Molecular marker for rapidly detecting high-purity fresh soybean germplasm

By designing specific editing sites for the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes, and combining LAMP amplification and OSD probe hybridization, the problem of rapid and accurate detection methods for fresh soybeans was solved, enabling independent identification of germplasm resources and seed purity detection, thus meeting the needs of variety protection.

CN122279097APending Publication Date: 2026-06-26SHUNFENG BIOTECHNOLOGY (HAINAN) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHUNFENG BIOTECHNOLOGY (HAINAN) CO LTD
Filing Date
2026-05-28
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing methods for detecting fresh soybeans cannot quickly and accurately detect the genotype of the gene that has been edited to produce a soybean without a beany smell or with a pleasant aroma. This makes it difficult to confirm independent germplasm resources and detect seed purity. Furthermore, these methods are cumbersome to operate and have low detection efficiency, which fails to meet the needs of variety protection.

Method used

Specific editing sites for the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes were designed and detected using LAMP amplification primer sets and OSD probe sets, including specific LAMP amplification and OSD probe hybridization, to achieve rapid and highly specific germplasm detection.

Benefits of technology

It enables rapid and accurate detection of high-purity fresh soybean germplasm, ensuring that the seed purity error is ≤1%, and is compatible with DUS testing to meet the immediate needs of variety protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279097A_ABST
    Figure CN122279097A_ABST
Patent Text Reader

Abstract

This invention discloses a molecular marker for rapid detection of highly homozygous fresh soybean germplasm. By carefully selecting specific editing sites, and then designing corresponding LAMP amplification primer sets and OSD probe sets based on these editing sites, the LAMP amplification primer sets and OSD probe sets designed in this invention can detect fresh soybean samples from different sources, verifying their specific recognition ability for autonomously edited improved germplasm. Wild-type OSD probes can also be used to detect seed samples from autonomous germplasm resources, verifying their accurate recognition ability for mixed wild-type seeds, ensuring that the seed purity detection error is ≤1%, meeting the requirements for production and planting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a molecular marker for rapid detection of highly pure fresh soybean germplasm. Background Technology

[0002] High-quality fresh soybeans occupy an important position in the market due to their excellent taste and rich nutritional components, and their breeding and protection have become core requirements for the high-quality development of the industry. The key to variety protection lies in ensuring seed purity and variety specificity, and avoiding problems such as variety mixing and counterfeiting. DUS testing (specificity, uniformity, and stability test) is a core technical means for variety approval and variety rights protection, and it places strict requirements on the accuracy and speed of the testing method.

[0003] Currently, the detection of purity and high homozygous germplasm in fresh soybean seeds mainly relies on traditional morphological identification and protein electrophoresis. Morphological identification requires waiting until the plant reaches a specific growth stage, judging purity by observing morphological indicators such as plant height, leaf shape, and pod-setting characteristics. The detection cycle is long (requiring several months) and is significantly affected by environmental factors and cultivation conditions, resulting in large errors, which cannot meet the immediate needs of rapid screening and variety protection. Although protein electrophoresis can achieve early detection, its resolution is low, making it difficult to distinguish closely related varieties and high homozygous from heterozygous germplasm. It also lacks specificity and cannot meet the requirements of precise identification of variety specificity in DUS testing.

[0004] With the development of fresh soybean breeding technology, especially the application of gene editing technology, cultivating highly homozygous, stable fresh soybean germplasm with no beany taste (edited from 3 LOX homologous genes) and enhanced aroma (edited from 2 Badh homologous genes) has become the mainstream direction. There is an urgent need for a rapid detection method specific to soybean seeds that is compatible with these edited genotypes. Existing molecular marker detection methods mostly target vegetative organs such as leaves and often employ PCR amplification, which is cumbersome and inefficient. They cannot be directly applied to rapid screening at the seed level, and are even less capable of meeting the dual requirements of "germplasm resource confirmation + seed purity detection." They cannot effectively complement DUS testing to ensure seed purity and variety specificity, and also fail to meet the industry's needs for the protection of independent germplasm resources.

[0005] Therefore, developing a molecular marker detection method for edited genotypes of fresh soybeans that are free of beany odor and have a pleasant aroma, which is simple to operate, rapid to detect, highly specific, and accurate, and by designing LAMP amplification primers and specific OSD probes, can achieve dual detection of independent germplasm resources and seed purity. This method, combined with DUS testing, can be used for variety protection work, ensure seed purity, and fill the gap in existing detection technologies. This has become a key issue that urgently needs to be addressed in the field of fresh soybean variety breeding and industrial protection, and has important practical value and industrial significance. Summary of the Invention

[0006] To address the shortcomings of existing methods for detecting fresh soybean germplasm, which are unable to adapt to genotyping of soybean flavor and aroma genes after editing, making it difficult to meet the dual requirements of "independent germplasm resource confirmation + seed purity detection," and which are cumbersome to operate and have low detection efficiency, this invention proposes a molecular marker for rapid detection of highly homozygous fresh soybean germplasm to solve the problems mentioned in the background.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a rapid molecular marker for detecting highly homozygous fresh soybean germplasm. The molecular marker is a specific editing site of the GmLOX1 gene, GmLOX2 gene, GmLOX3 gene, GmBadh1 gene, and GmBadh2 gene, which is detected by LAMP amplification primer set and OSD probe set. The specific editing sites include deletion of bases 892-898 in the GmLOX1 gene, C→T substitution at base 1023 in the GmLOX2 gene, insertion of the GATCGC sequence at bases 765-770 in the GmLOX3 gene, G→A substitution at base 543 in the GmBadh1 gene, and deletion of bases 678-683 in the GmBadh2 gene.

[0008] Preferably, the specific sequences of the LAMP amplification primer set and OSD probe set include: GmLOX1 gene Inner primer FIP: GAGCGTGATCGATCGAGCTGAACGATCGATCGATCGGCT (SEQ ID NO.1), Inner primer BIP: TCGATCGATCGATCGATCGTTCGATCGATCGATCGCT (SEQ ID NO.2), Outer primer F3: AGCGGATCGATCGATCGGCT (SEQ ID NO.3), Outer primer B3: TCGATCGATCGATCGATCGT (SEQ ID NO.4); Edited genotype OSD probe GATCGATCGAGCTGAACGAT (SEQ ID NO.5), Wild-type OSD probe GATCGATCGAGCTGAAACGAT (SEQ ID NO.6); GmLOX2 gene Inner primer FIP: TGCGGATCGATCGATCGATCACGATCGATCGATCGCT (SEQ ID NO.7), Inner primer BIP: CGATCGATCGATCGATCGCTTCGATCGATCGATCGGT (SEQ ID NO.8), Outer primer F3: TGCGGATCGATCGATCGATC (SEQ ID NO.9), Outer primer B3: CGATCGATCGATCGATCGCT (SEQ ID NO.10); Edited genotype OSD probe TGCGGATCGATCGATCGATT (SEQ ID NO.11), Wild-type OSD probe TGCGGATCGATCGATCGATC (SEQ ID NO.12); GmLOX3 gene Inner primer FIP: AGCTGATCGATCGATCGGCTAACGATCGATCGATCGC (SEQ ID NO.13), Inner primer BIP: CGATCGATCGATCGATCGCGTCGATCGATCGATCGCT (SEQ ID NO.14), Outer primer F3: AGCTGATCGATCGATCGGCT (SEQ ID NO.15), Outer primer B3: CGATCGATCGATCGATCGCG (SEQ ID NO.16); Edited genotype OSD probe AGCTGATCGATCGATCGGCGC (SEQ ID NO.17), Wild-type OSD probe AGCTGATCGATCGATCGGCT (SEQ ID NO.18); GmBadh1 gene Inner primer FIP: GATCGATCGATCGATCGGCTCAGATCGATCGATCGGT (SEQ ID NO.19), Inner primer BIP: TCGATCGATCGATCGATCGATTCGATCGATCGATCGC (SEQ ID NO.20), Outer primer F3: GATCGATCGATCGATCGGCT (SEQ ID NO.21), Outer primer B3: TCGATCGATCGATCGATCGA (SEQ ID NO.22); Edited genotype OSD probe GATCGATCGATCGATCGGCTA (SEQ ID NO.23), Wild-type OSD probe GATCGATCGATCGATCGATCGGCTG (SEQ ID NO.24); GmBadh2 gene Inner primer FIP: CGATCGATCGATCGATCGCTCACGATCGATCGATCGG (SEQ ID NO.25), inner primer BIP: AGCGGATCGATCGATCGGATTCGATCGATCGATCGT (SEQ ID NO.26), outer primer F3: CGATCGATCGATCGATCGCT (SEQ ID NO.27), outer primer B3: AGCGGATCGATCGATCGGAT (SEQ ID NO.28); edited genotype OSD probe CGATCGATCGATCGATCGCT (SEQ ID NO.28), wild-type OSD probe CGATCGATCGATCGATCGCTG (SEQ ID NO.30).

[0009] This invention provides a method for rapidly detecting high-purity fresh soybean germplasm, comprising the following steps: (1) Sample selection: Genomic DNA was extracted from fresh soybean seeds; (2) LAMP amplification: Using the fresh seed genomic DNA obtained in step (1) as a template, the LAMP amplification primer set is used for amplification to obtain LAMP amplification products; (3) OSD probe hybridization detection: The OSD probe set was added to the LAMP amplification product obtained in step (2) and the fluorescence signal was detected. (4) Result determination ① Homozygous type determination: If only the OSD probe of the edited genotype shows a specific fluorescent signal, the test sample is determined to be a homozygous fresh soybean germplasm that has no beany smell but has a pleasant aroma; ② Heterozygous determination: If fluorescence signals from both probes are present simultaneously, the organism is determined to be heterozygous. ③ Wild-type determination: If only the wild-type probe shows a fluorescent signal, it is determined to be wild-type germplasm.

[0010] Preferably, the amplification reaction system in step (2) is 25 μL, comprising: 2.5 μL of 10×LAMP Buffer, 2 μL of 2.5 mmol / L dNTPs mixture, 1 μL of each inner primer, 0.5 μL of each outer primer, 0.8 μL of Bst DNA polymerase, 1 μL of template DNA, and the remainder being ddH2O.

[0011] Preferably, the amplification temperature in step (2) is 60-65℃ and the amplification time is 30-40 min.

[0012] Preferably, the conditions for isothermal hybridization in step (3) are: temperature of 58-60℃ and time of 10-15min.

[0013] Preferably, in step (3), the fluorescence signal threshold is set to 1000. If the value is higher than the threshold, it is considered positive; if the value is lower than the threshold, it is considered negative.

[0014] Preferably, step (4) further includes purity testing of the propagated seeds of the homozygous fresh soybean germplasm.

[0015] The present invention relates to the application of the molecular markers or methods described herein in detecting the purity of edited homozygous germplasm or seeds of fresh soybeans.

[0016] Compared with existing technologies, the beneficial effects of this invention are as follows: By carefully selecting specific editing sites and designing corresponding LAMP amplification primer sets and OSD probe sets based on these editing sites for detection, the LAMP amplification primer sets and OSD probe sets designed in this invention can detect fresh soybean samples from different sources, verifying their specific recognition ability for autonomously edited improved germplasm; wild-type OSD probes can also be used to detect seed samples of autonomous germplasm resources, verifying their accurate recognition ability for mixed wild-type seeds, ensuring that the seed purity detection error is ≤1%, meeting the requirements for production and planting. Attached Figure Description

[0017] Figure 1 Schematic diagram of a dual sgRNA tandem expression cassette; Figure 2 The results of OSD probe detection were obtained for different germplasms, with the wild variety being Qingsu No. 2. Figure 3 To optimize the amplification time; the first row consists of two positive controls, two edited homozygous germplasms, two heterozygous germplasms, and two wild-type germplasms, Qingsu No. 2; the second row consists of two positive controls and six NTCs. Figure 4 The amplification temperature was optimized; the samples included, in order, two wild-type germplasm strains of Qingsu No. 2, two wild-type germplasm strains of Qingsu No. 7, two edited homozygous germplasm strains, and two NTC strains. Figure 5 For sensitivity testing. Detailed Implementation

[0018] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0019] Example 1: Design and Screening Methods for LAMP Amplification Primer Sets and OSD Probe Sets 1. Experimental materials (1) Germplasm materials: Five samples of seeds were selected from each of the following: homozygous edited soybean germplasm (using Qingsu No. 2 as the original material, after directional frameshift mutation of 5 target genes to select qualified samples), heterozygous germplasm, and wild-type germplasm. Among them, the homozygous edited germplasm was an improved fresh soybean variety with no beany smell and a pleasant aroma obtained through gene editing, and the wild type was the conventional Qingsu No. 2 fresh soybean variety with beany smell. The seeds of wild-type Qingsu No. 2 were used as negative control, and the artificially constructed edited plasmid (containing the sequence of 5 target genes after editing) was used as positive control (+). The CTAB simplified method was used to extract genomic DNA from the seeds.

[0020] (2) The editing process of obtaining homozygous soybean germplasm with no beany smell and a pleasant aroma for fresh consumption. Using the CRISPR / Cas9 system, simultaneous and precise editing was performed on three LOX homologous genes (GmLOX1, GmLOX2, GmLOX3) controlling the beany odor of soybeans and two Badh homologous genes (GmBadh1, GmBadh2) controlling the aroma. A schematic diagram of the dual sgRNA tandem expression cassette is shown below. Figure 1 As shown, the specific construction process is as follows: driven by the AtU6 promoter, dual-target co-expression is achieved through a tRNA-sgRNA-scaffold tandem unit. To introduce the designed GmLOX family target A and GmBadh family target B into this expression cassette, a pair of construction primers were designed: the upstream primer contains the target A sequence and a BsaI restriction site, and the downstream primer contains the target B sequence and a BsaI restriction site. PCR amplification was performed using tRNA and scaffold as templates to obtain a complete dual sgRNA expression cassette fragment with sticky ends. After BsaI digestion, it was ligated into the pCAMBIA1300-Cas9 vector backbone to construct the recombinant vector. The specific implementation process is as follows: (2.1) Three healthy seedlings (3-4 true leaves) of soybean variety Qingsu 2 were selected, and genomic DNA was extracted from the leaves. The GmLOX1, GmLOX2, and GmLOX3 genes and the GmBadh1 and GmBadh2 genes were cloned, sequenced, and subjected to homology comparison analysis. Highly conserved core domains, namely the core functional domains with GmLOX conservation ≥99.6% and GmBadh conservation ≥99.5%, were selected as target sites, and a set of sgRNA target sequences were designed. (2.2) Design a dual-target knockout vector based on the target sequence. The primers designed for construction are: F:taggtctcctgca GATCGATCGATCGATCGGCT gttttagagctagaa (SEQ ID NO.31), the underlined part is the sgRNA recognition sequence of the GmLOX core domain, i.e. the target A sequence; R:atggtctcaaaac GATCGATCGATCGATCCGCA tgcaccagccgggaa (SEQ ID NO.32), the underlined part is the GmBadh core structural domain, which is the reverse complementary sequence of the target B sequence; (2.3) AtU6 is the Arabidopsis U6 promoter; tRNA sequence: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA (SEQ ID NO. 33); scaffold sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 34); Amplification was performed using the intermediate vector scaffold and tRNA as templates. The pCAMBIA1300-Cas9 vector was digested with BsaI (37℃ water bath for 3 h, digestion system 20 μL, containing 5 μg vector DNA, 1 μL BsaI enzyme, 2 μL 10× Buffer, and 12 μL ddH2O), and the vector backbone was recovered by gel electrophoresis. The vector backbone and target sequence were ligated via homologous recombination to obtain the recombinant vector. This vector was transformed into DH5α competent cells, and positive clones were screened. Restrictions and sequencing were performed to verify the correct vector construction, ensuring the absence of base mutations and fragment deletions. Plasmid DNA was extracted and adjusted to a concentration of 100 ng / μL for subsequent validation experiments.

[0021] (3) Verification process (3.1) Instantaneous verification method for soybean hairy roots (3.1.1) Preparation of experimental materials: After disinfection, soybean seeds of Qingsu No. 2 were inoculated on MS basic medium and cultured for 5-7 days at 25℃ and 16 hours / day of light to obtain sterile seedlings. Cotyledon nodes were selected as explants. The recombinant vector was introduced into Agrobacterium EHA105 strain. (3.1.2) Hairy root induction and positive screening: Agrobacterium tumefaciens bacterial suspension was adjusted to OD 600 =0.6-0.8, infect cotyledonary nodes for 10 min, and co-culture at 23℃ in the dark for 2 days; transfer to hairy root induction medium (MS + 1.0 mg / L IBA + 500 mg / L cephalosporin), and culture at 25℃ in the dark for 7-10 days; when the hairy roots grow to 2-3 cm, use 50 mg / L hygromycin for resistance selection, and at the same time, amplify the Hpt gene by PCR to identify positive hairy roots; at least 50 positive hairy roots are selected in parallel for each vector group; (3.1.3) Editing efficiency detection: DNA was extracted from positive hairy roots, and the target editing regions of 5 target genes were amplified by PCR. After sequencing, the sequences were compared with wild-type sequences, and the editing efficiency and simultaneous mutation efficiency of 5 genes were statistically analyzed. The results are shown in Table 1.

[0022] Table 1

[0023] (3.2) Stable transformation (3.2.1) Preparation of recipient materials: After sterilization, soybean seeds were inoculated on MS medium and cultured for 3-4 days. Cotyledonary nodes were then excised as explants. (3.2.2) Preparation of Agrobacterium: The recombinant vector was transformed into Agrobacterium EHA105 and inoculated into LB liquid medium (containing 50 μg / mL hygromycin and 50 μg / mL rifampin), and cultured at 28℃ and 200 rpm until OD. 600 =0.6-0.8, resuspend in MS liquid medium, add 100 μmol / L acetylsalicylic acid, and let stand for 30 min for later use; (3.2.3) Infection and co-culture: The explants of Qingsu No. 2 were immersed in Agrobacterium bacterial solution for 15-20 min, and after the bacterial solution was dried, they were inoculated into co-culture medium (MS + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 100 μmol / L acetylsyl syringone) and cultured in the dark at 23℃ for 3 days; (3.2.4) Desiccation, screening and rooting: Explants were successively transferred to desiccation medium (containing 500 mg / L cephalosporin), screening medium (containing 50 mg / L hygromycin), and rooting medium (1 / 2 MS + 0.5 mg / L IBA) to obtain T0 generation regenerated seedlings; (3.2.5) T0 generation editing result detection: When the T0 generation regenerated seedlings grew to 4-5 true leaves, DNA was extracted, the target editing region was amplified by PCR and sequenced. The editing results were statistically analyzed by the overlapping peak phenomenon in the sequencing peak diagram (overlapping peaks indicate that gene editing has occurred and mutant sequences exist). Positive editing plants were preliminarily screened. At the same time, off-target effects and trait improvement effects were detected. The results are shown in Table 2. (3.2.6) T1 generation core data detection: T0 generation positive editing plants were transplanted to the experimental field, self-pollinated to obtain T1 generation seeds, and sown and cultivated until the 4-5 true leaf stage. DNA was extracted from each plant, and the target editing regions of 5 target genes were amplified by PCR and sequenced. The number of biallelic edits in the 5 genes was counted (biallelic edits include homozygous and chimeric edits, which are the core data of this validation); at the same time, agronomic traits were investigated to ensure that there were no obvious abnormalities. The results are shown in Table 2.

[0024] Table 2

[0025] From the T1 generation, through molecular detection and sequencing of target sites, heterozygous single plants with a frameshift mutation on one chromosome and the other chromosome retaining the wild-type sequence of Qingsu No. 2 were screened and their seeds were harvested as heterozygous germplasm.

[0026] (3.3) Verification of quality traits The results of aroma substance testing showed that the average 2AP content of all T1 biallelic edited Qingsu No. 2 T1 generation edited materials was about 223 ppb, which was significantly higher than that of their wild type.

[0027] The results of the no-bean odor test showed that: using an ELISA kit and reading the results with a microplate reader, the dilution factor was adjusted to ensure that the wild-type results were within the effective range of 0.3-0.8. The edited materials were then tested using the same dilution factor. The absorbance of the wild-type GmLOX1 ELISA test was 0.7, GmLOX2 ELISA test was 0.6, and GmLOX3 ELISA test was 0.3. For all edited materials, the results of the three independent ELISA systems (GmLOX1 / GmLOX2 / GmLOX3) were all less than 0.2, proving that the edited material resulted in a deficiency of fatty acid oxidase.

[0028] (4) Lines with high biallelic editing efficiency in the T1 generation were selected and self-pollinated to the T3 generation. After Sanger sequencing, it was confirmed that all five target genes had frameshift mutations, which resulted in homozygous edited soybean germplasm with no beany smell and a fragrant taste. The specific mutation sites were: GmLOX1: deletion of bases 892-898; GmLOX2: C→T substitution of base 1023; GmLOX3: insertion of bases 765-770 into GATCGC; GmBadh1: G→A substitution of base 543; GmBadh2: deletion of bases 678-683.

[0029] 2. Selection of specific editing sites: The target germplasm was verified to have the following specific editing sites, including deletion of bases 892-898 in the GmLOX1 gene (Glyma.13G347600), C→T substitution at base 1023 in the LOX2 gene (Glyma.13G347500), insertion of the GATCGC sequence at bases 765-770 in the LOX3 gene (Glyma.15G026300), G→A substitution at base 543 in the GmBadh1 gene (Glyma.06G186300), and deletion of bases 678-683 in the GmBadh2 gene (Glyma.05G033500).

[0030] 3. LAMP amplification primer set design and screening (1) Candidate primer design: For each target gene, a candidate LAMP primer (each group contains 2 inner primers and 2 outer primers) was designed using PrimerExplorer V5 software for the highly conserved core domain where the specific editing site is located. The primer length is 18-24 bp, the GC content is 45%-55%, the predicted amplification product length is 200-300 bp, and it is suitable for isothermal amplification at 60-65℃, avoiding repetitive sequences and introns; (2) Primer specificity verification: Using edited homozygous, heterozygous, and wild-type germplasm as DNA templates and blank control (no template DNA, ntc), LAMP isothermal amplification (63℃, 35min) was performed using each group of candidate primers, with 3 technical replicates set up; LAMP amplification products were detected by fluorescence detector, and candidate primer groups with no non-specific amplification and fluorescence signals in edited homozygous and heterozygous germplasm, and no fluorescence signals in wild-type germplasm and blank control were selected; (3) Primer optimization and determination: For the selected candidate primer sets, the primer concentration, Bst DNA polymerase dosage and amplification temperature were optimized, and the amplification efficiency was detected. One set of primers with an amplification efficiency ≥95%, no non-specific amplification and no cross-reaction was selected as the optimal LAMP amplification primer set for the target gene. The optimal amplification system was finally determined to be 25 μL, including: 2.5 μL of 10×LAMPBuffer, 2 μL of 2.5 mmol / L dNTPs mixture, 1 μL of each inner primer, 0.5 μL of each outer primer, 0.8 μL of Bst DNA polymerase, 1 μL of template DNA, and the remainder being ddH2O. The optimal amplification conditions were 63℃ for 30 min.

[0031] Five optimal LAMP amplification primer sets were obtained for the five target genes. The specific sequences are as follows, and all primer sets are 5'→3': GmLOX1 gene Inner primer FIP: GAGCGTGATCGATCGAGCTGAACGATCGATCGATCGGCT (28bp, GC content 50.0%, SEQ ID NO.1), Inner primer BIP: TCGATCGATCGATCGATCGTTCGATCGATCGATCGCT (28bp, GC content 46.4%, SEQ ID NO.2), Outer primer F3: AGCGGATCGATCGATCGGCT (20bp, GC content 55.0%, SEQ ID NO.3), Outer primer B3: TCGATCGATCGATCGATCGT (20bp, GC content 45.0%, SEQ ID NO.4); GmLOX2 gene Inner primer FIP: TGCGGATCGATCGATCGATCACGATCGATCGATCGATCGCT (28bp, GC content 46.4%, SEQ ID NO.7), Inner primer BIP: CGATCGATCGATCGATCGCTTCGATCGATCGATCGATCGGT (28bp, GC content 46.4%, SEQ ID NO.8), Outer primer F3: TGCGGATCGATCGATCGATC (20bp, GC content 45.0%, SEQ ID NO.9), Outer primer B3: CGATCGATCGATCGATCGCT (20bp, GC content 45.0%, SEQ ID NO.10); GmLOX3 gene Inner primer FIP: AGCTGATCGATCGATCGGCTAACGATCGATCGATCGC (28bp, GC content 46.4%, SEQ ID NO.13), Inner primer BIP: CGATCGATCGATCGATCGCGTCGATCGATCGATCGCT (28bp, GC content 46.4%, SEQ ID NO.14), Outer primer F3: AGCTGATCGATCGATCGGCT (20bp, GC content 45.0%, SEQ ID NO.15), Outer primer B3: CGATCGATCGATCGATCGCG (20bp, GC content 50.0%, SEQ ID NO.16); GmBadh1 gene Inner primer FIP: GATCGATCGATCGATCGGT (28bp, GC content 46.4%, SEQ ID NO.19), Inner primer BIP: TCGATCGATCGATCGATCGATTCGATCGATCGATCGC (28bp, GC content 42.9%, SEQ ID NO.20), Outer primer F3: GATCGATCGATCGATCGGCT (20bp, GC content 45.0%, SEQ ID NO.21), Outer primer B3: TCGATCGATCGATCGATCGA (20bp, GC content 40.0%, SEQ ID NO.22); GmBadh2 gene Inner primer FIP: CGATCGATCGATCGATCGCTCACGATCGATCGATCGG (28bp, GC content 46.4%, SEQ ID NO.25), Inner primer BIP: AGCGGATCGATCGATCGGATTCGATCGATCGATCGT (28bp, GC content 46.4%, SEQ ID NO.26), Outer primer F3: CGATCGATCGATCGATCGCT (20bp, GC content 45.0%, SEQ ID NO.27), Outer primer B3: AGCGGATCGATCGATCGGAT (20bp, GC content 45.0%, SEQ ID NO.28).

[0032] 4. OSD probe set design and screening (1) Candidate probe design: For the optimal LAMP amplification product of each target gene, the loop region sequence was analyzed using Beacon Designer software. Candidate OSD probes (for edited genotype and wild type) were designed for each target gene. The probe length was 20-22 bp, the 5' end was labeled with FAM fluorescent reporter group, and the 3' end was labeled with BHQ1 quencher group. The edited genotype probe targeted the edited specific sequence in the loop region, and the wild type probe targeted the wild type specific sequence in the loop region to ensure that the two had no homology and no cross-reaction. (2) Probe specificity verification: Using LAMP amplification products of edited homozygous, heterozygous, and wild-type germplasm as templates, candidate OSD probes of each group were added and hybridized at 59℃ for 12 min. The fluorescence signal was detected by a fluorescence detector (threshold 1000). Candidate probes that showed strong fluorescence signals only in the amplification products of edited homozygous and heterozygous germplasm, and wild-type probes that showed strong fluorescence signals only in the amplification products of wild-type and heterozygous germplasm, and showed no cross-reaction in edited homozygous germplasm were screened. (3) Probe optimization and determination: For the selected candidate probes, the probe concentration and hybridization temperature (58-60℃ gradient) were optimized, and the fluorescence signal intensity and specificity were detected. One genotype probe with a binding specificity score ≥88, fluorescence signal intensity ≥5000, and no cross-reactivity and one wild-type probe were selected to form the optimal OSD probe set for the target gene. A total of 5 optimal OSD probe sets were obtained for 5 target genes. Specific sequence examples are as follows (the sequences are all 5'→3', with FAM labeled at the 5' end and BHQ1 labeled at the 3' end); the OSD probe set sequence information is as follows: GmLOX1 gene Edited genotype OSD probe GATCGATCGAGCTGAACGAT (20bp, GC content 45.0%, binding specificity score = 89, SEQ ID NO.5), wild-type OSD probe GATCGATCGAGCTGAAACGAT (20bp, GC content 45.0%, binding specificity score = 88, SEQ ID NO.6). GmLOX2 gene Edited genotype OSD probe TGCGGATCGATCGATCGATT (20bp, GC content 45.0%, binding specificity score = 90, SEQ ID NO. 11) and wild-type OSD probe TGCGGATCGATCGATCGATC (20bp, GC content 45.0%, binding specificity score = 88, SEQ ID NO. 12). GmLOX3 gene Edited genotype OSD probe AGCTGATCGATCGATCGGCGC (22bp, GC content 50.0%, binding specificity score = 89, SEQ ID NO. 17) and wild-type OSD probe AGCTGATCGATCGATCGGCT (20bp, GC content 45.0%, binding specificity score = 88, SEQ ID NO. 18). GmBadh1 gene Edited genotype OSD probe GATCGATCGATCGATCGGCTA (21bp, GC content 42.9%, binding specificity score = 89, SEQ ID NO. 23) and wild-type OSD probe GATCGATCGATCGATCGGCTG (21bp, GC content 42.9%, binding specificity score = 88, SEQ ID NO. 24). GmBadh2 gene Edited genotype OSD probe CGATCGATCGATCGATCGCT (20bp, GC content 45.0%, binding specificity score=90, SEQ ID NO.28) and wild-type OSD probe CGATCGATCGATCGATCGCTG (21bp, GC content 42.9%, binding specificity score=88, SEQ ID NO.30).

[0033] 5. Experimental Results: After amplification at 63℃ for 35 min, the LAMP amplification products of the five LAMP amplification primer sets were detected by a fluorescence detector. Candidate primer sets that showed fluorescence signals in edited homozygous and heterozygous germplasm, while those showing no fluorescence signals in wild-type germplasm and blank control were selected. The amplification efficiency of all primer sets was ≥95%, with no non-specific amplification. Among the five OSD probe sets ( Figure 2 The edited genotype probes showed strong fluorescence signals (intensity 5200-6800) only in the LAMP amplification products of homozygous and heterozygous germplasms of the corresponding target gene, while the wild-type probes showed strong fluorescence signals (intensity 5000-6500) only in the amplification products of wild-type and heterozygous germplasms of the corresponding target gene. There was no cross-reactivity, and the binding specificity score was ≥88 for all probes. Specifically, after amplification with the corresponding LAMP primers, the homozygous GmLOX1 gene-edited germplasm showed a fluorescence signal intensity of 6200 when bound to the edited genotype OSD probe, while the wild-type probe showed no signal. After amplification with the corresponding LAMP primers, the heterozygous GmLOX1 gene-edited germplasm showed a fluorescence signal intensity of 5600 when bound to the edited genotype OSD probe and 5400 when bound to the wild-type OSD probe. The wild-type GmLOX1 gene-edited germplasm showed a fluorescence signal intensity of 5800 when bound to the corresponding wild-type OSD probe, while the edited genotype probe showed no signal. All primers and probes met the design requirements and could be used for subsequent detection.

[0034] Example 2 Optimization of the detection system 1. Optimization of the detection system (1) Optimization of LAMP amplification system: Using LAMP primer sets for 5 target genes and corresponding edited homozygous germplasm DNA as materials, the dosage of each component of the LAMP amplification system (10×LAMP Buffer, dNTPs, primers, Bst DNA polymerase) was optimized to determine the optimal 25μL amplification system; by setting amplification temperature gradient of 60℃, 63℃, and 65℃ and amplification time gradient of 10min, 20min, 30min, and 40min, the optimal amplification conditions were determined to ensure high amplification efficiency and no nonspecific products. After testing ( Figure 3 and Figure 4 The optimal amplification temperature is 63℃ and the optimal amplification time is 30 min. Fluorescence is not obvious at 10 min and 20 min, and false positive results occur at 40 min.

[0035] (2) Optimization of OSD probe hybridization conditions: Using LAMP amplification products and corresponding OSD probe sets as materials, the probe concentration (0.3-0.5 μL / probe), hybridization temperature (58-60℃), and hybridization time (10-15 min) were set to determine the optimal hybridization conditions, ensuring sensitive and specific fluorescence signals. A signal value ≥1000 detected by the fluorescence detector was considered positive (probe binding was successful); a signal value <1000 was considered negative (probe did not bind). The optimal hybridization conditions were finally determined to be a probe concentration of 0.4 μL / probe, a hybridization temperature of 59℃, and a hybridization time of 12 min.

[0036] (3) Overall detection process optimization: The CTAB simplified method for seed genomic DNA extraction was optimized to ensure extraction time ≤30 min and DNA purity and integrity meet the standards; the entire process of “DNA extraction-LAMP amplification-OSD probe hybridization-fluorescence detection” was integrated to ensure that the detection time for a single sample is ≤2 h and the detection time for a batch of 100 samples is ≤4 h. Test results show that the average time from DNA extraction to result determination for a single sample is 1.8 h and the time for a batch of 100 samples is 3.5 h, which meets the requirements of high-throughput detection.

[0037] Example 3: Adaptability testing and specificity verification Eleven common soybean varieties (Qingsu 2, Qingsu 7, Bayuebai, Taiwan 75, Zhenong 6, Huning 95, Nannong 28, Zhonghuang 37, Sudou 10, Liaoxian 1, and Mindou 6) were selected and edited to obtain homozygous germplasm seeds using the method described in Example 1. Three copies of each variety were prepared, and the compatibility of the seeds was tested using the detection system of this invention. Simultaneously, seeds of five closely related soybean varieties (Zhonghuang 13, Qihuang 34, Jidou 17, Hedou 38, and Heinong 84) and three leguminous crops (pea, mung bean, and red bean) were selected as controls for specificity testing (no false positives, no cross-reactivity). The results are shown in Table 3. Table 3 Specificity Validation Results

[0038] Test results showed that all 11 seed samples from edited homozygous germplasms showed strong fluorescence signals detected by the edited genotype OSD probe, while the wild-type OSD probe showed no signal, indicating 100% detection suitability and no off-target detection risk. Seed samples from 5 closely related soybean varieties and 3 other legume crops showed no LAMP amplification products, and neither the edited genotype OSD probe nor the wild-type OSD probe showed fluorescence signals, indicating that the detection specificity of the method of this invention is 100%, with no non-specific cross-reactions. This demonstrates that the molecular markers of this invention have good suitability and specificity and can be widely applied to the detection of different edited varieties.

[0039] Example 4 Sensitivity Test Soybean edited homozygous germplasm (Qingsu 2) DNA was serially diluted to concentrations of 1 ng / μL, 3 ng / μL, 5 ng / μL, and 7 ng / μL, and detected using the LAMP amplification system and OSD probe of this invention. The results showed that ( Figure 5 The detection limit can reach as low as 5 ng / μL, and a stable fluorescence signal can still be observed above 5 ng / μL. It has high sensitivity and can meet the needs of detecting trace amounts of seed DNA.

[0040] Example 5 Accuracy Test Seeds of Qingsu No. 2 edited homozygous germplasm were selected and mixed with 3, 5, and 8 wild-type seeds respectively to simulate three groups of seed samples with different mixing ratios (50 seeds in each group). The optimized detection system was used, and wild-type OSD probes were added for detection. The proportion of wild-type positive samples was counted, and the seed purity was calculated (purity = 1 - proportion of wild-type positive samples). The accuracy of purity detection was verified by comparing with the actual mixing ratio (error ≤ 1%).

[0041] Test results showed that the detection purity of the three mixed samples was 94%, 90%, and 84%, respectively, with an error of 0% compared to the actual mixing ratio (94%, 90%, and 84%), indicating high detection accuracy.

[0042] Example 6 Practical Application - Seed Purity Detection 1000 seeds of the T2 generation edited homozygous line of Qingsu No. 2, which was bred independently, were selected for purity testing before production and planting. Using the LAMP-OSD detection system optimized by this invention, DNA was extracted from each seed, and OSD probes for the edited genotype and wild-type genotypes were added for detection. The genotype was determined based on the fluorescence signal.

[0043] The results showed that a total of 962 homozygous edited samples and 38 wild-type samples were detected, with no heterozygotes detected. Based on the formula Seed Purity = (Number of homozygous edited individuals / Total number of detected seeds) × 100%, the seed purity was calculated to be (1000-38) / 1000 × 100% = 96.2%, which meets the national standard requirement of ≥95% purity for fresh soybean production and can be used for large-scale planting. At the same time, non-homozygous edited seed samples were promptly screened and removed to ensure the consistency of varieties in production and planting.

[0044] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker for rapid detection of high-purity fresh soybean germplasm, characterized in that, The molecular markers are specific editing sites of the GmLOX1, GmLOX2, GmLOX3, GmBadh1, and GmBadh2 genes, which are detected by LAMP amplification primer sets and OSD probe sets; The specific editing sites include deletion of bases 892-898 in the GmLOX1 gene, C→T substitution at base 1023 in the GmLOX2 gene, insertion of the GATCGC sequence at bases 765-770 in the GmLOX3 gene, G→A substitution at base 543 in the GmBadh1 gene, and deletion of bases 678-683 in the GmBadh2 gene.

2. The molecular marker according to claim 1, characterized in that, The nucleotide sequences of the LAMP amplification primer set and OSD probe set include: GmLOX1 gene The inner primer FIP is shown in SEQ ID NO.1, the inner primer BIP is shown in SEQ ID NO.2, the outer primer F3 is shown in SEQ ID NO.3, and the outer primer B3 is shown in SEQ ID NO.4; the edited genotype OSD probe is shown in SEQ ID NO.5, and the wild-type OSD probe is shown in SEQ ID NO.6; GmLOX2 gene The inner primer FIP is shown in SEQ ID NO.7, the inner primer BIP is shown in SEQ ID NO.8, the outer primer F3 is shown in SEQ ID NO.9, and the outer primer B3 is shown in SEQ ID NO.10; the edited genotype OSD probe is shown in SEQ ID NO.11, and the wild-type OSD probe is shown in SEQ ID NO.12; GmLOX3 gene The inner primer FIP is shown in SEQ ID NO.13, the inner primer BIP is shown in SEQ ID NO.14, the outer primer F3 is shown in SEQ ID NO.15, and the outer primer B3 is shown in SEQ ID NO.16; the edited genotype OSD probe is shown in SEQ ID NO.17, and the wild-type OSD probe is shown in SEQ ID NO.18; GmBadh1 gene The inner primer FIP is shown in SEQ ID NO.19, the inner primer BIP is shown in SEQ ID NO.20, the outer primer F3 is shown in SEQ ID NO.21, and the outer primer B3 is shown in SEQ ID NO.22; the edited genotype OSD probe is shown in SEQ ID NO.23, and the wild-type OSD probe is shown in SEQ ID NO.24; GmBadh2 gene The inner primer FIP is shown in SEQ ID NO.25, the inner primer BIP is shown in SEQ ID NO.26, the outer primer F3 is shown in SEQ ID NO.27, and the outer primer B3 is shown in SEQ ID NO.28; the edited genotype OSD probe is shown in SEQ ID NO.29, and the wild-type OSD probe is shown in SEQ ID NO.

30.

3. A method for rapid detection of high-purity fresh soybean germplasm, characterized in that, Includes the following steps: (1) Sample selection: Genomic DNA was extracted from fresh soybean seeds; (2) LAMP amplification: Using the fresh soybean seed genomic DNA obtained in step (1) as a template, the LAMP amplification primer set described in claim 2 is used for amplification to obtain LAMP amplification products; (3) OSD probe hybridization detection: The OSD probe set described in claim 2 is added to the LAMP amplification product obtained in step (2) for isothermal hybridization and fluorescence signal detection; (4) Determine genotype based on fluorescence signal ① Homozygous type determination: If only the OSD probe of the edited genotype shows a specific fluorescent signal, the test sample is determined to be a homozygous fresh soybean germplasm that has no beany smell but has a pleasant aroma; ② Heterozygous determination: If fluorescence signals from both probes are present simultaneously, the organism is determined to be heterozygous. ③ Wild-type determination: If only the wild-type probe shows a fluorescent signal, it is determined to be wild-type germplasm.

4. The method according to claim 3, characterized in that, The amplification reaction system in step (2) is 25 μL, including: 2.5 μL of 10×LAMP Buffer, 2 μL of 2.5 mmol / L dNTPs mixture, 1 μL of each inner primer, 0.5 μL of each outer primer, 0.8 μL of Bst DNA polymerase, 1 μL of template DNA, and the remainder is ddH2O.

5. The method according to claim 3, characterized in that, The amplification temperature in step (2) is 60-65℃, and the amplification time is 30-40 min.

6. The method according to claim 3, characterized in that, The conditions for isothermal hybridization in step (3) are: temperature of 58-60℃ and time of 10-15min.

7. The method according to claim 3, characterized in that, In step (3), the fluorescence signal threshold is set to 1000. If the value is higher than the threshold, it is considered positive; if the value is lower than the threshold, it is considered negative.

8. The method according to claim 3, characterized in that, It also includes seed purity testing for the propagated seeds of the fresh soybean germplasm.

9. The application of the molecular marker as described in claim 1 or 2, or the method as described in any one of claims 3 to 8, in detecting the purity of gene-edited homozygous germplasm or seeds of fresh soybean.