Application of bifidobacterium animalis lactis and probiotics in bone development
By preparing Bifidobacterium lactis subsp. BL-16 postbiotic and combining it with Astragalus membranaceus extract, the problems of poor live bacteria stability and side effects of traditional bone development promotion methods were solved, achieving a safe and effective bone development promotion effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHONGKE WISBIOM(BEIJING)BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-30
AI Technical Summary
In existing technologies, Bifidobacterium animalis subsp. lactis has poor stability in the intestines, and live bacteria are sensitive to environmental changes, resulting in high industrialization costs. Furthermore, traditional calcium supplementation and growth hormones for promoting bone development have side effects. Therefore, we are seeking safe and effective ways to promote bone development.
Bifidobacterium lactis subsp. BL-16 and its postbiotics were prepared by fermentation and pasteurization. The postbiotics were then combined with Astragalus membranaceus extract to prepare a bacterial agent or preparation for promoting bone development.
Bifidobacterium animalis subsp. lactis BL-16 postbiotic can significantly promote bone growth, regulate bone metabolism-related genes, increase growth hormone levels, and improve bone density. It also has no side effects such as insulin resistance, and is highly stable, making it suitable for preparing products that promote bone development.
Smart Images

Figure CN122303086A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to the application of a strain of Bifidobacterium lactis and its metagenin in bone development. Background Technology
[0002] Bones are a vital component of the human body, supporting the body structure and protecting important organs, while also participating in mineral metabolism and hematopoiesis. Bone health is closely related to human growth, development, and quality of life in later life, especially during childhood and adolescence, when rapid bone development directly impacts bone health in adulthood. However, due to various factors such as genetics, malnutrition, and unhealthy lifestyles, many people face problems such as delayed bone development, low bone density, or osteoporosis.
[0003] Traditionally, methods to promote bone development have primarily focused on supplementing calcium, vitamin D, and other minerals. Calcium, as a crucial component of bones, is a fundamental element for bone health. However, calcium supplementation alone is insufficient to effectively promote bone development. Calcium absorption and utilization are limited by various factors, particularly the intestinal environment. Even with large amounts of calcium supplementation, the effect will be significantly reduced if the intestines cannot effectively absorb or utilize it. Vitamin D can promote calcium absorption in the intestines, and many calcium supplements also include vitamin D to enhance their effectiveness. However, these supplements often have limitations, such as the potential side effects of excessive calcium and vitamin D supplementation (e.g., hypercalcemia, kidney stones). Clinically, growth hormone and other methods are often used to regulate bone development and improve bone growth status. However, growth hormone has significant side effects during application, with insulin resistance being particularly prominent. It may also be accompanied by elevated blood sugar and abnormal weight, limiting its long-term clinical application. Therefore, seeking safer and more effective ways to promote bone development is particularly necessary.
[0004] Astragalus is the dried root of *Astragalus mongholicus* or *Astragalus membranaceus*, belonging to the legume family. It is a typical traditional Chinese medicine and food homology substance, listed as a superior-grade herb. It is sweet and slightly warm in nature, and enters the spleen and lung meridians, possessing both medicinal and dietary value. Modern research shows that astragalus is rich in astragalus polysaccharides, astragaloside saponins, flavonoids, amino acids, and various trace elements, exhibiting good physiological activity.
[0005] Gut microbiota not only participate in nutrient metabolism but also indirectly affect bone health by regulating the immune system, reducing inflammation, and promoting mineral absorption. Probiotics are live microorganisms that are beneficial to the host's health, such as *Bifidobacterium animalis* subsp. *lactobacter* (…). Bifidobacterium animalis subsp. lactis As one of the most common probiotic strains, live probiotics have been widely used to regulate gut health. However, live probiotics have certain stability issues in the gut, and some people have poor tolerance to live bacteria. Therefore, how to maximize the effective function of probiotics has become an important issue.
[0006] Postbiotics are metabolites produced by probiotics during their metabolism, including short-chain fatty acids, polysaccharides, proteins, enzymes, vitamins, and antioxidants. These metabolites can exert similar health benefits to probiotics without the need for live bacteria, and they have advantages such as high stability, no risk of infection, and ease of processing. Postbiotics not only possess the health benefits of probiotics but also avoid the stability issues associated with storing and transporting live bacteria. Therefore, preparing postbiotics directly from probiotic cells and fermentation broth during fermentation, followed by pasteurization, is a simple and effective method. Extensive research has been conducted on the role of postbiotics in promoting immune system regulation, anti-inflammation, anti-oxidation, and regulating intestinal barrier function. However, research on the role of postbiotics in bone development is relatively limited.
[0007] Relevant patent documents retrieved:
[0008] This document, published in China (CN120458269A) on September 19, 2025, discloses the application of *Bifidobacterium animalis* subsp. *lactamase* CP-9 in the preparation of products that promote bone growth and development or improve bone health. Through long-term research and extensive experiments, this invention has found that *Bifidobacterium animalis* subsp. *lactamase* CP-9 can improve bone volume fraction, trabecular bone thickness, bone mineral density, and bone mass, and can also effectively increase growth hormone and insulin-like growth factor 1 levels, thereby promoting bone growth and development. Simultaneously, *Bifidobacterium animalis* subsp. *lactamase* CP-9 can effectively increase the levels of type I procollagen N-terminal propeptide, osteocalcin, bone morphogenetic protein, and osteoprotegerin in the body, while significantly reducing the levels of type I collagen N-terminal peptide and nuclear factor κB receptor activator ligand, thereby promoting osteoblast differentiation, inhibiting osteoclast differentiation, promoting bone formation, inhibiting bone resorption, improving bone metabolism, and ultimately achieving the effect of improving bone health.
[0009] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: Literature CN120458269A uses live Bifidobacterium animalis subsp. lactis CP-9 as the active ingredient. However, this live bacterium has extremely poor tolerance to temperature, pH, and processing techniques. It is easily inactivated due to environmental changes during product production, processing, storage, and transportation, requiring stringent preservation conditions such as low temperature and vacuum, which significantly increases industrialization costs. Therefore, there is an urgent need to provide a Bifidobacterium animalis subsp. lactis and its metabiotic that effectively promotes bone growth without causing side effects such as insulin resistance. Summary of the Invention
[0010] The purpose of this invention is to provide: Application of a strain of Bifidobacterium lactis and its post-genetic agent in bone development, and related technologies, to solve the technical problems of providing a strain of Bifidobacterium lactis and its post-genetic agent that promotes bone development, or a combination thereof.
[0011] Terminology Explanation: Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by those skilled in the art. Unless otherwise stated, all patents, patent inventions, and publications cited throughout this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions provided in this chapter shall prevail.
[0012] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.
[0013] Definitions of standard chemical terms can be found in the references "Principles and Identification Techniques of Bacterial and Archaea Systematic Taxonomy, Higher Education Press, Chief Editors Li Wenjun, Liu Lan, Jiao Jianyu, and Fang Baozhu, 2025-01"; "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Science Press, 4th Edition, 2017; and "Microbiology Experiments", Higher Education Press, 4th Edition, 2016.
[0014] Unless otherwise specified, conventional methods within the scope of the art, such as growth curves, cell adhesion tests, acid resistance tests, strain fermentation, strain activation, inoculation, and gavage of laboratory animals, shall be used.
[0015] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.
[0016] The term "Bifidobacterium lactis subsp. animalis" as used in this article refers to: Bifidobacterium genus ( Bifidobacterium Animal Bifidobacterium species ( B. animalis It is a subspecies of probiotics and is one of the most widely used and studied strains in the field of probiotics. It has clear probiotic characteristics and safety properties, and is widely found in the human gut, breast milk and fermented dairy products. It is also a core functional strain in food, health food and microecological preparations.
[0017] The term "human growth hormone" used in this article refers to a single-chain polypeptide hormone synthesized and secreted by eosinophils in the anterior pituitary gland. It is species-specific and is one of the core endocrine hormones that regulate human growth, development, and metabolism.
[0018] The term "insulin resistance" used in this article refers to a pathophysiological state in which the body's target organs and target cells (mainly the liver, skeletal muscle, and adipose tissue) exhibit reduced responsiveness or decreased sensitivity to the biological effects of insulin. In other words, normal doses of insulin cannot effectively promote glucose uptake, utilization, and storage, and inhibit hepatic gluconeogenesis and glycogenolysis. The body needs to secrete more insulin to compensate for and maintain blood glucose homeostasis, which is an important pathological basis for metabolic disorders.
[0019] The term "post-biotic" used in this article refers to the collective term for the biologically active cell-free components and metabolites produced by probiotics after inactivation, fermentation, lysis and other processes. It is the core active substance group for probiotics to exert their beneficial effects. It includes: (1) cell-derived components: inactivated probiotic cells (heat inactivation, low temperature inactivation, high pressure inactivation, etc.), cell lysates / lysates, cell wall components (peptidoglycan, teichoic acid), cell exosomes, intracellular extracts, etc.; (2) metabolites: short-chain fatty acids (acetic acid, propionic acid, butyric acid), extracellular polysaccharides, amino acids, vitamins, bacteriocins, enzymes, secondary metabolites, etc. produced by probiotic fermentation; (3) fermentation-derived systems: probiotic fermentation broth, fermentation broth supernatant, fermentation broth precipitate, and freeze-dried powder and other dosage forms obtained by concentration and drying.
[0020] In a first aspect, the present invention provides: a subspecies of Bifidobacterium lactis (Bifidobacterium lactis) Bifidobacterium animalis subsp. Lactis The preservation number of Bifidobacterium lactis subspecies BL-16 is CGMCC No. 32050.
[0021] The 16S sequence of Bifidobacterium animalis subsp. lactis BL-16 is shown in SEQ ID NO:3; SEQ ID NO:3:
[0022] Among them, the colony characteristics of Bifidobacterium animalis subsp. lactis BL-16 on MRS medium are as follows: the colonies are milky white, round, about 1-2 mm in diameter, smooth and raised, with neat edges.
[0023] Among them, the colony characteristics of Bifidobacterium animalis subsp. lactis BL-16 on Columbia blood agar plates are: non-hemolytic, single colonies are round, milky white and translucent, with regular edges and raised colonies.
[0024] Secondly, the present invention provides a microbial agent comprising the aforementioned Bifidobacterium animalis subsp. lactis BL-16.
[0025] Specifically, the bacterial agent includes one or more of the following: Bifidobacterium animalis subsp. lactis BL-16 cells, fermentation broth, fermentation broth supernatant, fermentation broth precipitate, and lyophilized powder.
[0026] Preferably, the bacterial cells are a liquid suspension or a solid bacterial powder.
[0027] Specifically, the microbial agent also includes nutritionally acceptable nutrient additives.
[0028] Preferably, the nutritional additives include any one or more of dietary fiber, prebiotics, protein, lipids, minerals, and vitamins.
[0029] Thirdly, the present invention provides a preparation of Bifidobacterium lactis subsp. BL-16, comprising: fermentation broth, fermentation broth precipitate, fermentation broth supernatant, live bacteria, inactivated bacteria, lyophilized powder, lysate, lysate, secondary metabolites, and exosomes.
[0030] Specifically, the fermentation broth of Bifidobacterium animalis subsp. lactis BL-16 is a mixed liquid system obtained by culturing Bifidobacterium animalis subsp. lactis BL-16 in a culture medium under artificially controlled fermentation conditions. It contains the bacteria themselves, intracellular and extracellular metabolites, unused culture medium components, and fermentation byproducts.
[0031] Specifically, the precipitate of Bifidobacterium animalis subsp. lactis BL-16 fermentation broth is the solid phase component separated from the fermentation broth of the strain after treatment such as standing, centrifugation or filtration. It mainly includes live / dead cells of the strain, cell fragments and insoluble substances produced in the fermentation system.
[0032] Specifically, the supernatant of the fermentation broth of Bifidobacterium animalis subsp. lactis BL-16 is a clear liquid phase component containing extracellular metabolites of the strain, soluble culture medium residues, and soluble fermentation by-products obtained after the fermentation broth of the strain has been allowed to stand, centrifuged, or filtered to remove solid phase precipitates such as bacterial cells.
[0033] Specifically, Bifidobacterium animalis subsp. lactis BL-16 live bacteria are bacteria with normal physiological activity and capable of carrying out life activities such as metabolism and reproduction.
[0034] Specifically, inactivated Bifidobacterium animalis subsp. lactis BL-16 refers to bacteria that have lost their metabolic and reproductive activities but whose overall structure has been basically preserved after being treated by physical, chemical or other means.
[0035] Specifically, Bifidobacterium animalis subsp. lactis BL-16 freeze-dried powder refers to a solid powder that retains the original active components, obtained by removing moisture from liquid materials such as strain fermentation broth, fermentation supernatant, and bacterial suspension through a freeze-drying process.
[0036] Specifically, Bifidobacterium animalis subsp. lactis BL-16 lysate refers to the mixture of intracellular substances formed after live or inactivated Bifidobacterium animalis subsp. lactis BL-16 bacteria are broken down through physical, chemical or enzymatic methods, releasing intracellular substances.
[0037] Specifically, Bifidobacterium animalis subsp. lactis BL-16 lysate refers to a mixed system containing intracellular active components and fragmented bacterial cells formed after live or inactivated Bifidobacterium animalis subsp. lactis BL-16 bacteria are ruptured through physical, chemical, enzymatic, or biological lysation methods to release all intracellular substances.
[0038] Specifically, secondary metabolites of Bifidobacterium animalis subsp. lactis BL-16 refer to various compounds produced by microorganisms such as the strain during their stable growth phase that are not essential for their own growth and reproduction and often possess specific biological activities such as anti-inflammatory and metabolic regulation.
[0039] Specifically, Bifidobacterium animalis subsp. lactis BL-16 exosomes refer to extracellular vesicles encapsulated by nanoscale lipid bilayer membranes that are actively secreted or released by Bifidobacterium animalis subsp. lactis during its growth and metabolism.
[0040] According to some embodiments of the present invention, the preparation of Bifidobacterium lactis subsp. BL-16 is the postbiotic of Bifidobacterium lactis subsp. BL-16 described below.
[0041] Furthermore, the preparation method of the Bifidobacterium lactis subsp. BL-16 postbiotic is as follows: Bifidobacterium animalis subsp. lactis BL-16 was activated and inoculated into the fermentation substrate, then subjected to anaerobic fermentation. After fermentation, it was pasteurized to obtain Bifidobacterium animalis subsp. lactis BL-16 postbiotic.
[0042] The inoculation amount is 3-30%; preferably, the inoculation amount is 10%.
[0043] The anaerobic fermentation conditions are 35-38℃ and the fermentation time is 24-36h; preferably, the anaerobic fermentation conditions are 37℃ and the fermentation time is 36h.
[0044] The pasteurization conditions are 63-65℃ for 25-30 minutes; preferably, the pasteurization conditions are 65℃ for 30 minutes.
[0045] The fermentation substrate is a mixture of Astragalus extract and basic fermentation substrate; Furthermore, the preparation method of the Astragalus extract is as follows: Astragalus is soaked in 5-10 times its volume of water and extracted at 90-100℃ for 60-80 min, filtered, and the residue after filtration is extracted again with 5-10 times its volume of water at 90-100℃ for 40-50 min, the filtrates are combined and concentrated to obtain the Astragalus extract.
[0046] According to some embodiments of the present invention, the preparation method of the Astragalus extract is as follows: 100g of Astragalus is soaked in 10 times its volume of water and extracted at 100°C for 60min. After filtration, the residue is added to 10 times its volume of water and extracted at 100°C for 45min. The filtrates are combined and concentrated to obtain the Astragalus extract.
[0047] Furthermore, the volume ratio of Astragalus extract to basic fermentation substrate was 1:(0-10). Preferably, the volume ratio of Astragalus extract to basic fermentation substrate is 1:1.
[0048] Furthermore, the basic fermentation substrate is MRS medium.
[0049] Further, the concentration of Astragalus extract in the fermentation substrate is 0.1-5 g / mL; preferably, the concentration of Astragalus extract in the fermentation substrate is 0.5 g / mL.
[0050] Fourthly, the present invention provides a composition comprising the above-described Bifidobacterium animalis subsp. lactis BL-16 or the above-described bacterial agent or the above-described preparation.
[0051] Composition: a product comprising an active ingredient and an inert component (pharmaceutically acceptable excipient) constituting a carrier, and any product obtained directly or indirectly from a combination, complexation or aggregation of two or more components, or from the decomposition of one or more components, or from other types of reactions or interactions of one or more components.
[0052] The active ingredient can be in solid and liquid dosage forms, such as capsules, tablets, lozenges, sugar lozenges, granules, and powders, and liquid dosage forms such as elixirs, syrups, emulsions, dispersions, and suspensions. Other dosage forms include ointments, creams, drops, transdermal patches, or powders; ophthalmic solutions or suspensions for use in the eyes, i.e., eye drops; and gelatin capsules containing the active ingredient and a powdered carrier, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc. Similar diluents can be used to prepare compressed tablets. Both tablets and capsules can be formulated as sustained-release products for sustained release over several hours. Compressed tablets can be sugar-coated or film-coated to mask any unpleasant taste and protect the tablet from air, or they can be enteric-coated for selective disintegration in the gastrointestinal tract. Generally, water, suitable oils, saline solutions, aqueous solutions of dextrose (glucose), and related sugar solutions, as well as glycols such as propylene glycol or polyethylene glycol, are suitable carriers for parenteral solutions. The parenteral solution preferably contains a water-soluble salt of the active ingredient, a suitable stabilizer, and a buffer substance as needed. Antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid, alone or in combination, are suitable stabilizers. Citric acid and its salts, and sodium EDTA can also be used. Furthermore, the parenteral solution may contain preservatives such as benzalkonium chloride, methylparaben, or propylparaben, and chlorobutanol. The compositions of the present invention can be conveniently delivered in aerosol form from pressurized packaging or a sprayer.
[0053] The composition described herein has the function of promoting bone development.
[0054] Specifically, the composition has any one or more of the following functions: (1) Increase body length and femur length; (2) It increases weight without causing obesity; (3) Upregulate IGF-1 and ALP expression levels, and reduce trap expression levels; (4) Maintain fasting blood glucose at a normal level; (5) Increased levels of dopamine, 3-methoxytyramine and tryptophan, and decreased levels of methoxyadrenaline and histamine; (6) Regulates intestinal flora; (7) It alters the metabolism of gut microbiota.
[0055] Furthermore, the composition has any one or more of the following functions: (1) Promotes bone growth; (2) Promotes growth and weight gain without causing obesity; (3) Regulates the expression of bone metabolism-related genes, positively regulating osteogenic genes and negatively regulating osteoclast-related genes; (4) Promotes bone growth and has no insulin resistance; (5) It regulates the expression of key neurotransmitters, upregulates the levels of dopamine and tryptophan neurotransmitters, and downregulates the levels of methoxyadrenaline and histamine neurotransmitters; (6) Reconstructing the composition of gut microbiota and regulating the abundance and diversity of gut microbiota; (7) Regulate the metabolic pathways of gut microbiota.
[0056] The composition further includes excipients selected from any one or more of diluents, excipients, fillers, disintegrants, solubilizers, osmotic pressure regulators, surfactants, pH regulators, and antioxidants; the composition is in any one or more of the following forms: powder, tablet, emulsion, pill, ointment, powder, lyophilized powder for injection, gel, drops, tincture, capsule, granule, or aerosol.
[0057] Fifthly, the present invention provides the use of the above-mentioned Bifidobacterium animalis subsp. lactis BL-16 or the above-mentioned bacterial agent or the above-mentioned preparation in the preparation of a composition having a bone development promoting function.
[0058] Specifically, the composition has any one or more of the following functions: (1) Increase body length and femur length; (2) It increases weight without causing obesity; (3) Upregulate IGF-1 and ALP expression levels, and reduce trap expression levels; (4) Maintain fasting blood glucose at a normal level; (5) Increased levels of dopamine, 3-methoxytyramine and tryptophan, and decreased levels of methoxyadrenaline and histamine; (6) Regulates intestinal flora; (7) It alters the metabolism of gut microbiota.
[0059] Furthermore, the composition has any one or more of the following functions: (1) Promotes bone growth; (2) Promotes growth and weight gain without causing obesity; (3) Regulates the expression of bone metabolism-related genes, positively regulating osteogenic genes and negatively regulating osteoclast-related genes; (4) Promotes bone growth and has no insulin resistance; (5) It regulates the expression of key neurotransmitters, upregulates the levels of dopamine and tryptophan neurotransmitters, and downregulates the levels of methoxyadrenaline and histamine neurotransmitters; (6) Reconstructing the composition of gut microbiota and regulating the abundance and diversity of gut microbiota; (7) Regulate the metabolic pathways of gut microbiota.
[0060] The composition further includes excipients selected from any one or more of diluents, excipients, fillers, disintegrants, solubilizers, osmotic pressure regulators, surfactants, pH regulators, and antioxidants; the composition is in any one or more of the following forms: powder, tablet, emulsion, pill, ointment, powder, lyophilized powder for injection, gel, drops, tincture, capsule, granule, or aerosol.
[0061] The present invention has at least the following beneficial effects: Bifidobacterium animalis subsp. lactis BL-16, isolated from healthy breast milk and deposited at the China General Microbiological Culture Collection Center (CGMCC No. 32050), exhibits excellent acid and bile salt tolerance, intestinal epithelial cell adhesion ability, and high fermentation efficiency. Its postbiotic (W16) can regulate the expression of bone metabolism-related genes, positively regulating osteogenic genes and negatively regulating osteoclast-related genes, significantly promoting bone growth and individual development without side effects such as insulin resistance. It can also regulate the expression of key neurotransmitters, upregulating dopamine and tryptophan levels and downregulating methoxy-adrenaline and histamine levels, and regulating intestinal flora. It has broad application prospects in the preparation of products for bone development.
[0062] Considering the possibility of this invention entering other countries, this invention also provides the following technical solutions: A method for promoting bone development involves administering to a subject an effective amount of Bifidobacterium animalis subsp. lactis BL-16 or the above-described bacterial agent, preparation, or composition.
[0063] The subjects include living organisms (e.g., mammals) that can elicit an immune response. Examples of subjects include humans, primates, cattle, horses, goats, sheep, dogs, cats, mice, rats, rabbits, guinea pigs, pigs, and their transgenic species.
[0064] Specifically, the method has at least one of the following effects: (1) Promotes bone growth; (2) Promotes growth and weight gain without causing obesity; (3) Regulates the expression of bone metabolism-related genes, positively regulating osteogenic genes and negatively regulating osteoclast-related genes; (4) Promotes bone growth and has no insulin resistance; (5) It regulates the expression of key neurotransmitters, upregulates the levels of dopamine and tryptophan neurotransmitters, and downregulates the levels of methoxyadrenaline and histamine neurotransmitters; (6) Reconstructing the composition of gut microbiota and regulating the abundance and diversity of gut microbiota; (7) Regulate the metabolic pathways of gut microbiota.
[0065] Preservation Instructions Preserved strain: Bifidobacterium animalis subsp. lactis BL-16; Classification and nomenclature: Bifidobacterium animalis subsp. lactis Bifidobacterium animalis subsp.lactis ; Accession number: CGMCC No. 32050; Preservation period: September 24, 2024; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description
[0066] Figure 1 Morphological and colony observations of Bifidobacterium animalis BL-16, and hemolytic characteristics.
[0067] Figure 2 The growth curve of Bifidobacterium animalis BL-16 is shown.
[0068] Figure 3 BL-16 fermented Astragalus membranaceus post-biotic promotes bone growth; (A) Body length curve (cm), (B) Body length increase (cm), (C) Left femur length (cm), (D) Body weight curve (g), (E) Body weight increase (g), (F) Four groups of Lee's index.
[0069] Figure 4 BL-16 post-genetic upregulates bone growth gene expression; (A) bone IGF-1 (B) Relative mRNA levels; IGF-1 (C) Relative mRNA level of plasma IGF-1 (pg / mL); (D) Relative mRNA level of liver IGF-1 (pg / mL); (E) Relative mRNA level of plasma alp; (F) Relative mRNA level of plasma trap. P<0.05, P<0.01, P<0.001.
[0070] Figure 5 BL-16 postbiotic (W16) improves insulin resistance in juvenile rats; (A) fasting blood glucose level (mmol / L), (B) serum insulin level (mU / L), ns indicate no significant difference. P<0.05, P<0.01.
[0071] Figure 6BL-16 post-biotic altered neurotransmitter levels in juvenile rats. The levels of (A) dopamine, (B) 3-methoxytyramine, (C) tryptophan, (D) (-)-norepinephrine, (E) methyladrenaline, (F) γ-aminobutyric acid, and (G) histamine in the hippocampus were determined. P<0.05, P<0.01, P<0.001.
[0072] Figure 7 To assess the diversity and composition of the gut microbiota in juvenile rats, α-diversity of the gut microbiota was assessed using (A) the Chao1 and (B) Shannon indices, (C) principal coordinate analysis (PCoA) of microbiome β-diversity, and the level of bacterial distribution among the four groups: (D) phylum, (E) genus, and (F) species.
[0073] Figure 8 Differences in gut microbiota distribution among different treatment groups. (A) Differential bacterial volcano in hGH group vs. NC group, (B) Differential bacterial volcano in FS group vs. NC group, (C) Differential bacterial volcano in W16 group vs. NC group, (D) Two-way bar chart showing specific differential species in hGH group vs. NC group, (E) Two-way bar chart showing specific differential species in FS group vs. NC group, (F) Two-way bar chart showing specific differential species in W16 group vs. NC group.
[0074] Figure 9 Microbial gene functions predicted by PICRUSt2 based on KEGG database annotations.
[0075] Figures 10-11 The results are from UPLC-Q-TOF / MS component detection and identification.
[0076] Figure 12 The effect of different strains of biogen on body length promotion (significant difference markers only show results with P<0.01 and more significant differences compared with the NC group). Detailed Implementation
[0077] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.
[0078] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.
[0079] Data analysis and statistical analysis were performed using professional data processing software. One-way ANOVA was used for significance analysis, and P<0.05 was considered to indicate a significant difference.
[0080] Example 1: Isolation and Identification of Bifidobacterium animalis subsp. lactis BL-16 1. The animal Bifidobacterium lactis subsp. BL-16 of the present invention was isolated from healthy breast milk by MRS agar plates.
[0081] 2. 16S rRNA identification: After culturing the bacterial culture, colony PCR amplification was performed using universal bacterial primers 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1); 1540R: AGGAGGTGATCCAGCCGCA (SEQ ID NO:2). Following this, 16S rDNA sequencing was performed for identification. The 16S rDNA sequences of each strain were compared with the 16S rDNA sequences of all previously identified bacteria in the database. Among the results, strain BL-16 was found to be similar to *Bifidobacterium animalis* subsp. *lactamella* (…). Bifidobacterium animalis subsp. lactis The 16S rDNA sequence of the animal showed the highest homology similarity (99.72%), and a strain of Bifidobacterium animalis subsp. lactis BL-16 was identified through screening. The 16S sequence of Bifidobacterium animalis subsp. lactis BL-16 is shown in SEQ ID NO:3.
[0082] 3. Strain Preservation: Bifidobacterium animalis subsp. lactis BL-16 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on September 24, 2024, with accession number CGMCC NO. 32050, and classified as Bifidobacterium animalis subsp. lactis. Bifidobacterium animalis subsp. lactis.
[0083] Example 2 Characterization of Bifidobacterium animalis subsp. lactis BL-16 1. Morphological and colony observation, hemolytic characteristics Pure bacterial culture was evenly spread onto a glass slide and fixed in the outer flame of an alcohol lamp. After Gram staining, the slide was slowly rinsed with deionized water to remove excess staining solution. After the slide dried, it was observed and photographed under an oil immersion microscope. Diluted pure bacterial culture was spread on MRS agar medium and incubated at 37°C for 48 hours. The colony morphology was then observed.
[0084] The results show that ( Figure 1 The microbiological characteristics of Bifidobacterium animalis subsp. lactis BL-16 are as follows: (1) Colony morphology: Colony characteristics on MRS medium: colonies are milky white, round, about 1-2 mm in diameter, smooth, raised, and with neat edges. Colony characteristics on Columbia blood agar plates: non-hemolytic, single colonies are round, milky white and translucent, with regular edges and raised colonies. (2) Bacterial morphology after staining: typical bifidoid morphology, showing irregular shapes such as Y-shaped, V-shaped, club-shaped, and rod-shaped, without spores, without flagella, and non-motile.
[0085] 2. Growth curve determination The glycerol-preserved test strain was inoculated into sterile MRS liquid medium at a 1% inoculum and anaerobically cultured at 37°C for 16 h. 1% of the inoculum was then transferred to a sterile 96-well plate containing 200 μL of MRS broth. After purging with nitrogen, the plate was incubated at 37°C for 8 h. Another 1% of the inoculum was then transferred to a new 96-well plate, with each strain replicated in triplicate. The plates were sealed and incubated at 37°C with shaking. OD was measured every 1 h. 600 The measurements were taken continuously for 24 hours. The results showed that ( Figure 2 BL-16 enters the logarithmic phase approximately 5 hours after inoculation and the stationary phase approximately 17 hours later, with an OD value of approximately 1.0 at the stationary phase. Compared to the control strain Bifidobacterium animalis subsp. lactis BL-11 (CGMCC NO.20847), which takes 26 hours to reach the stationary phase, BL-16 exhibits a shorter fermentation time and higher density under the same conditions.
[0086] 3. Virulence and safety tests of Bifidobacterium animalis subsp. lactis BL-16 The pathogenicity test method of food-grade bacteria in Appendix A of GB 31615.2-2025 "National Food Safety Standard - Procedure for Safety Evaluation of Food-grade Microbial Strains" was used to test Bifidobacterium lactis subsp. BL-16. The tested animals showed no abnormalities or deaths, and their body weight was not statistically significant compared with the control group (p>0.05), indicating that this strain is non-pathogenic.
[0087] 4. Test for tolerance to artificial gastric juice Preparation of artificial gastric fluid: Weigh 0.1 g NaCl and 0.175 g pepsin, add 50 mL water, dissolve thoroughly, adjust pH to 2.5 with dilute hydrochloric acid, mix well, and filter under sterile conditions using a 0.22 μm filter membrane for later use.
[0088] The glycerol-preserved bacterial strain was inoculated into sterile MRS liquid medium at a 1% inoculum and anaerobically cultured at 37°C for 16 h. 10 mL of the culture was centrifuged at 6000 g for 10 min, the supernatant was discarded, and the bacterial cells were washed twice with sterile physiological saline. The bacterial sludge was resuspended in 3 mL of artificial gastric fluid, mixed thoroughly, and then brought to a final volume of 10 mL with artificial gastric fluid. After thorough mixing, 100 μL was taken and serially diluted, and the initial viable count was determined using MRS plate counting. After anaerobic incubation at 37°C for 3 h, 100 μL was taken and serially diluted, and the viable count was determined using MRS plate counting after 3 h of gastric fluid treatment.
[0089] Gastric juice resistance = (3-hour viable count / initial viable count) × 100%.
[0090] The results (Table 1) showed that after 3 hours in simulated gastric fluid at pH 2.5, the survival rate of strain BL-16 was 75.48%. Table 1. Survival rate of Bifidobacterium animalis subsp. lactis BL-16 in artificial gastric fluid at pH 2.5
[0091] 5. Test for tolerance to artificial intestinal fluid Preparation of artificial intestinal fluid: Dissolve 6.8 g of potassium dihydrogen phosphate in 500 mL of water, adjust the pH to 6.8 with 0.1 mol / L sodium hydroxide solution, and dissolve 10 g of pancreatic enzyme in an appropriate amount of water. Mix the two solutions together, dilute with water to 1000 mL, mix well, and filter under sterile conditions using a 0.22 μm filter membrane.
[0092] The experimental bacterial strain preserved in glycerol was inoculated into sterile MRS liquid medium at a 1% inoculum and anaerobically cultured at 37°C for 16 h. 10 mL of the culture medium was centrifuged at 6000 g for 10 min, the supernatant was discarded, and the bacterial cells were washed twice with sterile physiological saline. 3 mL of artificial intestinal fluid was added to resuspend the bacterial sludge, and the mixture was brought to a final volume of 10 mL with artificial intestinal fluid. After thorough mixing, 100 μL was taken and serially diluted to determine the initial viable count. After culturing at 37°C for 3 h, 100 μL was taken and serially diluted again for plate counting to determine the viable count after 3 h of intestinal fluid treatment.
[0093] Intestinal fluid resistance = (3-hour viable count / initial viable count) 100%.
[0094] The results (Table 2) showed that both strains of Bifidobacterium lactis exhibited excellent tolerance to artificial intestinal fluid after 3 hours, with the experimental strain BL-16 showing better tolerance.
[0095] Table 2. Survival rate of Bifidobacterium lactis subsp. BL-16 in artificial intestinal fluid.
[0096] 6. Adhesion ability test Determine the OD of bacterial culture entering the plateau phase 600 The cells were washed three times with DMEM incomplete medium, and the cell concentration was adjusted to approximately 5 × 10⁻⁶. 7 Approximately CFU / mL. Discard the culture medium for Caco-2 cells and add 1 ml of a solution containing 5 × 10⁻⁶ CFU / mL to each well. 7 Add 1 ml of DMEM incomplete culture medium containing approximately CFU of bacteria to cell-free wells containing 5 × 10⁶ cells / ml. 7 DMEM incomplete culture medium containing approximately CFU of bacteria was used as a baseline control and incubated at 37°C in a 5% CO2 incubator for 2 hours.
[0097] Except for the baseline control group, the culture medium in other wells was discarded, the cells were washed twice with sterile physiological saline, 1 ml of Trypesin-EDTA was added to digest the cells, and the number of viable bacteria after adhesion was counted.
[0098] Adhesion rate (%) = number of viable bacteria after adhesion / number of viable bacteria before adhesion × 100.
[0099] The results showed that the adhesion of BL-16 was 60.72±0.29%.
[0100] Example 3: Preparation of medicinal and edible traditional Chinese medicine and postbiotics by fermentation of Bifidobacterium animalis subsp. lactis BL-16 1. Preparation of aqueous extract of food-medicine homology composition 100g each of dried black dates (HZ), black sesame seeds (HZM), malt (MY), Cistanche deserticola (RCR), hawthorn (SZ), yam (SY), and astragalus membranaceus (HQ) were weighed out. Ten times the volume of distilled water was added to each extract, and the mixture was soaked and boiled for 1 hour, then filtered. The residue was then boiled again with ten times the volume of distilled water for 45 minutes. The filtrates were combined and concentrated to obtain 1g / ml aqueous extracts of the medicinal and edible homologous compositions. The concentrated fermentation broth was serially diluted with MRS medium to different concentrations of aqueous extract (0.1g / mL, 0.2g / mL, 0.5g / mL, 1g / mL) for fermentation.
[0101] 2. Determination of viable count of medicinal and edible bacteria in BL-16 fermentation BL-16 strain activation: Bifidobacterium animalis BL-16 strain was inoculated into MRS medium at a rate of 5% for activation until the bacterial cells reached the logarithmic growth phase.
[0102] Preparation of fermentation broth for food and medicine homology: BL-16 cells that have been activated twice are inoculated at a ratio of 10% into the above-mentioned fermentation substrates of food and medicine homology of different concentrations. Fermentation is carried out at 37℃ for 24-48 hours until obvious acidic changes (pH value decrease) are produced in the fermentation broth. Five tubes are made for each concentration.
[0103] Determination of viable cell counts of different fermented products after 36 hours: The viable cell counts of BL-16 post-fermentation progenitor after fermentation of traditional Chinese medicine are shown in Table 3. The viable cell counts are HQ>HZ>SY>MY>HZM>RCR>SZ. Among them, BL-16 fermented astragalus (HQ) showed the best growth, with the highest cell density after fermentation at 0.5g / mL.
[0104] Table 3. Viable bacterial count of Bifidobacterium animalis subsp. lactis BL-16 after fermentation of traditional Chinese medicine
[0105] 3. Preparation of BL-16 fermentation-inactivated bacterial cells and metabiotics 1) Inactivation treatment after fermentation The fermented Bifidobacterium animalis subsp. lactis BL-16 fermentation broth and cell mixture (including cells and metabolites) were heated to 65°C and maintained for 30 minutes.
[0106] 2) Concentration of BL-16 post-biotic Cooling: Allow the pasteurized fermentation broth and cell mixture to cool naturally to room temperature.
[0107] Concentration: The pasteurized liquid is concentrated to obtain a more concentrated postbiotic liquid.
[0108] 3) Preparation of BL-16 post-biotic powder Freeze-drying: The concentrated epigenetic liquid is processed using a freeze dryer to remove moisture, yielding epigenetic powder. Low temperatures are maintained during freeze-drying to ensure the active ingredients of the epigenetic are not destroyed.
[0109] Spray drying: Add 5%-10% of the concentrated post-fermentation liquid and a composite protective agent to the fermentation broth, stirring until completely dissolved. Then perform spray drying: inlet air temperature 120-140℃, outlet air temperature 55-65℃, ensuring instantaneous drying of the droplets. The feed rate is adjusted according to the equipment capacity (usually 5-15 mL / min) to ensure uniform atomization and prevent droplet sticking. The atomization pressure is 0.2-0.4 MPa, causing the fermentation broth to form fine droplets of 10-100 μm, increasing the contact area with hot air. Collect BL-16 post-fermentation powder from the bottom of the drying tower and the cyclone separator to avoid prolonged exposure to air and moisture absorption. Sieve through an 80-100 mesh sieve to remove agglomerated particles and ensure uniform product particle size. Store in a dry environment (relative humidity <60%), sealed in an aluminum foil bag, protected from light and refrigerated (4-8℃).
[0110] 4) Detection of viable bacteria count after BL-16 The BL-16 postbiotic liquid or powder obtained by the above method was tested by the streak plate method and found to contain no live bacteria.
[0111] Example 4: Animal experiment on the promotion of bone growth by BL-16 post-biotic (W16) 1. Material preparation Fermentation substrate (Fs): The fermentation substrate was a mixture (1:1) of Astragalus extract and basic fermentation substrate, wherein the concentration of Astragalus extract (prepared by the same method as in Example 3) was 1 g / mL. 1 g / mL Astragalus extract was mixed with an equal volume of sterile MRS medium to serve as the fermentation substrate (Fs) for BL-16.
[0112] BL-16 postbiotic (W16): The BL-16 strain was revived and subcultured twice to activate it. It was then added to the fermentation substrate (Fs) at a 10% inoculum and anaerobic fermented at 37°C for 36 hours. After fermentation, it was pasteurized (65°C, 30 minutes) to prepare BL-16 postbiotic (WISYNBIO-16, abbreviated as W16).
[0113] 2. Animal experiments with BL-16 postbiotics 1) Experimental Grouping Thirty-two 3-week-old male SD rats (Beijing Spef Biotechnology Co., Ltd.) were housed in specific pathogen-free (SPF) animal enclosures under a 12 / 12-hour light cycle, at a room temperature of 22±1℃ and humidity of 60%, with free access to food and water. After 7 days of acclimatization, they were randomly divided into 4 groups of 8 rats each, and received the intervention shown in the table below once daily. The specific groupings are as follows: Table 4 Experimental Groups
[0114] During the experiment, the weight of each rat was recorded. After 14 days of intervention, the eyes of the anesthetized rats were removed and blood samples were collected. Serum samples were obtained by centrifugation at 5000 rpm for 10 minutes at 4°C. Brain tissue was separated by perfusion of physiological saline through the heart. At the same time, cecal tissue, tibia and 3rd, 4th and 5th sections of the spine were collected and stored at -80°C.
[0115] 2) BL-16 post-genetic agents promote bone growth Experimental methods: Body length measurement: The body length (cm) of each rat was measured with a ruler on days 1, 6, 11 and 15. Body length was defined as the distance from the tip of the rat’s nose to its anus. The Lee index was calculated using the formula: Lee index = (body weight × 1000)^(1 / 3) / body length (cm).
[0116] Bone length measurement: Remove excess tissue with tweezers and a blade, and take complete left and right tibias with the upper and lower growth plates intact. Measure the length (cm) of the left and right tibias with a ruler.
[0117] result: The test results showed that, two weeks after the intervention, compared with the NC group, the body length and femur length of rats in the post-treatment group (W16) injected with human growth hormone (hGH) and Bifidobacterium lactis subsp. BL-16 were significantly increased. Figure 3 A- Figure 3 (C) The FS group contains the active ingredient of Astragalus membranaceus, which also has a partial promoting effect on height increase. In terms of weight, the hGH, FS, and W16 groups all showed significant increases, with the W16 group showing a slightly lower increase than the hGH group. Figure 3 D- Figure 3 The Lee index, used to assess obesity in adult rats, showed no significant difference among the four groups (E). Figure 3 (F in the middle).
[0118] 3) BL-16 post-genetic upregulates bone growth gene expression Experimental methods: Serum IGF-1, insulin, and liver IGF-1 levels were measured using the IGF-1 ELISA kit and the INS ELISA kit (Jiangsu Meimian Industrial Co., Ltd.) according to the manufacturer's instructions.
[0119] RNA extraction and real-time quantitative reverse transcription PCR (RT-qPCR) were performed. Total RNA was extracted from bone and liver using TRIzol reagent (Thermo Fisher Scientific, 15596026). Quantification was performed by RT-qPCR using specific forward and reverse PCR primers. IGF-1 , alp and trapThe relative expression. Primers are as follows: IGF-1 : Forward 5'-GCTTGCTCACCTTTACCAGC-3' (SEQ ID NO:4); Reverse 5'-AAGTTG TACTTCCTTCTGAGTCT-3' (SEQ ID NO:5). alp: Forward 5'-GACGGTGAACGGGAGAAC-3' (SEQ ID NO:6); Reverse 5'-GACGGTGAACGGGAGAAC-3' (SEQ ID NO:7). trap: Forward 5'-CGCCAGAACCGTGCAGA-3' (SEQ ID NO:8); Reverse 5'-TCAGGCTGCTGGCTGAC-3' (SEQ ID NO:9). β-actin: Forward 5'-CCTGTACGCCAACACAGTGC-3' (SEQ ID NO:10); Reverse 5'-ATACTCCTGCTTGCTGATCC-3' (SEQ ID NO:11).
[0120] Real-time PCR amplification was performed on an Applied Biosystems quantitative PCR system (Boritech, Hangzhou, China). All reactions were performed in triplicate. The PCR cycling parameters were as follows: 95°C pre-denaturation for 5 minutes; followed by 40 cycles of 95°C denaturation for 15 seconds and 60°C annealing / extension for 30 seconds. Melting curves were generated after cycling to verify the specificity of the amplified products.
[0121] The relative gene expression levels were compared using the Ct method (2). ΔΔCt) was used for calculation, and the data were standardized to the expression level of the stable internal reference gene β-actin.
[0122] Test results: The results show that hGH, fermentation substrate FS, and BL-16 The post-gene (W16) upregulated IGF-1 gene expression in both bone and liver tissues. The effects, ranked from highest to lowest, are as follows: hGH >BL-16 Post-natal > Fermentation substrate FS ( Figure 4 A in Figure 4 (B in the text). The results show that using hGH, BL-16 Following intervention with post-biotics and FS, plasma and liver IGF-1 levels also significantly increased. BL-16 The enhancing effect of the postgene group is similar to that of the hGH group ( Figure 4 C- Figure 4 (D in the text). As an early marker of osteogenic differentiation, hGH, FS, and... compared to control rats... BL-16 The post-genetic group significantly enhanced alp Gene expression. BL-16 The promoting effect of metagenes is similar to that of hGH (E in Figure 4). Trap is a lytic enzyme responsible for bone resorption and a functional marker of osteoclasts. When using hGH, FS, and... BL-16 After metastasis, the level of mRNA in bone decreased significantly. Figure 4 (F in the text). These results indicate that... BL-16 The metabiotic significantly promoted the expression of genes related to skeletal development, thereby promoting the growth of rats.
[0123] 4) BL-16 postbiotic can reduce insulin resistance in juvenile rats and improve blood glucose levels. Experimental methods: According to the manufacturer's instructions, fasting blood glucose levels in rats that had been fasted for 12 hours were measured using a commercial kit (Nanjing Jiancheng). Insulin levels were measured using a commercial kit (Jiangsu Meimian Industrial Co., Ltd.).
[0124] Experimental results: Compared with the NC group, hGH significantly increased fasting blood glucose and serum insulin levels. Figure 5 A in Figure 5 (B in the text). Conversely, neither the unfermented astragalus substrate FS group nor the post-fermented astragalus glutamate W16 group affected fasting blood glucose levels. Although the FS group did increase serum insulin, this effect was less significant than that of hGH ( Figure 5 A in Figure 5 (B in the text) indicates that while BL-16 post-genetic agents promote bone growth, they do not cause insulin resistance associated with hGH.
[0125] 5) BL-16 post-genetic alters neurotransmitter levels Experimental methods: The levels of twelve neurotransmitters, including dopamine, 3-methoxytyramine, tryptophan, methyladrenaline, histamine, (-)-norepinephrine, γ-aminobutyric acid, tyramine, 5-hydroxytryptamine, agamma-gamma, (±)-adrenaline, and (±)-octopamine, were measured using a Waters ACQUITY UPLC BEH C8 column (2.1 × 100 mm, 1.7 μm) on a triple quadrupole mass spectrometer (Thermo Fisher Scientific, USA).
[0126] The analytical conditions were as follows: mobile phase A consisted of 0.004% formic acid and 5 mM ammonium bicarbonate, and mobile phase B consisted of 0.16% formic acid and 2 mM ammonium formate. The gradient conditions were: 0–2 min 7% B, 2–5 min 22% B, 5–8.5 min 30% B, 8.5–8.6 min 45% B, 8.6–12.1 min 95% B, 12.1–15 min 7% B; flow rate 0.5 mL / min; column temperature 50 °C; and injection volume 1 μL. The mass spectrometry parameters were: capillary voltage 4000 V, source temperature 130 °C, desolvation temperature 300 °C, desolvation gas N2 (flow rate 10 L / min), and collision gas Ar (flow rate 0.15 mL / min).
[0127] Test results: The test results showed that only 7 out of 12 neurotransmitters were detected: dopamine, 3-methoxytyramine, tryptophan, methoxyadrenaline, histamine, (-)-norepinephrine, and γ-aminobutyric acid (GABA). Figure 6 As can be seen, hGH had no effect on these seven neurotransmitters. The W16 group significantly increased dopamine levels (A in Figure 6). Furthermore, the FS group significantly decreased 3-methoxytyramine and tryptophan levels, while the W16 group significantly reversed these changes. Figure 6 B- Figure 6 (C in the text). Conversely, the FS group showed a significant increase in methotrexate and histamine, while the W16 group showed a significant decrease in methotrexate and histamine levels (C in the text). Figure 6 E in Figure 6 (G) There were no significant differences in (-)-norepinephrine and γ-aminobutyric acid levels among the four groups. Figure 6 D in Figure 6 (F in the middle).
[0128] 6) BL-16 postbiotic alters gut microbiota in juvenile rats Experimental methods: Full-length 16S rRNA gene sequencing and analysis Rat fecal samples were immediately frozen in liquid nitrogen and then stored at -80°C. Total DNA was extracted using the QIAamp DNA Stool Mini Kit (Qiagen, Valencia, CA, USA) according to previously reported methods (Qiao JY, Chen R, Wang MJ, Bai R, Cui XJ, Liu Y, et al. Perturbation of gutmicrobiota plays an important role in micro / nanoplastics-induced gut barrierdysfunction. Nanoscale. 2021;13(19):8806-16.). The V1-V9 region of the 16S rRNA gene was amplified using barcoded specific primers, and PCR was performed using TransStart® FastPfu DNA polymerase (TransGenBiotech) (Yang Y, Zhao X, Xie Y, Wu C. Modulative effect of Physalisalkekengi on both gut bacterial and fungal micro-ecosystem. Chin Herb Med.2023;15(4):564-73.). PCR products were then pooled at an isodense ratio and purified using the QIAquick@GelExtraction Kit (QIAGEN). Sequencing libraries were subsequently constructed using the SMRTbell™ Template Prep Kit (PacBio) according to the manufacturer's protocol. To assess library quality, a Qubit@2.0 fluorometer (Thermo Scientific) and a FEMTO Pulse system were used. Sequencing was performed on the PacBio Sequel platform, and data analysis was conducted using bioinformatics methods.
[0129] Bioinformatics analysis methods are as follows: The raw sequencing sequences were initially processed using PacBio SMRT Portal, and sequences with a cycle consistency accuracy below 90% were identified as noise sequences. Amplicon trimming was performed on the PacBio platform, removing sequences exceeding the 1340-1640 bp range. Chimeric sequences were detected using the UCHIME algorithm. Sequence analysis was performed using Uparse software (v7.0.1001), clustering sequences with similarity ≥97% into one operational taxonomic unit (OTU). Species classification and annotation were performed based on the Mothur algorithm and referencing the small subunit ribosomal RNA database of the Silva database (version 138.1). α- and β-diversity of the bacterial community were calculated using QIIME software (v1.9.1), and visualized using R software (v4.2.3). Species with significant differences (Yang Y, Lu W, Zhang X, Wu C. Gut fungi differentially respond to the antipyretic) were selected based on P < 0.05 and fold change > 2. (heat-clearing) and diaphoretic (exterior-releasing) traditional Chinese medicines in Coptis chinensis-conditioned gut microbiota. Front Pharmacol. 2022;13:1032919.).
[0130] Experimental results: The α diversity represented by the Chao1 and Shannon indices did not change significantly among the four groups. Figure 7 A- Figure 7 (B in the original text). Principal coordinate analysis (PCoA) showed no significant differences in microbial structure among the NC, hGH, and FS groups. Only the second principal component (PC2) showed a significant difference between the NC and W16 groups. Figure 7 (C in the middle).
[0131] At the phylum level, hGH intervention increased Firmicutes while decreasing Bacteroidetes and Actinomycetes. These changes were significantly reversed in the FS and W16 groups, which had structures similar to the NC group. Figure 7 (D in the middle).
[0132] At the genus level, compared to the NC group, *Lactobacillus* showed a slight increase in the hGH and FS groups, but a significant increase in the FS group. *Eisenbergiella* showed the opposite trend, decreasing in the hGH and FS groups, but increasing in the W16 group. Compared to the NC group, Romboutsia Increased in all three treatment groups. Compared with the NC and hGH groups, Ligilactobacillus and Blautia Reduced in the FS group and W16 group (E in Figure 7).
[0133] Comparative analysis showed that interventions with hGH, FS, and W16 increased [the risk of infection / proliferation]. Romboutsia ilealis and Lactobacillus intestinalis Species such as Ligilacttobacillus were inhibited. murinus and Prevotella sp002251295 (F in Figure 7).
[0134] Compared with the NC group, hGH, FS, and W16 interventions upregulated 7, 8, and 9 species, respectively, and downregulated 26, 12, and 11 species, respectively. Figure 8 A- Figure 8 (C in the text). Specifically, hGH increases Bittarella Massiliensis , Blautia stercoris , Lactobacillus kefiranofaciens , Lactobacillus sp007570935 , Lactobacillus Enteris , Lachnospira eligens_A The quantity was reduced at the same time. Megasphaera Massiliensis , Sutcliffiella cohnii , Alistipes putredinis and Prevotella quantity sp002298815 , Psychrobacter ciconiae wait.( Figure 8 (D in the middle).
[0135] FS intervention significantly increased the levels of *Factobacillus skatole*, *Lactobacillus masiliforme*, rodents, *Lactobacillus helveticus*, *Lactobacillus kefirizine*, and *Lactobacillus*. sp007570935 The presence of [this bacteria] also reduces Akkermansia mucinidia. Bacteroides faecinchillae , Afipia broomeae Bifidobacterium adolescentis Lacrimispora indolis , Phocaeicola vulgatus , Lysinibacillus xylanilyticus wait. ( Figure 8 (E in the text). W16 intervention is beneficial to the species Lactobacillus and Lactobacillus. sp007570935It inhibited the growth of *Bacillus brevis*, *Lactobacillus helveticus*, *Vibrio cellulose*, *Pseudomonas thermophilus*, and *Lactobacillus enterica*, but suppressed *Bacillus azadirachtinus* A, *Psychrophilus storkia*, *Ackermania murineis*, *Bryanella marveneseella* sp900066075, *Lactobacillus murineis*, *Bacteroides acetaminophen* sp002298815, *Pseudomonas medalis*, *Helicobacter rhodospirillum* A, and *Acinetobacter aeruginosa* sp009936055. Figure 8 (F in the middle).
[0136] 7) BL-16 postbiotics alter gut microbiota metabolism Analysis method: The above microbial sequencing data were used to predict the metabolic capacity of the gut microbiota using PICRUSt2 bioinformatics software.
[0137] Analysis results: KEGG pathway annotation showed that the identified pathways are mainly related to metabolism, including amino acid metabolism, carbohydrate metabolism, energy metabolism, lipid metabolism, and glycan biosynthesis and metabolism. Figure 9 ).
[0138] 8) Component analysis of BL-16 before and after fermentation Experimental methods: To investigate the material basis of osteogenic activity of FS and W16, UPLC-Q-TOF / MS was used for component detection and identification. Figures 10-11 Gradient elution (mobile phase A: ultrapure water (containing 0.5% formic acid); mobile phase B: acetonitrile, flow rate 0.4 ml / min, column temperature 35 °C), mass spectrometry conditions: electrospray ionization (ESI), data acquisition in both positive and negative ion modes. Ion source temperature 600 °C, nebulizer gas pressure 60 psi, auxiliary gas pressure 60 psi, curtain gas pressure 35 psi. Primary mass spectrometry acquisition range: m / z 50–1200, accumulation time 0.1 s, declustering voltage ±80 V, collision energy ±10 eV. Secondary mass spectrometry was acquired using information correlation acquisition mode (IDA), acquisition range: m / z 25–1000, accumulation time 0.035 s, declustering voltage ±60 V, collision energy ±40 eV.
[0139] Results: This study identified 85 metabolites before fermentation and 107 metabolites after fermentation. The BL-16 fermentation process significantly altered the metabolite composition of the samples, showing a significant increase in metabolite types and chemical diversity. Metabolites specifically accumulated after fermentation were mainly enriched in flavonoids (such as genistein, baicalin, and hyperoside), phenolic acids (such as ferulic acid and sinapyl alcohol), and lipid metabolites (such as phytosphingosine and linolenic acid). This suggests that fermentation may enhance the bioactivity of products by activating the phenylpropanoid metabolic pathway, promoting the release of cell wall-derived compounds, and regulating membrane lipid remodeling. In contrast, metabolites specific to the pre-fermentation stage were mainly sugars (such as stachyose and maltotriose) and early intermediate metabolites (such as glycerophosphate choline). It is speculated that these metabolites were preferentially used as carbon sources or energy substrates by microorganisms during fermentation. Common metabolites such as choline, gluconic acid, proline, and ursolic acid remained stable before and after fermentation, indicating their continuous role in basal metabolic regulation. In summary, BL-16 fermentation not only enriched the chemical structure types of metabolites, but also induced the generation of a variety of secondary metabolites with potential functional activities, providing an important material basis for subsequent research on functional mechanisms.
[0140] Comparative experiment of growth promotion of BL-16 metagener and metagener of the same strain 1. Experimental Materials Control strain: 1) Bifidobacterium animalis subsp. lactis BB12; 2) The animal Bifidobacterium lactis subsp. preserved in this laboratory are strain numbers S153, S53, S20, S61, BL-10, BL-11, and BL-27, respectively.
[0141] Test samples: Following the same process as in Example 3 of this invention, the post-generics of fermented Astragalus membranaceus of the above control strains were prepared and were respectively designated as S153W, S53W, S20W, S61W, BL10W, BL11W, and BL27W; the post-generic of Bifidobacterium lactis subsp. BL-16 of this invention was designated as W16; the BL-16 group was prepared by centrifuging BL-16 after FS fermentation and preparing a bacterial suspension.
[0142] Experimental animals: 3-week-old male SD rats, 8 rats per group, intervention dose of 500 mg / kg, experimental period of 14 days.
[0143] 2. Test Methods The experimental method was completely consistent with Example 4 of this invention. The experiment was repeated with the addition of a Bifidobacterium lactis postbiotic control strain group and a BL-16 live bacteria group (5...). 10 9 CFU / animal / day was used to measure body length growth in order to compare the bone-promoting effects of different strains of metatrophic agents.
[0144] 3. Result Comparison The promoting effect of different strains of fermented Astragalus membranaceus on the growth of rat body length, such as Figure 12 As shown in the figure, only the comparison with the NC group is shown (P < 0.01). The results of the analysis showed even greater significance. The body length increase in the blank control group (NC) was approximately 4.6 cm, while the body length increase in the positive control group (hGH, human growth hormone) was approximately 6.1 cm, indicating that hGH has a significant growth-promoting effect (P < 0.001 compared to the NC group). The body length increase of the Astragalus fermentation substrate group (FS) was approximately 5.3 cm, which was higher than that of the NC group (P < 0.05), but lower than that of the hGH group (P < 0.05) and the post-generic group W16 (P < 0.05). In contrast, the body length increase of the Astragalus fermentation post-generic group (W16) of the BL-16 strain of this invention was approximately 6.0 cm, which was not significantly different from that of the hGH group (P > 0.05) and was significantly higher than that of the NC group (P < 0.001). It was significantly superior to FS, BL-16 live bacteria group and other postbiotic groups tested (such as S20W, S153W, etc., P<0.05).
[0145] The above results indicate that the patented strain of the present invention fermented with Astragalus membranaceus metagener (W16) can effectively promote the growth of model organisms. Its growth-promoting activity is comparable to that of the positive control hGH and is significantly superior to that of Astragalus membranaceus fermentation substrate and other metageners, showing good application prospects in the field of promoting bone growth.
[0146] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A subspecies of Bifidobacterium lactis ( Bifidobacterium animalis subsp. Lactis BL-16, characterized in that, The preservation number of Bifidobacterium lactis subspecies BL-16 is CGMCC No. 32050.
2. A microbial agent, characterized in that, The bacterial agent includes Bifidobacterium lactis subsp. BL-16 as described in claim 1.
3. The preparation of Bifidobacterium animalis subsp. lactis BL-16 according to claim 1, characterized in that, include: Fermentation broth, fermentation broth precipitate, fermentation broth supernatant, live bacteria, inactivated bacteria, lyophilized powder, lysate, lysate, secondary metabolites, exosomes.
4. The preparation of Bifidobacterium animalis subsp. lactis BL-16 according to claim 3, characterized in that, The preparation of Bifidobacterium animalis subsp. lactis BL-16 is a postbiotic of Bifidobacterium animalis subsp. lactis BL-16, and the preparation method is as follows: After activation, Bifidobacterium animalis subsp. lactis BL-16 was inoculated into the fermentation substrate and anaerobic fermented. After fermentation, it was pasteurized to obtain Bifidobacterium animalis subsp. lactis BL-16 postbiotic. The fermentation substrate is a mixture of Astragalus membranaceus extract and a basic fermentation substrate; Soak Astragalus membranaceus in 5-10 times its volume of water and extract at 90-100℃ for 60-80 min. Filter the extract and extract the residue again with 5-10 times its volume of water at 90-100℃ for 40-50 min. Combine the filtrates and concentrate to obtain Astragalus membranaceus extract.
5. A composition comprising Bifidobacterium animalis subsp. lactis BL-16 as described in claim 1, or the bacterial agent as described in claim 2, or the preparation as described in any one of claims 3-4.
6. The composition according to claim 5, characterized in that, The composition described herein has the function of promoting bone development.
7. The composition according to claim 6, characterized in that, The composition has any one or more of the following functions: (1) Increase body length and femur length; (2) Increase weight without causing Lee , The increase of the s-index; (3) Upregulate IGF-1 and ALP expression levels, and reduce trap expression levels; (4) Maintain fasting blood glucose at a normal level; (5) Increased levels of dopamine, 3-methoxytyramine and tryptophan, and decreased levels of methoxyadrenaline and histamine; (6) Regulates intestinal flora; (7) It alters the metabolism of gut microbiota.
8. The composition according to claim 5, characterized in that, The composition has any one or more of the following functions: (1) Promotes bone growth; (2) Promotes growth and weight gain without causing obesity; (3) Regulates the expression of bone metabolism-related genes, positively regulating osteogenic genes and negatively regulating osteoclast-related genes; (4) Promotes bone growth and has no insulin resistance; (5) It regulates the expression of key neurotransmitters, upregulates the levels of dopamine and tryptophan neurotransmitters, and downregulates the levels of methoxyadrenaline and histamine neurotransmitters; (6) Reconstructing the composition of gut microbiota and regulating the abundance and diversity of gut microbiota; (7) Regulate the metabolic pathways of gut microbiota.
9. The composition according to claim 5, characterized in that, It also includes excipients, which are selected from any one or more of diluents, excipients, fillers, disintegrants, solubilizers, osmotic pressure regulators, surfactants, pH regulators, and antioxidants; the composition is in any one or more of the following forms: powder, tablet, emulsion, pill, ointment, powder, lyophilized powder for injection, gel, drops, tincture, capsule, granule, or aerosol.
10. The use of the animal Bifidobacterium lactis subsp. BL-16 according to claim 1, or the bacterial agent according to claim 2, or the preparation according to any one of claims 3-4, in the preparation of a composition having a bone-promoting function.
Citation Information
Patent Citations
Application of bifidobacterium animalis subsp. Lactis CP-9 in preparation of product for promoting bone growth and development or improving bone health
CN120458269A