIDKEIAKKQGGVVKDVIKSAGAKILEGKSAVSLSLPVRIFEPRTNLERVCDLMLYAPTFLNTAYAQNDALERFKYVISFAVAGLHHSIGQLKPFNPILGETFQSTLNDGTDVSCEHTSHHPPISNFQFTGEKYSIAGFVLWHASMSVKSNAMLNTFKGPVRVTFPDTEGLPGTTIEYNLPYLQIGGLLWGDRTVDIMGNMVFEDKKNRLQCELRLNPDAKSGMGGMFSSSKTPTDSLRGVILDTSASPPREICDVSGSWLHDLVFGNKTYWSINSFQSGYMVPYPEDRILASDSRYREDLHYLAAGDLDESQEWKVKLEVLQRADRKARLDGRRPNHWSFRSAAGGH*
[0131] SEQ ID NO:9
[0132] *
[0133] SEQ ID NO:10
[0134] MQALQDAQQRFNDLVNNDWPERVPVEAMPDYDPRYMKEGFLQKKGQRLKGWKRRWFVCDGRTLSYYISRKDRKPNAVIPLEGCTVQDGGLSETWNSPRIYLTDPATGIMYCLSAEEGIVVTQWLDVLRVAVARVNNGTSESNAQASSQNNSRKQHRLQTAPSSSDDEDSRAHLKRAASLGPSQARAVTLKSASSVGTSNASATNGDNKRTTRLTSAPSSVSNAASTPAPPSHQHHQHRPHRTKTQRLPTTISLENELSHGLDVLEALLGHNSTGSSIRNHVAFRPLGAVNGVLRSIGTDSTSGKQYARASVVLPVSSEVAAILLADHARRAEWDVHFPHSAHVATFDDATDLVHLSSGSFAQIQQTKPFVAPHVAATACALCAALFSGASTWEALLTAMVYAAAVGGIVSSIDYSTLTTPRDLVLLRHVRESAAPDSQDSSDDKSEDEMGKSVVLILEKSVVNELKPISSGSVRAHVGLSGWLLEPVDSGHATLATYITDLDVKGWLSPATRQSFLLSRLDCVSVLSEYVNQAQLCGSELGFGGGLDDDGEGEYETRSVGYEDASEASGLGGFADGELSTIFHPKTYMRGMMPLPSGGLKLIDKEIAKKQGGVVKDVIKSAGAKILEGKSAVSLSLPVRIFEPRTNLERVCDLMLYAPTFLNTAYAQNDALERFKYVISFAVAGLHHSIGQLKPFNPILGETFQSTLNDGTDVSCEHTSHHPPISNFQFTGEKYSIAGFVLWHASMSVKSNAMLNTIKGPVRVTFPDTEGLPGTTIEYNLPYLQIGGLLWGDRTVDIMGNMVFEDKKNRLQCELRLNPDAKSGMGGMFSSSKTPTDSLRGVILDTSASPPREICDVSGSWLHDLVFGNKTYWSINSFQSGYMVPYPEDRILASDSRYREDLHYLAAGDLDESQEWKVKLEVLQRADRKARLDGRRPNHWSFRSAAGGH*。
Claims
1. A method for detecting a nucleotide mutation at position 2344 of the PiORP1 gene of Phytophthora infestans, characterized in that, The method includes the following steps: (a) Using the genomic DNA of the pathogenic fungus to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2 to obtain the amplification product; (b) The amplification product obtained in step (a) was digested with the restriction endonuclease SmlI; (c) Analysis of enzyme digestion products: If the enzyme digestion product shows two DNA fragments of 59 bp and 150 bp, it indicates that the nucleotide at position 2344 of the PiORP1 gene of the pathogenic fungus being tested is a T homozygous mutation. If the enzyme digestion product shows three DNA fragments of 59 bp, 150 bp and 209 bp, it indicates that the nucleotide at position 2344 of the PiORP1 gene of the pathogenic fungus being tested is an A / T heterozygous mutation. If the enzyme digestion product contains only a 209 bp DNA fragment, it indicates that the 2344th nucleotide of the PiORP1 gene of the pathogenic fungus being tested is wild-type. The mutation at nucleotide 2344 causes the amino acid at position 757 of the PiORP1 protein to change from asparagine to leucine, isoleucine, or phenylalanine.
2. The method according to claim 1, characterized in that, The annealing temperature for PCR amplification in step (a) is 60℃.
3. The application of the method according to claim 1 or 2 in identifying the resistance of pathogenic Phytophthora infestans to OSBP inhibitor fungicides, characterized in that, The OSBP inhibitor bactericide is fluthiazopyrone.
4. A method for identifying the resistance of pathogenic Phytophthora infestans to OSBP inhibitor fungicides, characterized in that, The method described in claim 1 or 2 is used to detect the nucleotide mutation at position 2344 of the PiORP1 gene of pathogenic Phytophthora indicum. If the mutation is A / T heterozygous or T homozygous, it indicates that the pathogenic Phytophthora indicum has or is a candidate for resistance to OSBP inhibitor fungicides; the OSBP inhibitor fungicide is fluthiazopyrone.
5. The application of the method according to any one of claims 1-2 in at least one of the following: monitoring of drug-resistant populations of Phytophthora infectivity, early warning of resistance evolution, and guidance on field application of pesticides, characterized in that... By using high-throughput detection of the mutation frequency at nucleotide position 2344 of the PiORP1 gene in pathogenic Phytophthora samples collected from the field, the occurrence and development trend of resistance to OSBP inhibitor fungicides in pathogenic Phytophthora populations can be predicted and monitored, thereby guiding scientific application of pesticides in the field; the OSBP inhibitor fungicide is fluthiazopyrone.