A genetically engineered strain for synthesizing indigo from glucose and a construction method and application thereof
By constructing genetically engineered strains, indigo can be directly synthesized from glucose, solving the problems of high cost and complex processes caused by dependence on tryptophan substrates in existing technologies, and realizing efficient and low-cost production of indigo.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- VERTEXYN (NANJING) BIOWORKS CO LTD
- Filing Date
- 2026-04-09
- Publication Date
- 2026-06-30
AI Technical Summary
Existing biosynthetic indigo technology relies on tryptophan substrates, resulting in high production costs and complex processes, which is detrimental to the industrialization of indigo.
A genetically engineered strain was constructed to overexpress the α subunit of indole-3-glycerol phosphate lyase derived from plants, bacterial mono/dioxygenases, and tryptophan synthase. By knocking out the genes of phenylalanine synthase and tyrosine synthase, the tryptophan pathway was optimized, enabling the direct synthesis of indigo from glucose and avoiding the use of tryptophan.
This technology enables the efficient production of indigo from glucose without the addition of tryptophan substrate, reducing production costs, simplifying the process, and promoting the industrial production of indigo.
Smart Images

Figure CN122303119A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and relates to a genetically engineered strain that synthesizes indigo using glucose, its construction method, and its application. Background Technology
[0002] Indigo is a dark indole-based dye, primarily extracted from plants such as Polygonum tinctorium and Isatis indigotica. It is one of the earliest natural dyes discovered by humankind. Its use as a textile dye can be traced back to at least 2500 BC, and it is currently widely used in coloring food, medicine, printing and dyeing, and daily cosmetics.
[0003] Currently, there are three main methods for producing indigo: plant extraction, chemical synthesis, and microbial transformation. Plants have a long growth cycle, the extraction process is complex, and yields are low. While chemical synthesis offers advantages such as high efficiency, high product purity, and simplicity, the materials, catalysts, and byproducts used in chemical synthesis have a certain degree of toxicity. Because indigo products are needed in food, cosmetics, clothing, and medical applications, and are highly integrated into daily life, green and safe biosynthetic solutions are attracting significant attention.
[0004] Since the first report of microbial synthesis of indigo, the exploration of microbial transformation of indigo has never ceased. For example, some researchers, through metabolic engineering and membrane engineering optimization, have achieved a yield of 3.9 g / L indigo in a 5 L fermenter by introducing flavin monooxygenase (FMO) and supplementing with an additional 8 g / L tryptophan. Other researchers have used a dual-enzyme cascade to catalyze the conversion of L-tryptophan to indigo, achieving a yield of 1.288 g / L indigo in a 5 L fermenter, with a conversion rate of 0.86 mg / mg L-tryptophan. CN119776249A discloses a method for constructing a genetically engineered strain that produces high-yield indigo, and a fermentation method thereof. Using *E. coli* as the starting strain, at least one gene from the host cell, either yddG, trpR, tyrA, or pheA, is knocked out. The tryptophanase gene tnaA and / or the flavin monooxygenase gene MaFMO are integrated into the genome. Simultaneously, one or more genes related to biofilm modification are integrated into the genome to obtain the genetically engineered strain. Using glycerol or glucose as the carbon source and tryptophan as the substrate, the genetically engineered strain is fermented to produce indigo.
[0005] Current reports on high-yield biosynthesis of indigo mainly rely on tryptophan substrate catalysis. This not only increases the production cost of indigo, but the low solubility of tryptophan also complicates the production process, hindering large-scale industrial development. Therefore, developing a technological solution for the efficient biosynthesis of indigo from glucose is of great significance to the indigo production sector. Summary of the Invention
[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a genetically engineered strain that synthesizes indigo using glucose, along with its construction method and applications, aiming to achieve direct and efficient biosynthesis of indigo using glucose and other biomaterials, avoiding the use of tryptophan substrates.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a genetically engineered strain that synthesizes indigo from glucose, wherein the genetically engineered strain overexpresses the α subunit of indole-3-glycerol phosphate lyase derived from plants, mono / dioxygenase derived from bacteria, and tryptophan synthase; wherein the plant includes any one of rice, wheat, or corn, and the mono / dioxygenase includes any one of flavin monooxygenase from methylphage, naphthalene dioxygenase from Pseudomonas, or styrene monooxygenase from Pseudomonas.
[0008] In this invention, exogenous indole-3-glycerol phosphate lyase and methyl-xanthophyll monooxygenase are expressed in the strain to promote the formation of indole and simultaneously promote the hydroxylation of indole to indophenol. Indophenol is further oxidized to form indigo, thus realizing the production of indigo from glucose through complete metabolism without the addition of tryptophan substrate, providing a new approach for low-cost production of indigo.
[0009] Optionally, the indole-3-glycerol phosphate lyase is an indole-3-glycerol phosphate lyase derived from wheat; alternatively, the mono / dioxygenase is a flavin monooxygenase derived from methylphage.
[0010] Optionally, the present invention uses wheat Triticum aestivum The enzymes include indole-3-glycerol phosphate lyase (IGL), methyl-emodin monooxygenase (FMO) from Pseudomonas aliformis DSM 6083, and the α subunit (trpA) of tryptophan synthase from Escherichia coli.
[0011] Optionally, the nucleic acid sequence of the indole-3-glycerol phosphate lyase includes the sequence described in SEQ ID NO.5.
[0012] Optionally, the nucleic acid sequence of the flavin monooxygenase includes the sequence described in SEQ ID NO. 6.
[0013] Optionally, the nucleic acid sequence of the gene for the α subunit of the tryptophan synthase includes the sequence shown in SEQ ID NO.8.
[0014] Optionally, the starting strain of the genetically engineered strain includes *Escherichia coli* (E. coli). Escherichia coli ).
[0015] Optionally, the *E. coli* includes *E. coli* BL21.
[0016] Optionally, the genetically engineered strain may lack the pheA and tyrA genes.
[0017] In this invention, the tryptophan pathway is enhanced by simultaneously knocking out the phenylalanine synthase gene pheA and the tyrosine synthase gene tyrA, thereby further increasing indigo yield.
[0018] Optionally, the genetically engineered strain also overexpresses the trpE gene.
[0019] Optionally, the nucleic acid sequence of the trpE gene includes the sequence shown in SEQ ID NO.1.
[0020] In this invention, the trpE gene (ES40F mutation) is optimized for overexpression to relieve trpE feedback inhibition and further increase indigo yield.
[0021] Optionally, the genetically engineered strain also overexpresses aroG. fbr Gene.
[0022] Optionally, the aroG fbr The nucleic acid sequence of the gene includes the sequence shown in SEQ ID NO.2.
[0023] In this invention, aroG is optimized fbr Overexpression of the gene (S180F mutation) relieved aroG feedback inhibition and further increased indigo yield.
[0024] Optionally, the genetically engineered strain also overexpresses the xfpk gene.
[0025] Optionally, the nucleic acid sequence of the xfpk gene includes the sequence shown in SEQ ID NO.3.
[0026] In this invention, the phosphotransketolase gene xfpk is overexpressed to enhance metabolic flux and further increase indigo yield.
[0027] Optionally, the genetically engineered strain also overexpresses the pck gene.
[0028] Optionally, the nucleic acid sequence of the pck gene includes the sequence shown in SEQ ID NO.4.
[0029] In this invention, overexpression of the phosphoenolpyruvate carboxykinase gene pck enhances metabolic flux and further increases indigo yield.
[0030] Optionally, the genetically engineered strain also overexpresses the katE gene.
[0031] In this invention, overexpression of the catalase gene KatE reduces the damage caused by harmful substances formed by oxidative stress in cells during product generation, thereby further increasing indigo yield.
[0032] In a second aspect, the present invention provides a method for constructing the genetically engineered strain that synthesizes indigo using glucose as described in the first aspect, the method comprising: The gene sequences of the indole-3-glycerol phosphate lyase derived from plants, the mono / dioxygenase derived from bacteria, and the α subunit of tryptophan synthase were inserted into an expression vector to obtain a recombinant vector. The recombinant vector was then transformed into the starting strain to obtain the genetically engineered strain.
[0033] Optionally, the method further includes knocking out the pheA gene and tyrA gene in the starting strain, or overexpressing trpE and aroG. fbr The xfpk, pck, or katE gene.
[0034] It is understood that, based on the genetic modification strategy designed in this invention, and using genetic modification methods commonly used in the field, it is theoretically possible to obtain genetically engineered strains with similar performance.
[0035] Thirdly, the present invention provides the application of the genetically engineered strain that synthesizes indigo using glucose as described in the first aspect in the production of indigo.
[0036] Fourthly, the present invention provides a method for producing indigo, the method comprising: The genetically engineered strain that synthesizes indigo from glucose as described in the first aspect is cultured, and the product is purified to obtain indigo.
[0037] The present invention constructs a genetically engineered bacterial strain for producing indigo, which can further develop methods for producing indigo. In addition, the genetically engineered strain can realize the production of indigo using the complete metabolism of glucose, and can develop a production method without tryptophan addition, further reducing costs, simplifying the process, and promoting the industrial production of indigo.
[0038] Optionally, the culture medium contains tryptone, yeast extract, Na2HPO4, KH2PO4, Na2SO4, MgSO4·7H2O, trace elements, glycerol, glucose, and L-arabinose.
[0039] Compared with the prior art, the present invention has at least the following beneficial effects: This invention designs a non-tryptophan-dependent genetic modification strategy to construct a genetically engineered strain that can directly synthesize indigo in vivo using glucose as a substrate. Furthermore, it designs a genetic modification strategy to increase indigo yield, achieving efficient indigo production using glucose as a substrate, further reducing costs, simplifying the process, and promoting the industrial production of indigo. Attached Figure Description
[0040] Figure 1 This is a schematic diagram of a genetic modification strategy.
[0041] Figure 2 This is a standard curve graph for indigo.
[0042] Figure 3 This is a graph showing the liquid phase detection results of the fermentation broth. Detailed Implementation
[0043] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.
[0044] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.
[0045] The main strains and reagents in the specific embodiments of this invention are as follows.
[0046] Escherichia coli DH5α (hereinafter referred to as DH5α), Escherichia coli BL21 (hereinafter referred to as BL21), Corynebacterium glutamicum 13032, etc. can all be purchased commercially. DH5α is used for vector construction, and BL21 is used for plasmid expression.
[0047] Plasmids pTarget and pCas9 were purchased from BioWind.
[0048] The 95S plasmid backbone was derived from CN116064363A. Using the constructed 95S-glnA plasmid as a template, the 95S plasmid backbone was obtained by PCR amplification using 95S-F and 95S-R primers.
[0049] High-fidelity DNA polymerase, restriction endonuclease, and In-Fusion® Snap Assembly Master Mix were purchased from TAKARA.
[0050] Plasmid extraction kit, DNA purification kit, gel extraction kit, and bacterial genomic DNA extraction kit were purchased from OMEGA.
[0051] LB medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, with the remainder being water, sterilized at 121℃ for 20 min; if preparing a solid medium, add 15-20 g / L agar powder.
[0052] TB medium: 12 g / L peptone, 24 g / L yeast extract, 5.31 g / L KH2PO4, 15.54 g / L K2HP4, 0.4% v / v glycerol, balance water, sterilized at 121℃ for 20 min.
[0053] ZYM fermentation medium: 10 g / L tryptone, 5 g / L yeast extract, 3.55 g / L Na2HPO4, 3.4 g / L KH2PO4, 0.71 g / L Na2SO4, 0.5 g / L MgSO4·7H2O, 10 mL / L 100× trace elements, 0.5% v / v glycerol, 0.5 g / L glucose and 5.0 g / L L-arabinose, pH adjusted to 6.8-7.2 with NH4Cl; The formula for 100× trace elements (100× represents that the concentration of the mother liquor is 100 times the final working concentration) is as follows: 0.32 g / L CuSO4, 4.5-3.1 g / L CaCl2·2H2O, 0.32 g / L MnCl2·4H2O, 4.75 g / L ZnSO4·7H2O, 0.47 g / L CoCl2·6H2O, 5.8 g / L FeSO4·7H2O, 0.48 g / L Na2MO4·2H2O, and 80 mL / L 0.5M EDTA.
[0054] Unless otherwise specified, the plasmid transformation into E. coli DH5α in the following examples and comparative examples are all chemical transformations. The chemical transformation includes the following steps: the transformation system is added to DH5α competent cells that have been thawed on ice, incubated on ice for 30 min, then heat-shocked at 42°C for 1 min, incubated on ice again for 2 min, then 900 μL of pre-cooled LB medium is added, and incubated at 37°C and 220 rpm for 60 min; 100 μL of the incubated bacterial solution is added to LB medium containing streptomycin resistance and cultured overnight at 30°C / 37°C.
[0055] Unless otherwise specified, in the following examples and comparative examples, the method for transforming plasmids into Escherichia coli DL series engineered bacteria is electroporation. Electroporation includes the following steps: take the target fragment and add it to the corresponding DL series engineered bacteria electroporation competent cells, gently mix evenly and then add it to an electroporation cuvette, incubate on ice for 5-10 min, electroporate at 5.5 kV, quickly add pre-cooled LB liquid medium, incubate at 30°C on a shaker for 2 h, take 100 μL of bacterial solution and spread it on LB solid medium, and incubate at 30°C for 24 h; The method for preparing electrocompetent cells is as follows: (1) Pick a single colony with a pipette tip and put it into a 50 mL centrifuge tube containing 10 mL of LB liquid medium (and make a blank control for the medium and pipette tip at the same time). (2) Incubate at 37℃ and 220rpm for 14-16h. Inoculate the bacterial culture into 50mL LB liquid medium at a ratio of 1:100. Incubate at 37℃ and 220rpm for 2-3h. Measure the OD every half hour. Stop the incubation when the OD value reaches 0.6-0.8. (3) Pre-cool the bacterial solution on ice for 30 min, then aliquot the bacterial solution into 50 mL pre-cooled centrifuge cups, centrifuge at 4℃ and 4500 rpm for 10 min, discard the supernatant, suspend the precipitate in sterile water, centrifuge at 4℃ and 4500 rpm for 10 min, discard the supernatant, suspend the precipitate in 10% sterile glycerol, centrifuge at 4℃ and 4500 rpm for 10 min, discard the supernatant, add 300 μL of 10% glycerol to each centrifuge cup to suspend the precipitate, aliquot the bacterial solution into 4.5 mL centrifuge tubes at 100 μL / tube, and store in a -80℃ freezer.
[0056] Unless otherwise specified, the methods for screening and eliminating pCas plasmids in the following examples and comparative examples include the following steps: electroporated competent cells are spread on LB solid medium containing kanamycin and spectinomycin, cultured at 30°C for 24 h, and transformants are picked and colony PCR is performed using the corresponding primers for verification. After verifying positive transformants, colonies were picked and induced in LB liquid medium containing IPTG. The culture was then diluted and spread onto LB solid medium containing kanamycin. The cultures were incubated at 30°C for 12-16 hours. Single colonies were picked and inoculated into LB solid medium containing kanamycin and spectinomycin. Single colonies that grew only on kanamycin monoclonal antibody medium and did not grow on kanamycin-spectinomycin dual antibody medium were selected as strains that eliminated the sg-pTarget plasmid. The strains that eliminated the sg-pTarget plasmid were inoculated into antibiotic-free LB solid medium and cultured at 42°C until single colonies grew. Antibiotic validation was performed according to the above method. Strains that grew only on antibiotic-free LB solid medium and did not grow on kanamycin monoclonal antibody LB solid medium were considered strains that eliminated the pCas plasmid. These strains were antibiotic-free stable engineered bacteria. The final concentrations of kanamycin and spectinomycin in the above-mentioned LB solid medium were 50 μg / mL and 50 μg / mL, respectively; the final concentration of IPTG in the above-mentioned LB liquid medium was 0.1 mM.
[0057] The Gibson assembly technique (hereinafter referred to as Gibson) is performed in accordance with the following literature: Gibson, DG et al. (2009). Enzymatic assembly of DNA molecules upto several hundred kilobases. Nature Methods, 6(5), 343-344. Gibson, DG et al . (2010). Creation of a bacterial cell controlled by a chemically synthesized genome. Science, 329(5987), 52-56. Example 1 This embodiment provides a genetically engineered strain for synthesizing indigo, and the genetic modification strategy is illustrated in the diagram below. Figure 1 As shown, its construction method includes the following steps: I. Construction of engineered bacteria DL-01 1.1 Primers 800 pheAtyrA-UF, 800 pheAtyrA-UR-T1, 800 pheAtyrA-DF-T1, and 800 pheAtyrA-DR were designed based on the pheAtyrA gene sequence of Escherichia coli. The fragments pheAtyrA-UP and pheAtyrA-Down were amplified using the Escherichia coli BL21 genome as a template. The two fragments were then ligated using nested PCR with 500 pheAtyrA-UF and 500 pheAtyrA-DR as primers to obtain the pheAtyrA deletion expression cassette. 1.2 The plasmid pCas9 carrying the transport protein gene was electroporated into BL21 electroporated competent cells and plated on LB solid medium containing kanamycin resistance. The single colony that grew was BL21 / pCas. 1.3 Design pheAtyrA site sgRNA primers Sg-pheAtyrA-F and Sg-pheAtyrA-R, use pTarget plasmid as template for PCR, purify the obtained gene fragment by DpNI restriction enzyme digestion, transform it into DH5α by chemical transformation, obtain transformation product, plate the transformation product on spectinomycin LB solid medium plate, extract plasmid from the single colony and sequence it for verification, the strain with correct verification is the transformant carrying sg-pheAtyrA-pTarget plasmid; 1.4 The pheAtyrA deletion expression cassette obtained in step 1.1 and the sg-pTarget plasmid obtained in step 1.3 were electroporated into the BL21 / pCas electroporation competent cells obtained in step 1.2. After screening, colony PCR was performed using primers 800 pheAtyrA-UF and 800 pheAtyrA-DR. The empty vector BL21 / pCas electroporation competent cells were used as controls. Positive transformants were obtained by screening. The positive transformants were then treated to eliminate the sg-pheAtyrA-pTarget plasmid and pCas plasmid to obtain the non-resistant and stable pheA and tyrA knockout engineered bacteria DL-01. The primer sequences used above are shown in Table 1.
[0058] Table 1 II. Construction of engineered bacteria DL-02 2.1 Using the engineered bacteria DL-01 obtained in step 1.4 as a template, primers were used to... and S40F-R, S40F-F and PCR amplification was performed, yielding two fragments containing the trpES40F mutation site. A 95S plasmid backbone was then assembled using Gibson. Two segments, converted to DH5α, yield... Plasmid; after mutation The sequence is shown in SEQ ID NO.1; 2.2 Using the engineered bacteria DL-01 obtained in step 1.4 as a template, the ΔtrpL::trpE up fragment was amplified by PCR using 800 trpL-UR and 800 trpL-UF primers; The plasmid obtained in step 2.1 Using T2-tac / 119-F and trpL-down800R primers as templates, the ΔtrpL::trpE down fragment was amplified by PCR. 2.3 Using the ΔtrpL::trpE up fragment and ΔtrpL::trpE down fragment obtained in step 2.2 as templates, PCR amplification was performed using 500 trpL-UF and 500 trpL-UR primers with overlap extension. Expression box; 2.4 Prepare DL-01 cells obtained in step 1.4 into electrotransfer competent cells, electrotransfer plasmid pCas carrying the transport protein gene into competent cells, spread them on kanamycin-resistant LB solid medium plates, and the single colony that grows is DL-01 / pCas. 2.5 Design trpL site sgRNA primers Sg-trpL-F and Sg-trpL-R, and perform PCR using pTarget plasmid as template to prepare sg-trpL-pTarget plasmid according to the method in step 1.3; 2.6 The ΔtrpL::trpE donor expression cassette obtained in step 2.3 and the sg-trpL-pTarget plasmid obtained in step 2.5 were electroporated together into the DL-01 / pCas electroporation competent cells obtained in step 2.4. After screening, colony PCR verification was performed using 800 trpL-UF and 800 trpL-DR. The empty vector DL-02 / pCas was used as a control. Positive transformants were obtained by screening. The positive transformants were then treated to eliminate the sg-trpL-pTarget plasmid and pCas plasmid to obtain the resistant and stable trpE overexpressing engineered bacteria DL-02. The primer sequences used above are shown in Table 2.
[0059] Table 2 III. Construction of engineered bacteria DL-03 3.1 PCR amplification was performed using primers aroG-95S-F and S180F-R, and S180F-F and aroG-95S-R, respectively, yielding two fragments containing the aroG S180F mutation site. The 95S plasmid backbone was then assembled using Gibson sequencing. Two segments, converted to DH5α, yield... Plasmid; after mutation The sequence is shown in SEQ ID NO.2; 3.2 Using the engineered bacteria DL-02 obtained in step 2.6 as a template, the ΔtyrR::aroG up fragment was amplified by PCR using primers 800 tyrR-UR and 800 tyrR-UF; Using the engineered bacteria DL-02 obtained in step 2.6 as a template, the ΔtyrR::aroG down fragment was amplified by PCR using primers 800 tyrR-DF and tyrR-down800R. The result obtained in step 3.1 Using tac / 119-F1 and rrnB-R1 primers as templates, PCR amplification was performed to obtain... Fragment; 3.3 Using the ΔtyrR::aroG up fragment, ΔtyrR::aroG down fragment, and obtained in step 3.2 Using the fragment as a template, PCR amplification was performed using overlapping extension primers of 500 tyrR-UF and 500 tyrR-UR to obtain... Expression box; 3.4 Prepare DL-02 cells obtained in step 2.6 into electrotransfer competent cells, electrotransfer plasmid pCas carrying the transport protein gene into competent cells, spread them on kanamycin-resistant LB solid medium plates, and the single colony that grows is DL-02 / pCas; 3.5 Design sgRNA primers Sg-tyrR-F and Sg-tyrR-R for the tyrR site, and perform PCR using pTarget plasmid as a template to prepare sg-tyrR-pTarget plasmid according to the method in step 1.3; 3.6 The result obtained in step 3.3 The expression cassette and the sg-tyrR-pTarget plasmid obtained in step 3.5 were electroporated together into the DL-02 / pCas electroporation competent cells obtained in step 3.4. After screening, colony PCR verification was performed using 800 tyrR-UF and 800 tyrR-DR. The empty vector DL-02 / pCas was used as a control. Positive transformants were screened and then the positive transformants were treated to eliminate the sg-tyrR-pTarget plasmid and pCas plasmid to obtain the engineered bacteria DL-03 that stably overexpresses aroG without resistance. The primer sequences used above are shown in Table 3.
[0060] Table 3 IV. Construction of engineered bacteria DL-04 4.1 Based on the sequence of the Bifidobacterium phosphotransketolase gene xfpk, the target gene was optimized and synthesized. The xfpk fragment was amplified by PCR using primers xfpk-95S-F and xfpk-95S-R. The 95S plasmid backbone and the upstream and downstream fragments of xfpk were assembled using Gibson, and then transformed into DH5α to obtain the 95S-xfpk plasmid. The optimized xfpk sequence is shown in SEQ ID NO.3. 4.2 Using the engineered bacteria DL-03 obtained in step 3.6 as a template, the ΔpoxB::xfpk up fragment was amplified by PCR using 800 poxB-UR and 800 poxB-UF primers; Using the engineered bacteria DL-03 obtained in step 3.6 as a template, the ΔpoxB::xfpk down fragment was amplified by PCR using 800 poxB-DF and poxB-down800R primers. Using the 95S-xfpk obtained in step 4.1 as a template, the J23119-xfpk fragment was amplified by PCR using tac / 119-F1 and rrnB-R1 primers; 4.3 Using the ΔpoxB::xfpk up fragment, ΔpoxB::xfpk down fragment, and J23119-xfpk fragment obtained in step 4.2 as templates, the ΔpoxB::xfpk donor expression cassette was obtained by PCR amplification using 500 poxB-UF and 500 poxB-UR primer overlap extension. 4.4 Prepare DL-03 cells obtained in step 3.6 into electrotransfer competent cells, electrotransfer plasmid pCas carrying the transport protein gene into competent cells, and spread them on kanamycin-resistant LB solid medium plates. The single colony that grows is DL-03 / pCas. 4.5 Design sgRNA primers Sg-poxB-F and Sg-poxB-R for the poxB site, and perform PCR using pTarget plasmid as a template to prepare the sg-poxB-pTarget plasmid according to the method in step 1.3; 4.6 The ΔpoxB::xfpk donor expression cassette obtained in step 4.3 and the sg-poxB-pTarget plasmid obtained in step 4.5 were electroporated together into the DL-03 / pCas electroporation competent cells obtained in step 4.4. After screening, colony PCR verification was performed using 800 poxB-UF and 800 poxB-DR. The empty vector DL-03 / pCas was used as a control. Positive transformants were screened and then the sg-poxB-pTarget plasmid and pCas plasmid were eliminated from the positive transformants to obtain the resistant and stable xfpk overexpressing engineered bacteria DL-04. The primer sequences used above are shown in Table 4.
[0061] Table 4 V. Construction of engineered bacteria DL-05 5.1 Primers were designed based on the pck sequence of Corynebacterium glutamicum phosphoenolpyruvate carboxykinase. Using the genome of Corynebacterium glutamicum 13032 as a template, the pck fragment was amplified by PCR using pck-95S-F and pck-95S-R primers. The 95S plasmid backbone and upstream and downstream fragments of pck were assembled by Gibson, and then transformed into DH5α to obtain the 95S-pck plasmid. The optimized pck sequence is shown in SEQ ID NO.4. 5.2 Using the engineered bacteria DL-04 obtained in step 4.6 as a template, the ΔldhA::pck up fragment was amplified by PCR using primers 800 ldhA-UR and 800 ldhA-UF; Using the engineered bacteria DL-04 obtained in step 4.6 as a template, the ΔldhA::pck down fragment was amplified by PCR using primers 800 ldhA-DF and ldhA-down800R; Using the 95S-pck obtained in step 5.1 as a template, the J23119-pck fragment was amplified by PCR using T5 / tac / 119-F1 and rrnB-R1 primers; 5.3 Using the ΔldhA::pck up fragment, ΔldhA::pck down fragment, and J23119-pck fragment obtained in step 5.2 as templates, the ΔldhA::pckdonor expression cassette was obtained by overlapping extension PCR using 500 ldhA-UF and 500 ldhA-UR primers. 5.4 Prepare DL-04 cells obtained in step 4.6 into electrotransfer competent cells, electrotransfer plasmid pCas carrying the transport protein gene into competent cells, spread them on kanamycin-resistant LB solid medium plates, and the single colony that grows is DL-04 / pCas. 5.5 Design ldhA site sgRNA primers Sg-ldhA-F and Sg-ldhA-R, and perform PCR using pTarget plasmid as a template to prepare sg-ldhA-pTarget plasmid according to the method in step 1.3; 5.6 The ΔldhA::pck donor expression cassette obtained in step 5.3 and the sg-ldhA-pTarget plasmid obtained in step 5.5 were electroporated together into the DL-04 / pCas electroporation competent cells obtained in step 5.4. After screening, colony PCR verification was performed using 800 ldhA-UF and 800 ldhAD-R. The empty vector DL-0 / pCas was used as a control. Positive transformants were screened and then the positive transformants were treated to eliminate the sg-poxB-pTarget plasmid and pCas plasmid to obtain the engineered bacteria DL-06 that stably overexpresses pck without resistance. The primer sequences used above are shown in Table 5.
[0062] Table 5 VI. Construction of engineered bacteria DL-06 6.1 Based on the Escherichia coli catalase katE sequence, the target gene sequence (SEQ ID NO.7) was optimized and synthesized. The katE fragment was obtained by PCR amplification using katE-95S-F and katE-95S-R primers. The 95S plasmid backbone and upstream and downstream fragments of katE were assembled using Gibson, and then transformed into DH5α to obtain the 95S-katE plasmid. 6.2 Using the engineered bacteria DL-05 obtained in step 5.6 as a template, the ΔyghX::katE up fragment was amplified by PCR using primers 800 yghX-UR and 800 yghX-UF; Using the engineered bacteria DL-03 obtained in step 5.6 as a template, the ΔyghX::katE down fragment was amplified by PCR using primers 800 yghX-DF and yghX-down800R; Using the 95S-katE obtained in step 6.1 as a template, the J23119-katE fragment was amplified by PCR using T5 / tac / 119-F1 and rrnB-R1 primers; 6.3 Using the ΔyghX::katE up fragment, ΔyghX::katE down fragment, and J23119-katE fragment obtained in step 6.2 as templates, the ΔyghX::katE donor expression cassette was obtained by PCR amplification using 500 yghX-UF and 500 yghX-UR primers with overlap extension. 6.4 Prepare DL-05 cells obtained in step 5.6 into electrotransfer competent cells, electrotransfer plasmid pCas carrying the transport protein gene into competent cells, spread them on kanamycin-resistant LB solid medium plates, and the single colony that grows is DL-06 / pCas. 6.5 Design sgRNA primers Sg-yghX-F and Sg-yghX-R for the yghX site, and perform PCR using pTarget plasmid as a template to prepare the sg-yghX-pTarget plasmid according to the method in step 6.3; 6.6 The ΔyghX::katE donor expression cassette obtained in step 6.3 and the sg-yghX-pTarget plasmid obtained in step 6.5 were co-electrotransformed into the DL-0 / pCas electrotransformation competent cells obtained in step 6.4. After screening, colony PCR verification was performed using 800 yghX-UF and 800 yghX-DR, with the empty vector DL-0 / pCas as a control. Positive transformants were obtained by screening, and then the positive transformants were treated to eliminate the sg-poxB-pTarget plasmid and pCas plasmid to obtain the resistant and stable katE overexpressing engineered bacteria DL-06.
[0063] The primer sequences used above are shown in Table 6.
[0064] Table 6 VII. Construction of Expression Plasmids 7.1 Based on the indole-3-glycerol phosphate lyase (IGL) sequence from wheat, the target gene was optimized and synthesized. The IGL fragment was amplified by PCR using primers IGL-95S-F and IGL-95S-R. The 95S plasmid backbone and IGL fragment were assembled using Gibson PCR. A 10 μL ligation system was then transformed into DH5α competent cells and cultured overnight at 37°C. Positive clones were selected for PCR verification using primers YZ-F and YZ-R. Strains with the correct size were selected for sequencing verification. The successfully constructed plasmid was named 95S-IGL. The optimized IGL sequence is shown in SEQ ID NO.5. 7.2 Using the plasmid 95S-IGL constructed in step 7.1 as a template, the 95S-IGL vector backbone fragment was obtained by PCR amplification using KL-F and KL-R primers; 7.3 Based on the sequence of flavin monooxygenase (FMO) of *Pseudomonas*, the target gene was optimized and synthesized. The FMO fragment was amplified by PCR using primers FMO-95S-F and FMO-95S-R. Using the engineered strain DL-06 obtained in step 6.6 as a template, the trpA fragment (SEQ ID NO.8) was amplified by PCR using primers trpA-95S-F and trpA-95S-R. The 95S-IGL plasmid backbone, FMO, and trpA fragment were assembled using Gibson assay. A 10 μL ligation system was then transformed into DH5α competent cells and cultured overnight at 37°C. Positive clones were selected for PCR verification using primers YZ-F and YZ-R. Strains of the correct size were selected for sequencing verification. The successfully constructed plasmid was named 95S-IGL-FMO-trpA. The optimized FMO sequence is shown in SEQ ID NO.6. The primers used are shown in Table 7.
[0065] Table 7 SEQ ID NO.1:
[0066] SEQ ID NO.2:
[0067] SEQ ID NO.3:
[0068] SEQ ID NO.4:
[0069] SEQ ID NO.5: atgtctggtaacccggcaaccactgctccggctggctctctggcggaagcgccggcgccggctccggtgccggcggccgccggcgaacgcggtctgtctgtatcccaggctatgtccaaagttcgcgaaaaaggcaaaaccgctttcatcccgtacatcacggctggtgatccggacctggcaaccaccgctgctgcactgcgtctgctggatcgtctgggtgcagacgttgtggaactgggtatgccattctccgatgcgagcgcggacggtgctgttatcaaagcatctgcagctcgcgccctggcggcaggcgcgaccgcggattccattatggccatgctgaaggaagtaaccccggagctgttctgtcctgttgtgatcttcagctacttctctcctatcgtccaacgtggcacggcatccttcgcggccgctgttaaagaagccggtgtgaaaggtctgatcgttccggacctgccgtatgctgaaacctctgctttccgtgacgaagcaatcaaaaacgagctggaactggtgctgctgacgaccccgtccactccaccggaacgtatgaaagagatcactgaagcgtccggcggttttgtatacctggtgtctgttgatggcgttaccggcgcacgtgcaaccgttaatccgcgtgtcgaaagcctgctgaaagaaatcaaacaggtgaccgacaaagcggtcgcagtaggctttggtatctccactccggatcacgtcaaacagatcgctgaatggggcgcggatggtgtgattattggctccgcgatggtgaaacagctgggtgaagctgcttctccggaagaaggcctgatccgcctggaagtttacgcgcgctccctgaaaaacgctctgccataa。
[0070] SEQ ID NO.6:
[0071] SEQ ID NO.7:
[0072] SEQ ID NO.8:
[0073] Example 2 This embodiment provides a production method for fully metabolized indigo, which includes the following steps: (1) The engineered bacteria constructed in Example 1 were inoculated into LB solid medium and cultured at 30°C for 24 h. A single colony was picked and inoculated into 5 mL of LB medium and cultured at 30°C and 220 rpm for 12-16 h to obtain the primary seed culture. (2) Take 500 μL of the primary seed culture obtained in step (1) and inoculate it into 25 mL of ZYM fermentation medium containing a final concentration of 50 μg / mL kanamycin at a ratio of 1 / 100. Add 15 g / L glucose and culture at 30℃ and 225 rpm. After 24 h, supplement with 5 g / L glycerol and 0.5 g / L sorbitol to adjust osmotic pressure and improve cell membrane permeability. During the process, use ammonia water to maintain the pH between 6.6 and 7.2 and the residual sugar at 5-10 g / L. After 72 h, the indigo fermentation broth is obtained. Centrifuge and filter the shake flask fermentation broth to obtain indigo.
[0074] Example 3 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into wild-type Escherichia coli BL21, which is named DL-07.
[0075] Example 4 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-01, which is named DL-08.
[0076] Example 5 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-02, which is named DL-09.
[0077] Example 6 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-03, which is named DL-10.
[0078] Example 7 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-04, which is named DL-11.
[0079] Example 8 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-05, which is named DL-12.
[0080] Example 9 This embodiment provides an Escherichia coli strain that efficiently synthesizes indigo from glucose and its construction method. The construction method involves transforming the expression vector 95S-IGL-FMO-trpA into the engineered strain DL-06, which is named DL-13.
[0081] Comparative Example 1 Wild-type BL21 was selected as the indigo-producing strain in this comparative study.
[0082] Test case Indigo was produced using the engineered bacteria DL-07 to DL-13 from Examples 3-9 and the wild-type BL21 from Comparative Example 1, according to the method in Example 2.
[0083] Method for plotting the indigo standard curve: Weigh 1 mg of pure indigo and dissolve it in 1 mL of DMSO to obtain a 1 mg / mL standard solution. Dilute this standard solution with dimethyl sulfoxide to obtain standard solutions with different concentrations of 9.9 mg / L, 50 mg / mL, 150 mg / mL, 250 mg / mL, 350 mg / mL, and 550 mg / mL. Measure the absorbance of the corresponding concentrations of the standard solutions at 600 nm using a spectrophotometer; the absorbance values were 36, 194.4, 555.1, 942.7, 1344.3, and 2112.6, respectively. Plot the concentration of indigo on the x-axis (X) and the absorbance on the y-axis (Y) to fit an indigo standard curve, as shown below. Figure 2 As shown, y = 3.9661x - 3.8922, R 2 =0.9998 (R) 2 (It is a linear fitting constant).
[0084] High-performance liquid chromatography method for the determination of indigo culture medium: Take an appropriate amount of indigo fermentation broth and separate the bacterial cells from the supernatant by centrifugation. Use the highly polar organic solvent dimethyl sulfoxide (DMSO) to thoroughly extract the bacterial precipitate by shaking or sonication to completely dissolve the indigo. Then filter through a 0.22 μm microporous membrane to remove fine particulate matter and protect the subsequent chromatographic column.
[0085] The chromatographic column used was an Aglient Eclipse plus C18 reversed-phase column (250 mm × 4.6 mm, 5 μm). The mobile phase was methanol and 0.1% acetic acid water gradient elution. The column temperature was 35℃, the flow rate was 1.0 mL / min, the detection wavelength was 600 nm and full-band scanning was used, and the injection volume was 10 μL.
[0086] Liquid phase detection results as follows Figure 3 As shown, the product was confirmed to be indigo.
[0087] Method for determining the content of indigo in culture medium: Take 5 mL of indigo culture medium, treat it with ultrasound, and then centrifuge at 13000 rpm for 10 min to obtain a crude extract. Dissolve the crude extract in methanol and centrifuge at 13000 rpm for 10 min. Dissolve the precipitate in n-hexane and centrifuge at 13000 rpm for 10 min to obtain a pure indigo precipitate. Dissolve the precipitate in 5 mL of dimethyl sulfoxide to obtain a purified indigo liquid. Then, measure its absorbance at 600 nm using a spectrophotometer and calculate the indigo content according to the indigo standard curve.
[0088] The OD values of different samples at 600 nm were measured using a UV spectrophotometer, and the yield of indigo was calculated based on the standard curve. The results are shown in Table 8.
[0089] Table 8 As shown in Table 8, the engineered bacteria DL-07 to DL-13 of this invention can all synthesize indigo from glucose through total metabolism, with the highest total metabolic yield of indigo being 3.11 g / L. Following the indigo culture protocol in Example 2, the wild-type BL21 in Comparative Example 1 failed to change color, resulting in an indigo yield of 0. However, by introducing 95S-IGL-FMO-trpA into BL21, indigo was successfully synthesized from nothing, demonstrating that wheat-derived indole-3-glycerol phosphate lyase (IGL) can normally promote indole formation. FMO further oxidizes indole to form indigo, and the enhancement of trpA promotes indole formation.
[0090] The yield data show that strain DL08 in Example 4, through modification of the branching acid direction, weakens the formation of tyrosine and phenylalanine, and promotes the metabolic flux in the tryptophan direction, showing a significant improvement compared to Example 3. The strains in Examples 5 and 6, through targeted mutations that relieve feedback inhibition by knocking out the leader peptide genes trpL and trpE, respectively, and... Overexpression of the gene resulted in a stable increase in yield. In Examples 7 and 8, exogenous genes xfpk and pck were introduced, respectively, to improve glucose utilization efficiency and further increase yield. Example 9 addressed the problem of cellular oxidative stress-induced damage in indigo production by overexpressing catalase katE to increase the upper limit of yield, ultimately achieving a direct conversion of glucose into 3.11 g / L of indigo.
[0091] In summary, this application designed a genetic modification strategy that utilizes metabolic pathway enhancement and the integration of exogenous genes to enable Escherichia coli to produce indigo from glucose through complete metabolism. After 72 hours of shake-flask culture, the indigo yield can reach a maximum of 3.11 g / L, reducing production costs and further promoting the industrial production process.
[0092] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. A genetically engineered strain that synthesizes indigo from glucose, characterized in that, The genetically engineered bacteria overexpressed indole-3-glycerol phosphate lyase derived from plants, mono / dioxygenase derived from bacteria, and the α subunit of tryptophan synthase. The plant includes any one of rice, wheat, or corn; The mono / dioxygenase includes any one of flavin monooxygenase from methylphage, naphthalene dioxygenase from Pseudomonas, or styrene monooxygenase from Pseudomonas.
2. The genetically engineered strain that synthesizes indigo from glucose according to claim 1, characterized in that, The indole-3-glycerophosphate lyase used is an indole-3-glycerophosphate lyase derived from wheat; Optionally, the nucleic acid sequence of the indole-3-glycerol phosphate lyase gene includes the sequence described in SEQ ID NO. 5; Optionally, the mono / dioxygenase is a flavin monooxygenase derived from methylphages; Optionally, the nucleic acid sequence of the flavin monooxygenase gene includes the sequence described in SEQ ID NO. 6; Optionally, the nucleic acid sequence of the gene for the α subunit of the tryptophan synthase includes the sequence shown in SEQ ID NO. 8; Optionally, the starting strain of the genetically engineered strain includes Escherichia coli; Optionally, the *E. coli* includes *E. coli* BL21.
3. The genetically engineered strain that synthesizes indigo from glucose according to claim 1 or 2, characterized in that, The genetically engineered strain also lacks the pheA and tyrA genes.
4. The genetically engineered strain that synthesizes indigo using glucose according to claim 3, characterized in that, The genetically engineered strain also overexpresses the trpE gene; Optionally, the nucleic acid sequence of the trpE gene includes the sequence shown in SEQ ID NO.
1.
5. The genetically engineered strain that synthesizes indigo using glucose according to claim 4, characterized in that, The genetically engineered strain also overexpressed aroG. fbr Gene; Optionally, the aroG fbr The nucleic acid sequence of the gene includes the sequence shown in SEQ ID NO.
2.
6. The genetically engineered strain for synthesizing indigo using glucose according to claim 5, characterized in that, The genetically engineered strain also overexpresses the xfpk gene; Optionally, the nucleic acid sequence of the xfpk gene includes the sequence shown in SEQ ID NO.
3.
7. The genetically engineered strain that synthesizes indigo from glucose according to claim 6, characterized in that, The genetically engineered strain also overexpresses the pck gene; Optionally, the nucleic acid sequence of the pck gene includes the sequence shown in SEQ ID NO.
4.
8. The genetically engineered strain for synthesizing indigo using glucose according to claim 7, characterized in that, The genetically engineered strain also overexpresses the katE gene; Optionally, the nucleic acid sequence of the trpE gene includes the sequence shown in SEQ ID NO.
7.
9. The method for constructing a genetically engineered strain that synthesizes indigo using glucose according to any one of claims 1-8, characterized in that, The construction method includes: The gene sequences of the indole-3-glycerol phosphate lyase derived from plants, the mono / dioxygenase derived from bacteria, and the α subunit of tryptophan synthase were inserted into an expression vector to obtain a recombinant vector. The recombinant vector was then transformed into the starting strain to obtain the genetically engineered strain.
10. A method for producing indigo, characterized in that, The method for producing indigo includes: Cultivate the genetically engineered strain that synthesizes indigo from glucose according to any one of claims 1-8, and purify the product to obtain indigo.