A target for treating autoimmune diseases and use thereof

Abstract

This invention discloses a target for treating autoimmune diseases and its application, belonging to the field of cell biology. This invention discovers that a deubiquitinating enzyme, as shown in the amino acid sequence of SEQ ID NO.1, can be effectively targeted to inhibit host lupus-like inflammation and tissue damage. Simultaneously, this invention reveals a novel use of ubrogepant in the treatment of autoimmune diseases. The results of this invention can provide new targets and ideas for the development of drugs for treating autoimmune diseases, and can also be directly applied to the research field to guide the development of commercial products such as OTUD1-based chemical inhibitors and peptides.

Description

Technical Field

[0001] This invention relates to a target for treating autoimmune diseases and its application, belonging to the field of cell biology. Background Technology

[0002] Autoimmune diseases are primarily characterized by the disruption of immune tolerance, leading to the production of large amounts of autoantibodies and autoreactive lymphocytes against self-antigens, ultimately resulting in tissue damage. Systemic lupus erythematosus (SLE) is a heterogeneous autoimmune disease affecting multiple organs, characterized by abnormal activation of the immune system, large amounts of autoantibodies and immune complexes, and inflammation in multiple organs. In my country, the incidence of SLE is 30-70 cases per 100,000 people, with a mortality risk 2-5 times higher than in the healthy population. The etiology and pathogenesis of SLE are complex, and current treatment primarily relies on non-specific immunomodulators, mainly glucocorticoids. Research and development of specific biological agents remains limited. Therefore, in-depth exploration of the mechanisms of immune homeostasis imbalance in autoimmune diseases such as SLE will provide new targets and strategies for the development of drugs to treat these diseases.

[0003] The ubiquitin-proteasome pathway is responsible for the turnover of various cellular proteins, such as transporters, antigen presentation, and cell cycle control. Deubiquitating enzymes (DUBs) play a crucial role in central and peripheral immune tolerance to prevent the development of autoimmune diseases, thus providing potential therapeutic targets for autoimmune disease treatment. However, the molecular mechanisms by which deubiquitating enzymes regulate autoimmune diseases remain unclear, hindering the clinical application and preclinical development of drugs targeting deubiquitating enzymes in autoimmune diseases. OTUD1, a deubiquitinizing enzyme, is a cysteine ​​protease containing an ovarian tumor protease (OTU) domain. It primarily functions by cleaving polyubiquitin chains such as K63, K48, and K33 and plays a key role in various biological processes. OTUD1 participates in maintaining immune homeostasis by inhibiting immune responses through the regulation of interferon and RIG-I-like receptor signaling, and also by regulating the NF-κB signaling pathway to suppress the production of pro-inflammatory cytokines in intestinal immune cells. In the field of cancer, OTUD1 can mediate tumor cell apoptosis and inhibit the proliferation, invasion, and migration of lung adenocarcinoma cells, thereby suppressing tumor development and progression. Therefore, OTUD1 has become a potential therapeutic target for the prevention and treatment of inflammatory bowel diseases, cancer, and other diseases.

[0004] Currently, it is unknown whether the deubiquitinase OTUD1 affects autoimmune diseases, and its role in autoimmune diseases is also unclear. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the present invention provides a target for treating autoimmune diseases and its application. The purpose is to solve the technical problem that it is unknown whether the deubiquitinating enzyme OTUD1 can affect autoimmune diseases, and its function in autoimmune diseases is also unclear. There is an urgent need to find a new target related to autoimmune diseases.

[0006] The first technical solution provided by the present invention is the application of deubiquitinase OTUD1 and its encoded gene as targets in the preparation of drugs to alleviate, relieve and / or treat autoimmune diseases, wherein the amino acid sequence of deubiquitinase OTUD1 is shown in SEQ ID NO.1.

[0007] In some embodiments, the drug may bind to any of the targets shown in (a) to (c), said target containing:

[0008] (a) The amino acid sequence shown in SEQ ID NO.1;

[0009] (b) A polypeptide or analogue derived from the amino acid sequence in (a) by substitution, deletion or addition of one or more amino acids.

[0010] (c) A polypeptide or analogue thereof derived from (a) with an overall amino acid sequence similarity of more than 85% to that in (a) and (b).

[0011] In some embodiments, the drug alleviates, relieves, and / or treats autoimmune diseases by inhibiting the expression of the deubiquitinase OTUD1 or the gene it encodes.

[0012] In some embodiments, the drug includes an inhibitor of the deubiquitinase OTUD1.

[0013] In some embodiments, the dosage form of the drug can be a medically acceptable conventional dosage form. As a preferred example, without limitation, it can be an injection, a lyophilized powder for injection, a suspension, an implant, an embolization, a capsule, a tablet, a pill, or an oral liquid.

[0014] In some embodiments, the drug contains pharmaceutical excipients.

[0015] In some embodiments, the pharmaceutical excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, and wetting agents.

[0016] In some embodiments, the pharmaceutical excipients further comprise at least one of the following: osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, flocculants and anti-flocculators, filter aids, or release inhibitors.

[0017] In some embodiments, the drug contains a pharmaceutical carrier.

[0018] In some embodiments, the pharmaceutical carrier is selected from microcapsules, microspheres, nanoparticles, or liposomes.

[0019] The second technical solution provided by the present invention is the application of deubiquitinase OTUD1 and its encoded gene as targets in the preparation of inhibitors for autoimmune diseases, wherein the amino acid sequence of deubiquitinase OTUD1 is shown in SEQ ID NO.1.

[0020] In some embodiments, the blocking agent may bind to the target.

[0021] In some embodiments, the blocking agent is the drug Ubrogepant.

[0022] In some implementations, the autoimmune disease includes, but is not limited to, systemic lupus erythematosus and rheumatoid arthritis.

[0023] The third technical solution provided by the present invention is the application of deubiquitinase OTUD1 as a target in screening drugs for the treatment of autoimmune diseases, wherein the amino acid sequence of deubiquitinase OTUD1 is shown in SEQ ID NO.1.

[0024] In some embodiments, the application refers to using the amino acid sequence shown in SEQ ID NO.1 as a drug target to prepare a polypeptide or small molecule inhibitor that can bind to it.

[0025] The fourth technical solution provided by the present invention is the application of deubiquitinase OTUD1 as a target in screening inhibitors for autoimmune diseases. The application is that the drug that can block the binding of the amino acid sequence shown in SEQ ID NO.1 to the effector protein BLIMP1 is the target drug for screening.

[0026] The fifth technical solution provided by the present invention is the application of deubiquitinase OTUD1 in the preparation of products for detecting and / or diagnosing autoimmune diseases, wherein the amino acid sequence of deubiquitinase OTUD1 is shown in SEQ ID NO.1.

[0027] In some embodiments, the product includes a biochip, reagent kit, or device for detecting or diagnosing autoimmune diseases.

[0028] In some embodiments, the biochip includes a solid support and oligonucleotide probes ordered immobilized on the solid support, the oligonucleotide probes specifically corresponding to molecular markers.

[0029] In some embodiments, the kit contains reagents for detecting the expression level of the deubiquitinase OTUD1.

[0030] In some embodiments, the device includes one or more means for specifically detecting the expression level of the deubiquitinating enzyme OTUD1.

[0031] The sixth technical solution provided by this invention is the application of Ubrogepant in the preparation of drugs for alleviating, relieving and / or treating autoimmune diseases.

[0032] In some implementations, the autoimmune disease includes, but is not limited to, systemic lupus erythematosus and rheumatoid arthritis.

[0033] The technical effects of this invention are as follows:

[0034] This invention uses transcriptomic data (GSE110999) from blood samples of clinical patients with autoimmune diseases to determine the correlation between the deubiquitinase OTUD1 and autoimmune diseases. Further experiments confirmed that after OTUD1 gene knockout, lupus-like mice exhibited less systemic inflammation and tissue damage than wild-type mice, indicating that OTUD1 exacerbates the lupus-like phenotype in mice. Deubiquitinases are important molecules regulating the homeostasis of host immune cell function. Therefore, the OTUD1 amino acid sequence provided by this invention can serve as a novel target for the treatment of autoimmune diseases. Furthermore, drugs designed using this amino acid sequence as a target for treating autoimmune diseases can specifically inhibit inflammation and organ damage in these diseases. Additionally, this invention provides a novel application of Ubrogepant in the treatment of autoimmune diseases. Attached Figure Description

[0035] Figure 1 Expression profile of deubiquitinase OTUD1 in SLE patients; (A) Expression profile analysis of deubiquitinase family proteins in peripheral blood mononuclear cells of healthy individuals and SLE patients; (B) Expression of OTUD1 in healthy individuals and SLE patients.

[0036] Figure 2 Identification of OTUD1 knockout mice; (A) OTUD1 knockout mouse construction strategy; (B) Gel image of nucleic acid identification of OTUD1 knockout mice.

[0037] Figure 3 (A) Schematic diagram of the Imiquimod-induced SLE mouse model; (B) Visual image of mouse spleen tissue; (C) Changes in body weight in mouse spleen tissue; (D) H&E staining of mouse kidneys; (E) Concentration level of anti-double-stranded DNA IgG in mouse blood; (F) Concentration level of anti-nucleosome IgG in mouse blood. Vehicle, negative control group treated with drug solvent.

[0038] Figure 4 To screen for potential substrate protein BLIMP1 of OTUD1 using the yeast two-hybrid system; (A) In vivo Co-IP experiment to verify the interaction between OTUD1 and BLIMP1; (B) Schematic diagram of BLIMP1 truncated variants (Δ1-230, Δ230-520, Δ520-823) lacking different domains; (C) In vivo Co-IP experiment to verify the interaction between OTUD1 and BLIMP1 truncated variants with different domains.

[0039] Figure 5 For drug screening based on the interaction domains of BLIMP1 and OTUD1; (A) Screening small molecule drugs that block the interaction between BLIMP1 and OTUD1 using the DrugBank drug library; (B) In vivo Co-IP experiments to verify that Ubrogepant blocks the interaction between BLIMP1 and OTUD1.

[0040] Figure 6 (A) Schematic diagram of SLE mouse model treated with Ubrogepant; (B) Visual image of mouse spleen tissue; (C) Changes in body weight of mouse spleen tissue; (D) Concentration level of anti-double-stranded DNA IgG in mouse blood; (E) Concentration level of anti-nucleosome IgG in mouse blood. Vehicle, negative control group treated with drug solvent. Detailed Implementation

[0041] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0042] Raw materials used in the examples:

[0043] 1. Reagent Formulation

[0044] Rat tail lysis buffer: 100mM Tris-HCl (pH 8.0), 5mM EDTA, 200mM NaCl, 0.2% SDS, 0.1mg / ml Proteinase K;

[0045] PBST: 137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 2mM KH2PO4, 0.1% Tween 20;

[0046] NP-40 lysis buffer (pH7.4): 50mM Tris-HCl, 150mM NaCl, 1% NP-40;

[0047] 5×SDS-PAGE loading buffer (pH 6.8): 250mM Tris-HCl, 10% SDS, 0.5% Bromophenol Blue, 50% glycerol, β-mercaptoethanol;

[0048] 1×SDS-PAGE running buffer: 2.5mM Tris, 19.2mM Glycine, 0.1% SDS;

[0049] 1×TBST (pH 7.5): 10mM Tris-HCl, 15mM NaCl, 0.005% Tween 20;

[0050] 1×Western Blot transfer buffer:2.5mM Tris,19.2mM Glycine.

[0051] 2. Purchase reagents

[0052] Isopropanol: Beijing Tongguang Fine Chemical Company, 67-63-0;

[0053] Phanta Max Super-Fidelity DNA Polymerase: Novizan, P505-d1;

[0054] Agarose: Sigma-Aldrich, V900510;

[0055] Imiquimod: 3M Healthcare;

[0056] S1 nuclease: Promega, M5761;

[0057] Calf thymus DNA: Sigma-Aldrich, D4522;

[0058] Reacti-Bind DNA binding buffer: Pierce, 17250;

[0059] Bovine serum albumin: Aladdin, A116563;

[0060] HRP-labeled goat anti-mouse IgG: Zhongshan Jinqiao, ZB-2305;

[0061] Commercial Anti-chromatin IgG ELISA Kit: OmnimAbs, OM426773;

[0062] TMB developer: Beyotime, P0209;

[0063] Ampicillin sodium: Aladdin, A105484;

[0064] Lipofectamine 2000: Invitrogen, 11668019;

[0065] Opti-MEM: Gibco, 31985088;

[0066] Polyvinylidene fluoride membrane: Millipore, YS-TB-IPVH00010;

[0067] Skim milk powder: Wandashan;

[0068] NP-40 pyrolysis buffer: Beyotime, P0013F;

[0069] Anti-Flag M1 Affinity Gel: Sigma-Aldrich, A4596;

[0070] Immobilon Western Chemiluminescent HRP Substrate: Millipore, WBKLS0050;

[0071] Ubrogepant:MCE,HY-12366;

[0072] Zavegepant:MCE,HY-134992;

[0073] TMC-647055: MCE, HY-15591.

[0074] 3. The C57BL / 6N mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0075] Example 1: Expression profile of deubiquitinating enzyme OTUD1 in SLE patients

[0076] (1) Expression profile analysis of deubiquitinase family proteins in peripheral blood mononuclear cells of healthy individuals and SLE patients

[0077] like Figure 1 As shown in (A), based on the RNAseq data of GSE110999 in the NCBI database, the expression profiles of 96 DUBs from seven families (OTU, MJD, MINDY, UCH, USP, SENP, and JAMM) in blood samples from healthy individuals and SLE patients were analyzed using meta-analysis. It was found that OTUD1 expression was significantly increased in SLE patients.

[0078] (2) Expression of OTUD1 in healthy individuals and SLE patients

[0079] like Figure 1 As shown in (B), further validation using different SLE transcriptome data confirmed that OTUD1 is generally highly expressed in SLE patients, indicating that OTUD1 is a potential key protein regulating pathological inflammation in SLE.

[0080] Example 2: Identification of the OTUD1 knockout mouse genotype

[0081] (1) OTUD1 knockout mouse construction strategy

[0082] like Figure 2 As shown in (A), the OTUD1 knockout mice were constructed by Suzhou Cyagen Biotech Co., Ltd. The OTUD1 gene (NCBI accession number: NM_027715, 1365 bp) is located on chromosome 2 of C57BL / 6N mice, containing only one exon (both the ATG start codon and the TGA stop codon are located in exon 1). Using a CRISPR / Cas9 knockout strategy, the ribonucleoprotein complex was co-injected into the fertilized eggs of C57BL / 6N mice. The pups were genotyped by PCR and then sequenced. The knockout mice lacked the 120-137 (GCCGCCGCGGCCCCGGA) gene, a total of 17 bp.

[0083] (2) Nucleic acid identification of OTUD1 knockout mice

[0084] 1) Place the cut-off mouse tail into a 1.5ml EP tube and add 500μL of the prepared genomic extraction lysis buffer to each tube;

[0085] 2) Place in a hybridization oven at 55℃ and rotate overnight;

[0086] 3) Remove the centrifuge tubes and allow them to cool to room temperature for 10-15 minutes. Then centrifuge at 13,000 rpm for 15 minutes at room temperature.

[0087] 4) Transfer 400 μL of supernatant to another new centrifuge tube, add an equal volume of isopropanol, and immediately gently invert the tube to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min at room temperature and discard the supernatant.

[0088] 5) Add 700 μL of cooled 75% ethanol to the centrifuge tube, rinse gently, invert gently, centrifuge at 12000 rpm for 10 min at room temperature, and aspirate all the supernatant.

[0089] 6) Air dry in a clean bench, add 50-100μL of GIBCO pure water, and dissolve at 55℃ for 2 hours;

[0090] 7) Polymerase chain reaction (PCR) assay was used to identify the genotype of OTUD1 knockout mice. The primer sequences are as follows:

[0091] Mice-F:ATGCAGCTCTACAGCAGCGTG

[0092] Mice-R:GGGTGGGCGCTCTCCGGTATC

[0093] PCR reaction system (50 μL): 25 μL 2×Phanta Max Buffer (Vazyme), 1 μL dNTP Mix (Vazyme), 2 μL upstream primer, 2 μL downstream primer, 1 μL Phanta Max Super-Fidelity DNA Polymerase (Vazyme), 2 μL cDNA template, add water to 50 μL, reaction conditions are: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles, 72℃ final extension for 5 min; detection is performed by agarose gel electrophoresis.

[0094] like Figure 2 As shown in (B), the results show that the OTUD1 gene band in OTUD1 knockout mice is significantly smaller than that in wild-type mice.

[0095] Example 3: TLR7 agonist Imiquimod induces SLE mouse model

[0096] (1) Schematic diagram of a mouse model of SLE induced by the TLR7 agonist imiquimod.

[0097] refer to Figure 3 (A) Female mice aged 8-10 weeks were selected, and wild-type mice (Otud1) without Imiquimod (IMQ) treatment were used. + / + ) and OTUD1 knockout mice (Otud1 - / - ), IMQ-processed wild (Otud1)+ / + -IMQ) and Otud1 knockout mice (Otud1 - / - Four mice each were given 1.25 mg of 5% IMQ (3M Healthcare) topically to the right ear of each mouse for up to 6 weeks, three times a week.

[0098] (2) Spleen tissue condition of mice

[0099] Collect mouse tissue samples and add Otud1 + / + Otud1 - / - Otud1 + / + -IMQ and Otud1 - / - The spleen tissue of -IMQ mice was placed on a white A4 sheet of paper and photographed. The results were as follows: Figure 3 (B) shows that there is no significant difference in spleen tissue between wild-type and knockout mice that were not stimulated with IMQ, and the spleen tissue of wild-type mice stimulated with IMQ is larger than that of knockout mice.

[0100] Otud1 respectively + / + Otud1 - / - Otud1 + / + -IMQ and Otud1 - / - The spleen tissue of -IMQ mice was weighed on an electronic balance, and the data were statistically analyzed using Graphpad software. Figure 3 (C) shows that there is no significant difference in spleen tissue between wild-type and knockout mice that were not stimulated by IMQ. The spleen tissue weight of wild-type mice stimulated by IMQ was 172.9 mg, which was 1.23 times heavier than that of knockout mice.

[0101] (3) H&E staining of mouse kidneys

[0102] 1)Otud1 + / + Otud1 - / - Otud1 + / + -IMQ and Otud1 - / - Kidney tissue from IMQ mice was soaked in formalin overnight and sent to the company for paraffin sectioning. The paraffin sections were dewaxed to water and then sequentially immersed in xylene I for 10 min, xylene II for 10 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% ethanol for 5 min, 90% ethanol for 5 min, 80% ethanol for 5 min, and 70% ethanol for 5 min, finally washed with distilled water.

[0103] 2) Stain cell nuclei with hematoxylin, place the sections in Harris hematoxylin staining for 8-15 minutes, rinse with running water, differentiate with 1% hydrochloric acid alcohol for a few seconds, rinse with running water until the tissue is bright blue or sky blue.

[0104] 3) Stain the cytoplasm with eosin. Immerse the sections in eosin staining solution for 2-5 minutes, then transfer them to water to wash away the eosin residue.

[0105] 4) Dehydration and mounting: Place the sections in 95% ethanol I for 5 min, 95% ethanol II for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, xylene I for 5 min, and xylene II for 5 min in sequence to dehydrate and clear the sections. Wipe the xylene around the sections dry and mount them with neutral resin.

[0106] 5) Microscopic examination, image acquisition and analysis.

[0107] like Figure 3 As shown in (D), after IMQ treatment, compared with OTUD1 knockout mice, wild-type mice showed excessive proliferation of kidney cells, indistinguishable capillary loops, and glomerulonephritis.

[0108] (4) Anti-dsDNA IgG ELISA test

[0109] 1) Add S1 nuclease (Promega, M5761) to calf thymus DNA (0.5 mg / mL, Sigma, D4522) at a concentration of 0.1 U / μg and incubate at 37°C for 3 h;

[0110] 2) Mix 60 μL DNA (500 μg / mL), 4.94 μL sterile water, and 5 μL Reacti-Bind DNA binding buffer (Pierce, 17250) in a glass tube according to the above ratio. Add more than 100 μL of the mixture to each well, and then incubate overnight at 4°C in the dark.

[0111] 3) Next, wash the board three times with TBST;

[0112] 4) Block with 150 μL / well of 0.5% BSA solution at room temperature in the dark for 1 hour;

[0113] 5) Collect Otud1 + / + Otud1 - / - Otud1 + / + -IMQ and Otud1 - / - Serum samples from -IMQ mice were diluted 1:500 in 0.5% BSA, and 100 μL was added to each well of a 96-well plate.

[0114] 6) Incubate at room temperature for 2 hours, then wash 3 times with TBST, and then incubate with 1:200 diluted HRP-labeled goat anti-mouse IgG for 2 hours.

[0115] 7) After washing again, add 50 μL of TMB colorimetric solution (Beyotime, PO209) to each well and incubate at 37°C in the dark for 15 min. After color development, add 50 μL of 2M sulfuric acid to each well to terminate the reaction.

[0116] 8) Use an ELISA reader to read the OD value at 450 nm.

[0117] The results are as follows Figure 3 As shown in (E), after IMQ treatment, the OD value of anti-double-stranded DNA IgG in the blood of wild-type mice was 1.65, which was 1.46 higher than that of OTUD1 knockout mice.

[0118] (5) Anti-chromatin IgG ELISA test

[0119] The Anti-chromatin IgG ELISA assay used a commercially available Anti-chromatin IgG ELISA kit (OmnimAbs, OM426773). The procedure was strictly followed according to the instructions, as detailed below:

[0120] 1) Otud1 + / + Otud1 - / - Otud1 + / + -IMQ and Otud1 - / - - The serum of IMQ mice was numbered for the corresponding microtiter wells. Each plate contained 2 negative control wells, 2 positive control wells, and 1 blank control well (no sample or enzyme labeling reagent was added to the blank control well).

[0121] 2) Add 50 μL of positive control and 50 μL of negative control to the positive well and negative control well, respectively. Add 40 μL of sample diluent to the well containing the mouse serum to be tested, then add 10 μL of the serum to be tested. Add the serum to the bottom of the enzyme-labeled well, avoiding contact with the well walls, and gently stir until well mixed.

[0122] 3) After sealing the plate with the sealing film, incubate at 37°C for 30 minutes;

[0123] 4) Remove the sealing film, discard the liquid, shake dry, add washing solution to each well (20 times the washing solution diluted with distilled water), let stand for 30 seconds and then discard, repeat 5 times, and pat dry.

[0124] 5) Add 50 μL of enzyme-labeled reagent to each well, except for the blank wells;

[0125] 6) After sealing with sealing film, incubate at 37°C for 30 minutes. Wash again as in step 4);

[0126] 7) Add 50 μL of colorimetric reagent A solution and 50 μL of colorimetric reagent B solution to each well, and store at 37°C in the dark for 15 min;

[0127] 8) Add 50 μL of stop solution to each well to stop the reaction (at this point, the blue color turns yellow);

[0128] 9) Using the blank as zero, measure the absorbance at a wavelength of 450 nm within 15 minutes after adding the stop solution.

[0129] The results are as follows Figure 3 As shown in (F), after IMQ treatment, the OD value of antinucleosome IgG in the blood of wild-type mice was 0.32, which was 1.61 times higher than that in OTUD1 knockout mice.

[0130] Example 4: Detection of the interaction between OTUD1 and BLIMP1

[0131] (1) Co-IP assay of OTUD1 and BLIMP1 proteins

[0132] 1) The effector protein BLIMP1 plays an important regulatory role in systemic lupus erythematosus (SLE). To investigate whether OTUD1 exerts its regulatory effect on SLE through BLIMP1, plasmids fused with the BLIMP1 gene (NCBI accession number: NM_001198.4, 2478 bp) and the Flag tag (Sigma-Aldrich, E7908) and the OTUD1 gene (NCBI accession number: NM_027715, 1365 bp) and the Myc tag (Invitrogen, V22120) were constructed on p3×FLAG-CMV-14 and pcDNA6A plasmids, respectively. The corresponding primers were synthesized at Sangon Biotech Co., Ltd.

[0133] Flag-Blimp1-F:CGGAATTCaATGTTGGATATTTGCTTG;

[0134] Flag-Blimp1-R:TGCTCTAGAAGGATCCATTGGTTCAAC;

[0135] Myc-Otud1-F:CCGCTCGAGATGCAGCTCTACAGCAGCGT;

[0136] Myc-Otud1-R:TGCTTCTAGAAGAGCATGCATTTTGTTCAAT.

[0137] Using the primers described above, the target gene fragment was amplified. The Flag-Blimp1 gene fragment was inserted into the EcoRI and XbaI sites of the 3×FLAG-CMV-14 plasmid to construct the recombinant plasmid Flag-BLIMP1. The Myc-Otud1 gene fragment was inserted into the XhoI and XbaI sites of the pcDNA6A plasmid to construct the recombinant plasmid Myc-OTUD1. Sequencing and identification were performed at BGI Genomics Co., Ltd. in Shenzhen.

[0138] 2) At 10cm 2 Two eukaryotic expression plasmids were transfected into HEK293T cells (ATCC, CRL-3216) in culture dishes using Lipofectamine 2000 (Invitrogen, 11668019) transfection reagent. 40 μL of Lipofectamine 2000 and 24 μL of LFlag-BLIMP1 and Myc-OTUD1 plasmids were diluted separately in 1 mL of Opti-MEM (Gibco, 31985088) medium and incubated at room temperature for 5 min, respectively. The two Opti-MEM dilutions were then mixed and incubated at room temperature for 20 min. Finally, the plasmid-liposome complexes were added to the cells and the cells were cultured at 37°C for 16 h.

[0139] 2) Collect transfected cells, wash cells with 1 mL of pre-chilled 1×PBS buffer, and lyse cells at 37°C for 10 min using 1 mL of NP-40 lysis buffer (Beyotime, P0013F) containing 1 mM PMSF. Centrifuge to obtain the lysis supernatant and discard the precipitate. Add 35 μL of 5×SDS-PAGE loading buffer as the input sample. Add anti-Flag M1 Affinity Gel (Sigma-Aldrich, A4596) to the remaining supernatant and incubate at 4°C for 4 h. Wash three times with NP-40 lysis buffer, add 1×SDS-PAGE loading buffer, boil at 95°C for 10 min, and perform Western blot analysis.

[0140] 3) Select the appropriate separating gel according to the protein size and perform polyacrylamide gel electrophoresis. Transfer the proteins on the gel to a methanol-activated polyvinylidene fluoride membrane (Millipore, YS-TB-IPVH00010), then block with 1×TBST buffer containing 5% skim milk powder at room temperature for 1 hour. Incubate Flag-BLIMP1 and Myc-OTUD1 proteins with Flag and Myc antibodies, respectively. Co-incubate the blocked PVDF membrane and the antibody diluted in blocking buffer overnight on a shaker at 4°C. Wash the PVDF membrane three times with 1×TBST buffer, and incubate again with the corresponding horseradish peroxidase secondary antibody on a shaker at room temperature for 1 hour. Wash three more times with 1×TBST buffer. Finally, detect the protein bands using an Immobilon Western Chemiluminescent HRP Substrate (Millipore, WBKLS0050), and develop them onto X-ray film in a dark room based on signal intensity.

[0141] The results are as follows Figure 4 As shown in (A), the in vivo Co-IP experiment confirmed the in vivo interaction between OTUD1 and BLIMP1.

[0142] (2) BLIMP1 truncated forms with different structural domains

[0143] Based on the three-dimensional structure of the BLIMP1 protein, different domains of BLIMP1 were divided, and truncated BLIMP1 variants (Δ1-230, Δ230-520, Δ520-823) lacking different domains were constructed, such as... Figure 4 As shown in (B).

[0144] (3) OTUD1-BLIMP1 truncated body Co-IP test

[0145] 1) First, fusion plasmids with different BLIMP1 truncated variants and Flag tags were constructed on the p3×FLAG-CMV-14 plasmid, and the corresponding primers were synthesized at Sangon Biotech Co., Ltd.

[0146] Flag-Blimp1(Δ1-230)-F:CCCAAGCTTATGAGTAGTGAGAAAAAT;

[0147] Flag-Blimp1(Δ1-230)-R:TGCTTCTAGAAGGATCCATCGGTTCAAC;

[0148] Flag-Blimp1(Δ230-520)-F:AAGCAATACGCCACGTCAGAACACGTGGTACAA;

[0149] Flag-Blimp1(Δ230-520)-R:TGACTGGCGTATTGCTTTGGGTTGCTTTCCGT;

[0150] Flag-Blimp1(Δ520-823)-F:CCCAAGCTTATGTTGGATCTTCTCTTG;

[0151] Flag-Blimp1(Δ520-823)-R:TGCTTCTAGTGCAGTTCCCGCCGTTGG.

[0152] By amplifying the target gene fragment, the above fragment was inserted into the HindIII and XbaI sites of the p3×FLAG-CMV-14 plasmid, respectively, to construct recombinant plasmids Flag-BLIMP1(Δ1-230), Flag-BLIMP1(Δ230-520), and Flag-BLIMP1(Δ520-823), which were then sequenced and identified at BGI Genomics Co., Ltd. in Shenzhen.

[0153] 2) Two eukaryotic expression plasmids were transfected into HEK293T cells in 10cm culture dishes using Lipofectamine 2000 transfection reagent. 40μL of Lipofectamine 2000 was diluted with 1mL of Opti-MEM medium, and 24μL of Flag-BLIMP1 (Δ1-230), Flag-BLIMP1 (Δ230-520), Flag-BLIMP1 (Δ520-823), and Myc-OTUD1 plasmids were diluted with 1mL of Opti-MEM medium, respectively. After mixing, each plasmid was incubated at room temperature for 5 min. The two Opti-MEM medium dilutions were then mixed and incubated at room temperature for 20 min. Finally, the plasmid-liposome complex was added to the cells, and the cells were cultured at 37℃ for 16 h.

[0154] 3) Collect transfected cells, wash them with 1 mL of pre-chilled 1×PBS buffer, and lyse them at 37°C for 10 min using 1 mL of NP-40 lysis buffer containing 1 mM PMSF. Centrifuge to obtain the lysis supernatant and discard the precipitate. Add 35 μL of 5×SDS-PAGE loading buffer as the input sample, and add anti-FlagM1 Affinity Gel to the remaining supernatant. Incubate at 4°C for 4 h using a rotary oscillation. Wash three times with NP-40 lysis buffer, add 1×SDS-PAGE loading buffer, and boil at 95°C for 10 min for Western blot analysis.

[0155] 4) Select the appropriate separating gel concentration based on protein size and perform polyacrylamide gel electrophoresis. Transfer proteins from the gel to a methanol-activated polyvinylidene fluoride (PVDF) membrane, then block with 1×TBST buffer containing 5% skim milk powder at room temperature for 1 hour. Incubate Flag-BLIMP1 and Myc-OTUD1 proteins with Flag and Myc antibodies, respectively. Co-incubate the blocked PVDF membrane and the antibody diluted in blocking buffer overnight at 4°C on a shaker. Wash the PVDF membrane three times with 1×TBST buffer, and incubate again with the corresponding horseradish peroxidase secondary antibody at room temperature on a shaker for 1 hour. Wash three more times with 1×TBST buffer. Finally, detect protein bands using Immobilon Western Chemiluminescent HRP Substrate and develop them onto X-ray film in a dark room based on signal intensity.

[0156] The results are as follows Figure 4 As shown in (C), in vivo Co-IP experiments confirmed that OTUD1 mainly interacts with the 1-230 segment of BLIMP1.

[0157] Example 5: Drug screening based on the interaction domains of BLIMP1 and OTUD1

[0158] (1) Drug library screening

[0159] Based on the interacting domains of OTUD1 and BLIMP1, the structural information of BLIMP1 was obtained from the PDB database, and the three-dimensional structure of the target protein was optimized through "hydrogenation and dehydration." Simultaneously, the structural types of small molecule compounds in FDA-approved drug libraries such as DrugBank were standardized, and their three-dimensional structures were optimized through "hydrogenation and dehydration." Based on molecular docking methods, key drugs blocking the interaction between OTUD1 and BLIMP1 were screened, such as... Figure 5 As shown in (A).

[0160] (2) Small molecule drug blocking experiment

[0161] 1) First, two eukaryotic expression plasmids were transfected into HEK293T cells in 10cm culture dishes using Lipofectamine 2000 transfection reagent. 40μL of Lipofectamine 2000 and 24μL of Flag-BLIMP1 and Myc-OTUD1 plasmids were diluted with 1mL of Opti-MEM medium, respectively, and incubated at room temperature for 5 min. The two Opti-MEM medium dilutions were then mixed and incubated at room temperature for 20 min. Finally, the plasmid-liposome complex was added to the cells, and after culturing at 37℃ for 4 h, 10μM Zavegepant, Ubrogepant, and TMC-647055 drugs were added, and the cells were cultured for another 12 h.

[0162] 2) Collect transfected cells, wash them with 1 mL of pre-chilled 1×PBS buffer, and lyse them at 37°C for 10 min using 1 mL of NP-40 lysis buffer containing 1 mM PMSF. Centrifuge to obtain the lysis supernatant and discard the precipitate. Add 35 μL of 5×SDS-PAGE loading buffer as the input sample, and add anti-FlagM1 Affinity Gel to the remaining supernatant. Incubate at 4°C for 4 h by rotating and mixing. Wash three times with NP-40 lysis buffer, add 1×SDS-PAGE loading buffer, and boil at 95°C for 10 min for Western blot analysis.

[0163] 3) Select the appropriate separating gel concentration based on protein size and perform polyacrylamide gel electrophoresis. Transfer proteins from the gel to a methanol-activated polyvinylidene fluoride (PVDF) membrane, then block with 1×TBST buffer containing 5% skim milk powder at room temperature for 1 hour. Flag-BLIMP1 and Myc-OTUD1 proteins are incubated with Flag and Myc antibodies, respectively. The blocked PVDF membrane and the antibody diluted in blocking buffer are co-incubated overnight at 4°C on a shaker. Wash the PVDF membrane three times with 1×TBST buffer, and then incubate again with the corresponding horseradish peroxidase secondary antibody at room temperature on a shaker for 1 hour. Wash three more times with 1×TBST buffer. Finally, detect protein bands using Immobilon Western Chemiluminescent HRP Substrate, and develop them onto X-ray film in a dark room based on signal intensity.

[0164] The results are as follows Figure 5 As shown in (B), the in vivo Co-IP experiment verified that the ubrogepant drug can block the interaction between OTUD1 and BLIMP1.

[0165] Example 6 verifies the effectiveness of Ubrogepant.

[0166] (1) Schematic diagram of constructing a mouse model of SLE treated with Ubrogepant

[0167] Four 8-10 week old female C57BL / 6N mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were selected, including four mice without IMQ and ubrogepant treatment, four mice treated with ubrogepant, four mice treated with IMQ, and four mice treated with both IMQ and ubrogepant. Each mouse was given 1.25 mg of 5% IMQ topically in the right ear for up to six weeks, three times a week. For the last two weeks, each mouse was given 100 μL of 20 mg / kg ubrogepant intraperitoneally daily. Figure 6 As shown in (A).

[0168] (2) Visual image of mouse spleen tissue

[0169] Spleen samples were collected from mice. Spleen tissues from mice without IMQ and Ubrogepant treatment, mice treated with Ubrogepant, mice treated with IMQ, and mice treated with both IMQ and Ubrogepant were photographed on white A4 paper. Results showed that the spleen tissue of untreated mice was larger than that of treated mice. Figure 6 As shown in (B).

[0170] (3) Changes in body weight of mouse spleen tissue

[0171] Spleen tissues from mice treated with neither IMQ nor Ubrogepant, mice treated with Ubrogepant, mice treated with IMQ, and mice treated with both IMQ and Ubrogepant were weighed on an electronic balance, and the data were statistically analyzed using Graphpad software. The results showed that the spleen tissue of untreated mice weighed 158 mg, which was 1.19 times heavier than that of treated mice. Figure 6 As shown in (C).

[0172] (4) Anti-dsDNA IgG ELISA test

[0173] 1) Add S1 nuclease (Promega, M5761) to calf thymus DNA (0.5 mg / mL, Sigma, D4522) at a concentration of 0.1 U / μg and incubate at 37°C for 3 h;

[0174] 2) Mix 60 μL DNA (500 μg / mL), 4.94 μL sterile water, and 5 μL Reacti-Bind DNA binding buffer (Pierce, 17250) in a glass tube according to the above ratio. Add more than 100 μL of the mixture to each well, and then incubate overnight at 4°C in the dark.

[0175] 3) Next, wash the board three times with TBST;

[0176] 4) Block with 150 μL / well of 0.5% BSA solution at room temperature in the dark for 1 h;

[0177] 5) Collected serum samples from mice without IMQ and Ubrogepant treatment, mice treated with Ubrogepant, mice treated with IMQ, and mice treated with both IMQ and Ubrogepant were diluted 1:500 in 0.5% BSA and 100 μL was added to each well of a 96-well plate.

[0178] 6) Incubate at room temperature for 2 hours, then wash 3 times with TBST, and then incubate with 1:200 diluted HRP-labeled goat anti-mouse IgG for 2 hours;

[0179] 7) After washing again, add 50 μL of TMB colorimetric solution (Beyotime, PO209) to each well and incubate at 37°C in the dark for 15 min. After color development, add 50 μL of 2M sulfuric acid to each well to terminate the reaction;

[0180] 8) Use an ELISA reader to read the OD value at 450 nm.

[0181] The results are as follows Figure 6 As shown in (D), the OD value of anti-double-stranded DNA IgG in the blood of untreated ubrogepant mice was 1.63, which was 1.29 times higher than that in treated mice.

[0182] (5) Anti-chromatin IgG ELISA test

[0183] The Anti-chromatin IgG ELISA assay used a commercially available Anti-chromatin IgG ELISA kit (OmnimAbs, OM426773). The procedure was strictly followed according to the instructions, as detailed below:

[0184] 1) Number the microtiter wells corresponding to the serum of mice without IMQ and Ubrogepant treatment, mice treated with Ubrogepant, mice treated with IMQ, and mice treated with both IMQ and Ubrogepant. Set up 2 negative control wells, 2 positive control wells, and 1 blank control well per plate (no sample or enzyme labeling reagent is added to the blank control well).

[0185] 2) Add 50 μL of positive control and 50 μL of negative control to the positive well and negative control well, respectively. Add 40 μL of sample diluent to the well containing the mouse serum to be tested, then add 10 μL of the serum to be tested. Add the serum to the bottom of the enzyme-labeled well, avoiding contact with the well walls, and gently stir until well mixed.

[0186] 3) After sealing the plate with the sealing film, incubate at 37°C for 30 minutes;

[0187] 4) Remove the sealing film, discard the liquid, shake dry, add washing solution to each well (20 times the washing solution diluted with distilled water), let stand for 30 seconds and then discard, repeat 5 times, and pat dry.

[0188] 5) Add 50 μL of enzyme-labeled reagent to each well, except for the blank wells;

[0189] 6) After sealing with sealing film, incubate at 37°C for 30 minutes. Wash again as in step 4);

[0190] 7) Add 50 μL of colorimetric reagent A solution and 50 μL of colorimetric reagent B solution to each well, and store at 37°C in the dark for 15 min;

[0191] 8) Add 50 μL of stop solution to each well to stop the reaction (at this point, the blue color turns yellow);

[0192] 9) Using the blank as zero, measure the absorbance at a wavelength of 450 nm within 15 minutes after adding the stop solution.

[0193] The results are as follows Figure 6 As shown in (E), the OD value of antinucleosome IgG in the blood of untreated ubrogepant mice was 0.27, which was 1.45 times higher than that in treated mice.

[0194] Example 7: Application of OTUD1

[0195] The amino acid sequence shown in SEQ ID NO.1 can be used as a new target for the treatment of autoimmune diseases in the development of drugs for treating autoimmune diseases. Specifically, it can be used in the development and application of commercial proteins, peptides, kits, etc. Peptides and small molecule chemical drugs designed for this target can block the function of the protein, thereby inhibiting inflammation and organ damage in autoimmune diseases.

[0196] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The use of deubiquitinase OTUD1 and the gene encoding the same as a target point in the preparation of a drug for alleviating, relieving and / or treating an autoimmune disease, characterized in that, The amino acid sequence of the deubiquitinase OTUD1 is shown in SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The drug can bind to any of the targets shown in (a) to (c), wherein the target contains: (a) The amino acid sequence shown in SEQ ID NO.1; (b) A polypeptide or analogue derived from the amino acid sequence in (a) by substitution, deletion or addition of one or more amino acids. (c) A polypeptide or analogue thereof derived from (a) with an overall amino acid sequence similarity of more than 85% to that in (a) and (b).

3. Use according to claim 1, characterized in that, The drug reduces, alleviates, and / or treats autoimmune diseases by inhibiting the expression of deubiquitinase OTUD1 or the gene it encodes; optionally, the drug includes an inhibitor of deubiquitinase OTUD1.

4. The use of deubiquitinase OTUD1 and the gene encoding the same as a target in the preparation of an autoimmune disease blocking agent, characterized in that, The amino acid sequence of the deubiquitinase OTUD1 is shown in SEQ ID NO.

1.

5. Use according to claim 4, characterized in that, The blocking agent can bind to the target; optionally, the blocking agent is the drug Ubrogepant.

6. The application of deubiquitinase OTUD1 as a target in screening drugs for the treatment of autoimmune diseases, characterized in that, The amino acid sequence of the deubiquitinase OTUD1 is shown in SEQ ID NO.

1.

7. The application according to claim 6, characterized in that, The application refers to using the amino acid sequence shown in SEQ ID NO.1 as a drug target to prepare peptides or small molecule inhibitors that can bind to it.

8. Use of deubiquitinase OTUD1 as a target in the screening of blocking agents for autoimmune diseases, characterized in that, The application involves selecting drugs that can block the binding of the amino acid sequence shown in SEQ ID NO.1 to the effector protein BLIMP1 as the target drugs for screening.

9. Use of deubiquitinase OTUD1 for the preparation of a product for detecting and / or diagnosing an autoimmune disease, characterized in that, The amino acid sequence of the deubiquitinase OTUD1 is shown in SEQ ID NO.

1.

10. Use of Ubrogepant in the preparation of medicines for the relief, mitigation and / or treatment of autoimmune diseases.

Images