Carbonic anhydrase from a carbon-fixing bacterium and in vitro expression method and application thereof

By heterologously expressing carbonic anhydrase (CNCA) derived from carbon-fixing bacteria in Escherichia coli, the problem of low CO2 absorption efficiency in post-combustion capture technology was solved, achieving efficient CO2 capture and recovery.

CN122303205APending Publication Date: 2026-06-30GREEN CARBON TECH SUZHOU CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GREEN CARBON TECH SUZHOU CO LTD
Filing Date
2024-12-30
Publication Date
2026-06-30

Smart Images

  • Figure CN122303205A_ABST
    Figure CN122303205A_ABST
Patent Text Reader

Abstract

This invention relates to a carbonic anhydrase derived from carbon-fixing bacteria, its in vitro expression method, and its applications. The carbonic anhydrase is derived from the carbon-fixing bacterium *Cupriavidus necator*. The carbonic anhydrase of this invention can accelerate the CO2 hydration rate, allowing CO2 to be converted to H2CO3 more quickly, thereby accelerating the subsequent neutralization reaction in the aqueous phase and further obtaining stable CO3. 2‑ Salt.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioenzyme technology, specifically relating to a carbonic anhydrase derived from carbon-fixing bacteria, its in vitro expression method, and its application. Background Technology

[0003] Currently, CO2 capture from power plant flue gas mainly relies on three methods: post-combustion capture, pre-combustion capture, and oxy-fuel combustion capture technology. Pre-combustion capture technology suffers from immature technology and high costs. Oxy-fuel combustion involves high oxygen concentrations, which may lead to changes in the chemical composition of ash and cause corrosion, scaling, and other problems in equipment. Post-combustion capture technology, which involves capturing CO2 from the flue gas produced by power plant combustion, has become one of the most promising technologies for large-scale CO2 capture due to its high efficiency, adaptability, and ability to retrofit existing thermal power plants. Among post-combustion capture technologies, chemical absorption, especially organic amine solvent absorption, is the most widely used separation technology and has unique advantages. Against this backdrop, absorption processes based on natural carbonic anhydrase (CA) biocatalysts have been developed. Figure 1 As shown, in traditional CO2 capture processes, low-concentration CO2 flue gas enters the absorption section and is absorbed by pure amine or carbonate solvent, subsequently released in the desorption / regeneration section to obtain high-concentration CO2 gas. However, due to limitations imposed by CO2 hydration kinetics, only a small amount of CO2 can be absorbed and captured. Carbonyl amine (CA) is one of the enzymes with the highest known turnover numbers, reaching 600,000 per second, and is currently the fastest known enzyme catalyzing CO2 hydration. Introducing CA into the absorption section accelerates the solvent absorption rate and improves the absorption capacity due to its extremely high catalytic activity for CO2 hydration. More importantly, CA's ability to catalyze the reverse reaction also promotes the CO2 desorption process. After the reaction, CA and the solvent are recovered together and returned to the absorption unit for reuse. The most critical part of the bioenzyme-based flue gas CO2 capture process is providing highly catalytically active CA and its ability to be prepared in large quantities.

[0004] Currently, although there are existing studies on CA, there is still a need to provide more CA with high catalytic activity and easy preparation. Summary of the Invention

[0005] The purpose of this invention is to provide a carbonic anhydrase derived from carbon-fixing bacteria that has high catalytic activity and is easy to prepare, as well as its in vitro expression method and application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a carbonic anhydrase derived from carbon-fixing bacteria, wherein the carbonic anhydrase is derived from the carbon-fixing bacterium Cupriavidus necator (CN, formerly known as Ralstonia eutropha).

[0008] The carbon-fixing autotrophic archaea Cupriavidus necator (CN) has a higher CO2 assimilation efficiency than plants and algae, and therefore its key enzymes have higher activity. Therefore, Cupriavidusnecator was selected as the source of CA and named CNCA.

[0009] According to some specific embodiments, the amino acid sequence of the carbon-fixing bacteria-derived carbonic anhydrase is as follows: Met AsnThr Arg Leu Pro Ile Ile Thr Val Cys Thr Ala Leu Leu Ala Pro Ala Ala Trp AlaGly Asn Asp Pro His Trp Ser Tyr Thr Gly Pro Thr Gly Thr Ser His Trp Ala GluLeu Asp Gln Asp Tyr Lys Thr Cys Ala Leu Gly Lys His Gln Ser Pro Ile Asp IleArg Thr Ser Lys Ala Arg Pro Ala Asp Leu Lys Pro Ile Gly Phe Gly Tyr Ala Ala Ala Pro Ala Thr Val Val Asn Asn Gly His Thr Val Gln Val Asn Leu Pro Ala AlaGly Gln Ile Glu Leu Asp Gly Val Pro Tyr Lys Leu Leu Gln Phe His Phe His ThrPro Ser Glu Glu Lys Ile Asn Gly Lys Ala Tyr Pro Leu Val Ala His Leu Val HisGln Asn Ala Glu Gly Lys Leu Ala Val Ala Val Leu Phe Lys Ser Gly Arg GluAsn Ala Ala Leu Lys Pro Val Phe Ala Ser Leu Pro Ala Lys Ala Gly Glu Ser ArgGlu Leu Thr Ala Pro Leu Asp Val Ala Ala Leu Leu Pro Ala Arg Gln Ser Tyr TrpAla Phe Thr Gly Ser Leu Thr Thr Pro Pro Cys Ser Glu Asp Val Arg Trp Gln ValLeu Lys Thr Pro Val Glu Val Ser Pro Ala Gln Leu Ala Ala Phe Arg Gln Leu TyrPro Met Asn Ala Arg Pro Val Gln Pro Leu Asn Gly Arg Thr Val GlnVal Ser His (SEQ ID NO.1).

[0010] The CNCA protein shown in SEQ ID NO.1 can be used to extract CO2 from industrial waste gas and exhaust gas, and it can accelerate the hydration rate in CO2 absorption.

[0011] A second aspect of the present invention provides a gene encoding a carbonic anhydrase derived from carbon-fixing bacteria as described above.

[0012] According to some specific implementation methods, the gene encoding is heterologously soluble and expressed in Escherichia coli.

[0013] According to some specific embodiments, the nucleotide sequence of the gene is as follows:

[0014] ATGAATACTCGTCTGCCTATCATTACCGTTTGTACCGCGCTGCTGGCACCAGCGGCATGG

[0015] GCGGGCAACGACCCGCACTGGTCTTATACTGGCCCGACCGGCACTTCTCACTGGGCCGA

[0016] GCTGGATCAAGACTACAAAACGTGCGCCCTGGGCAAACATCAGTCTCCGATCGACATCC

[0017] GTACCAGCAAAGCGCGTCCGGCTGATCTGAAGCCGATCGGTTTCGGTTATGCTGCCGCA

[0018] CCGGCGACGGTGGTTAATAACGGCCACACCGTTCAGGTTAATCTGCCGGCAGCGGGCCA

[0019] GATCGAACTGGACGGCGTCCCGTACAAGCTGCTGCAGTTCCACTTCCACACCCCGAGCGAAGAGAAGATCAACG GCAAGGCGTA TCCGCTGGTG GCGCACCTGG TCCATCAGAA CGCAGAAGGTAAGCTGGCAGTGGTTGCAGTGCTGTTCAAGAGCGGCCGTGAAAACGCTGCGCTGAAACCGGTGTTTGCGTCTCTGCCGGCGAAAGCAGGTGAGTCTCGTGAGCTGACCGCGCCTCTGGATGTTGCTGCACTGCTGCCGGCACGTCAGTCTTACTGGGCAT TTACTGGTTCTCTGACCCCTCCGTGTAGCGAAGACGTGCGTTGGCAGGTTCTGAAAACTCCGGTGGAGGTATCCCCGGCCCAGCTGGCTGCTTTCCGTCAGCTGTACCCGATGAACGCGCGTCCTGTCCAGCCTCTGAACGGTCGTACCGTCCAGGTTTCCCAC(SEQ ID NO.2).

[0020] The third aspect of the present invention provides a method for preparing carbonic anhydrase from carbon-fixing bacteria as described above, comprising: performing PCR amplification on the carbonic anhydrase gene from carbon-fixing bacteria; performing double enzyme digestion on the amplified product and the expression vector; ligating the digested amplified product and the expression vector to obtain a recombinant plasmid carrying the target gene; and transforming and inducing expression of the carbonic anhydrase from the carbon-fixing bacteria.

[0021] The CO2 capture process based on CNCA relies on the large-scale preparation of CNCA, and the method of this invention can prepare CNCA in large quantities.

[0022] A fourth aspect of this invention provides an application of the carbonic anhydrase derived from carbon-fixing bacteria as described above, wherein the carbonic anhydrase derived from carbon-fixing bacteria is used in the field of CO2 absorption. Wherein, CO2 refers to gases containing CO2 produced in various production fields.

[0023] According to some specific implementation methods, the CO2 is in gaseous form.

[0024] According to some specific embodiments, in a CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the hydration rate of CO2 uptake decreases with increasing temperature.

[0025] According to some specific implementation methods, in a CO2 solution containing carbonic anhydrase derived from the carbon-fixing bacteria, the system temperature is controlled at 25–45°C.

[0026] Furthermore, in the CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the system temperature is controlled at approximately 40°C.

[0027] According to some specific embodiments, in a CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the pH of the system is controlled to be 6-8.

[0028] Furthermore, in the CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the pH of the system is controlled to be around 7.

[0029] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0030] The CA of this invention can accelerate the CO2 hydration rate, enabling CO2 to be converted into H2CO3 more quickly, thereby accelerating the subsequent neutralization reaction in the aqueous phase and further obtaining stable CO3. 2- Salt. Attached Figure Description

[0031] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 The mechanism by which carbonic anhydrase reversibly catalyzes the conversion between CO2 and H2CO3;

[0033] Figure 2 The constructed expression plasmid map;

[0034] Figure 3 The graph shows the results of the thermostability changes of carbonic anhydrase.

[0035] Figure 4 This is a graph showing the results of acid stability changes in carbonic anhydrase. Detailed Implementation

[0036] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the embodiments of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0037] All features disclosed in this invention, or steps in all methods or processes disclosed, may be combined in any way, except for mutually exclusive features or steps.

[0038] The technical solutions of the present invention will be further described below with reference to specific embodiments. However, the present invention should not be limited to these embodiments. Unless specifically stated otherwise, all features can be replaced by other equivalent or similar alternative features. Unless specifically stated otherwise, each feature is only one example of a series of equivalent or similar features. The terminology used in the present invention, unless otherwise stated, generally has the meaning commonly understood by those skilled in the art. The implementation conditions adopted in the embodiments can be further adjusted according to different requirements of specific use. Implementation conditions not specified are conventional conditions in the industry. The technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other.

[0039] In this invention, operations without specific instructions are performed at room temperature. All reagents or raw materials used in this application are commercially available or can be prepared using conventional methods in the prior art. In this invention, unless otherwise specified, all contents are mass contents, and "%" represents a mass percentage.

[0040] CNCA preparation method

[0041] This invention utilizes *Escherichia coli* as an expression vector for the heterologous expression of CNCA protein in vitro. Specifically, *E. coli* is used as the vector, and the CA gene derived from the carbon-fixing autotrophic archaea *Cupriavidus necator* (CN) is used as the target gene. After digestion with the corresponding restriction endonuclease, the target gene is inserted. The product of PCR amplification of the target gene is double-digested, and the expression vector undergoes the same procedure. The target fragment is then recovered by gel electrophoresis. The mixture of the target gene and the expression vector is ligated using DNA ligase. Successful ligation yields a recombinant plasmid carrying the target gene. The recombinant vector is then transformed, and positive clones are detected. The target product is then expressed by induction.

[0042] Protein content determination

[0043] The concentration of protein samples was determined using the Coomassie Brilliant Blue method as described in the Bradford kit. The principle is that Coomassie Brilliant Blue G-250 for protein determination is a dye-binding method; when it binds to protein, it turns cyan, and the protein-dye conjugate has maximum absorption at a wavelength of 595 nm. Its absorbance is directly proportional to the protein content, therefore it can be used for quantitative protein determination.

[0044] Enzyme activity detection methods

[0045] The most common method for detecting CNCA enzyme activity is the pH electrode method. In this method, saturated CO2 solution and CNCA are added to a buffer solution with pH = 8.0. CNCA can accelerate the H2O reaction. + The generation of [a substance] causes a rapid decrease in the solution pH. The CNCA enzyme activity is calculated by measuring the rate of decrease of the pH electrode within a fixed range.

[0046] Enzyme activity calculation:

[0047] U = (T1 - T0) / T0

[0048] T1 = Time it takes for the pH to drop from 8.0 to 7.0 after adding CNCA.

[0049] T0 = ​​Time it takes for the pH to drop from 8.0 to 7.0 without the addition of CNCA.

[0050] Example

[0051] 1. Extracting the genome

[0052] Hydrogen bacteria (Cupriavidus necator, CN, formerly known as Ralstonia eutropha) preserved in an activated bacterial culture bank were used. 1.5 mL of the hydrogen bacteria culture was added to a centrifuge tube and centrifuged at 10,000 rpm for 1 min, discarding the supernatant. The precipitate was washed with 1 mL of sterile water and centrifuged again at 10,000 rpm for 1 min. 200 μL of extraction buffer was added to prepare a resuspension. 100 μL of equilibrated phenol, 100 μL of chloroform, and 0.3 g of acid-washed glass beads were added. The mixture was vortexed for 3 min to ensure homogeneity, and then centrifuged at 10,000 rpm for 5 min to obtain the supernatant. Anhydrous ethanol was added to precipitate the nucleic acid, and the mixture was vortexed and incubated at –20°C for 30 minutes. After centrifugation, the supernatant was discarded, and 1 mL of ethanol was added to the precipitate. The tube was then sealed and inverted. Centrifuge at 10,000 rpm for 5 min using a high-speed centrifuge, retain the precipitate, prepare a resuspension in sterile water containing 100 μg / mL RNase A, incubate in a water bath at 37°C for 30 min, and store at –20°C for later use.

[0053] 2. PCR amplification of the target gene

[0054] Primers were designed by searching for the target gene sequence on NCBI and designing corresponding primers based on the sequence of the carbonic anhydrase gene *cnca* from hydrogen bacteria. The restriction enzyme site added to the upstream primer of gene *cnca* was EcoRI, and the restriction enzyme site added to the downstream primer was XhoI. The designed forward and reverse primers are shown in Table 1.

[0055] Table 1

[0056] end sequence F: 5'-GGAATTCATGAACACCAGGCTGCCG-3' R: 5'-CCGCTCGAGGTGGCTGACCTGCACCG-3'

[0057] Using the designed primers and the carbonic anhydrase gene cnca from hydrogen bacteria as a template, the gene was amplified by PCR. The amplification system is shown in Table 2.

[0058] Table 2

[0059]

[0060]

[0061] PCR amplification reaction procedure: Pre-denaturation, 94℃ for 5 min. Denaturation, 94℃ for 1 min. Annealing and extension, 60–65℃ for 70 s. The reaction ends at 4℃. Steps 2 and 3 are repeated 34 times. After PCR, DNA agarose gel electrophoresis is performed. The PCR amplification product is recovered from the gel and stored at –20℃ for later use.

[0062] 3. Establishment of the cloning T-vector ligation system

[0063] The target fragment was double-digested with restriction endonucleases EocRI and XhoI, and then recovered by agarose gel electrophoresis (resulting in a band of approximately 750 bp). The double-digested expression vector pGEM-T was ligated to the target fragment using ligase, as shown in Table 3.

[0064] Table 3

[0065] Components Volume (μL) pGEM-T Vector 1μL PCR products 3μL T4 DNA Ligase 1μL 2×Papid Ligation Buffer 5μL

[0066] The ligation product was transformed into E. coli DH5α competent cells and spread onto Amp antibody plates under sterile conditions in a laminar flow hood. The plates were then incubated upside down in a 37°C incubator for about 12 hours. One single colony was selected for preservation, and the other was used for subsequent electrophoresis detection.

[0067] 4. Culture and transformation of Escherichia coli DH5α competent cells

[0068] Remove the preserved DH5α strain and streak two plates on LB solid medium. Incubate the plates upside down at 37°C for approximately 12 hours. Pick a single colony of DH5α and add it to 5 mL of LB liquid medium. Shake twice and incubate overnight at 37°C and 200 rpm. Take 1 mL of the bacterial culture from a test tube and add it to two 100 mL LB Erlenmeyer flasks. Incubate at 37°C and 200 rpm for 4–5 hours. Finally, transfer 200 μL from the Erlenmeyer flask to a 96-well plate and observe the OD using a microplate reader. 600nmThe value should reach 0.3–0.5. Place ice in a foam box. Take a good LB conical flask, four sterilized 50mL centrifuge tubes, and pre-ice them for 10–15 min. Keep the conical flask containing 50mL CaCl2 and the test tube containing 10mL CaCl2 and glycerol on ice. Take 30mL of bacterial solution from each flask and place it in two 50mL centrifuge tubes. Centrifuge at 4℃, 4000rpm for 10 min and remove the supernatant. Then add 10mL of pre-chilled CaCl2 solution to each tube, vortex to mix, and incubate on ice for 30 min. Centrifuge at 4℃, 4000rpm for 10 min and remove the supernatant. Add 2mL of pre-chilled CaCl2-glycerol solution to each tube, vortex to mix, and take 20 2mL EP tubes, each containing 200μL of centrifuge tube liquid. Store in a -80℃ freezer for later use.

[0069] Adjust the water bath to 42°C. Take two DH5α competent cells stored at –80°C and the T vector ligation system and thaw them in the ice box of the laminar flow hood. Add ice to the foam box and place a 5mL LB liquid culture medium test tube inside. Pipette 50μL from a 2mL EP tube and add 5μL of the T vector ligation system. Vortex to mix and incubate on ice for 30min. Infuse with heat shock at 42°C for 90s, then incubate on ice for 3min. Add 400μL of pre-cooled culture medium to a new 2mL EP tube and gently shake at 37°C for 45min. Centrifuge at 6000rpm for 5min, remove 250μL of supernatant, vortex to mix, and spread onto two YPM antibody plates containing AMP. Incubate overnight in an inverted incubator at 37°C. Single colonies were picked from AMPDE YPM plates after culture and inoculated into test tubes containing 5 ml LB liquid medium. The tubes were shaken four times and enriched at 37°C for 12 h. 2 mL of the bacterial culture from the test tubes was added to 2 mL EP tubes, leaving a portion of the active bacterial culture for preservation. A portion of the bacterial culture was then used to extract plasmids using a plasmid extraction kit for relevant verification.

[0070] 5. Extract plasmids using a plasmid extraction kit.

[0071] Column equilibration: Add 500 μL of equilibration buffer BL to the adsorption column CP4 (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube. Add 10 mL of overnight culture to a centrifuge tube, centrifuge at 12000 rpm for 1 min, and aspirate the supernatant. Pipette 500 μL of solution P1 into the centrifuge tube containing the bacterial cell precipitate, and vortex thoroughly to suspend the bacterial cell precipitate. Add 500 μL of solution P2 to the centrifuge tube, and gently vortex several times to fully lyse the bacteria. Add 700 μL of solution P3 to the centrifuge tube, and immediately and gently vortex several times to mix thoroughly; a white flocculent precipitate will appear at this point. Centrifuge at 12000 rpm for 10 min. After centrifugation, a precipitate will appear at the bottom of the centrifuge tube; collect the supernatant. Add the collected supernatant to the filter column CS and centrifuge at 12000 rpm for 2 min. Carefully add the solution from the centrifuged collection tube to the adsorption column CP4. Centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and add the adsorption column CP4 to the collection tube. Add 500 μL of protein removal solution PD to the adsorption column CP4, centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CP4 into the collection tube. Add 600 μL of washing buffer PW to the adsorption column CP4 and let it stand for 2-5 min. Centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column CP4 into the collection tube. Repeat this operation. Place the adsorption column CP4 back into the collection tube and centrifuge at 12000 rpm for 2 min to remove any remaining washing buffer from the adsorption column. Place the CP4 adsorption column into a clean centrifuge tube, and add 100-300 μL of elution buffer TB in the middle of the adsorption membrane. Let it stand at room temperature for 2 minutes, and then centrifuge at 12000 rpm for 1 minute to collect the plasmid solution into the centrifuge tube.

[0072] 6. Construction of recombinant plasmids

[0073] Plasmids pGM-T-cnca and pET-28a(+) were double-digested using restriction endonucleases EcoR I and Xho I at 37℃ for 2 h. The digestion system is shown in Table 4 below. After digestion, 1% agarose gel electrophoresis was performed, and 700 bp and 5300 bp bands were extracted and recovered. The gel recovery products from the two double-digested samples were ligated according to the expression vector ligation system to obtain the recombinant expression vector. The expression vector ligation system is shown in Table 5 below.

[0074] Table 4

[0075]

[0076]

[0077] Table 5

[0078] Components Volume (μL) pET-28a fragment 1.5 cnca target fragment 7 T4 DNA Ligase 0.5 2×Papid Ligation Buffer 1

[0079] 7. Establishment of expression strains

[0080] Escherichia coli strain BL21, preserved in the laboratory, was streaked onto an LB agar plate using an inoculation loop, labeled, and incubated overnight at 37°C. A single colony was picked from the plate and inoculated into a test tube containing 4 mL of LB medium, and incubated overnight at 37°C with shaking at 200 rpm. 1 mL of the bacterial culture was then inoculated into a 500 mL shake flask containing 100 mL of LB medium and incubated at 37°C with shaking at 200 rpm for approximately 2–3 hours. When the colony OD600 nm value reached 0.5–0.7, the shake flask was placed on ice for approximately 15 minutes. Under aseptic conditions in a laminar flow hood, 50 mL of pre-chilled bacterial culture was added to four centrifuge tubes, and the tubes were centrifuged at 4°C with shaking at 4000 rpm for 10 minutes. Discard the supernatant, add approximately 10 mL of pre-chilled 0.1 M CaCl2 solution, mix well by pipetting, resuspend the bacterial cells, place in an ice bath for 30 min, centrifuge at 4000 rpm for 10 min at 4°C, discard the supernatant, add 2 mL of pre-chilled 0.1 M CaCl2 solution (containing 15% glycerol), and resuspend the bacterial cells. Aliquot the resuspended bacterial solution into 1.5 mL EP tubes, adding 200 μL to each tube, and store in an ultra-low temperature freezer at –80°C.

[0081] Adjust the water bath to 42℃, then thaw two BL21 competent cells stored at –80℃ and the constructed recombinant plasmid pET28a(+)-cnca in an ice box in a clean bench. Add ice to a foam box, place a 5ml LB liquid culture medium tube inside, pipette 50μL from a 2mL EP tube, add 5μL of the recombinant plasmid, vortex to mix, and incubate on ice for 30min. Perform heat shock at 42℃ for 90s, incubate on ice for 3min, add 400μL of pre-cooled culture medium to a new 2mL EP tube, and gently shake on a shaker at 37℃ for 45min. Centrifuge at 6000rpm for 5min, remove 250μL of supernatant, vortex to mix, spread onto two YPM antibody plates containing Kans, and incubate in an inverted incubator at 37℃ overnight. Single colonies were picked from YPM resistant plates containing Kan and inoculated into 5 ml LB liquid medium tubes. The tubes were shaken three times and incubated at 37°C for 12 h. 2 mL of the bacterial culture was then transferred to 2 mL EP tubes to construct three 25 μL systems. A portion was reserved for bacterial preservation. The three systems were used for colony PCR detection. A further portion of the bacterial culture was used to extract plasmids using a plasmid extraction kit. The extracted plasmids were then double-digested with restriction endonucleases for double digestion verification.

[0082] 8. Inducible expression of CNCA

[0083] The previously preserved transformed expression strain was inoculated (50 μL) into a test tube containing YPM liquid medium with Kan resistance. After enrichment culture overnight at 37°C with shaking at 200 rpm, it was inoculated into a shake flask containing 50 mL of LB liquid medium and cultured at 37°C with shaking at 200 rpm until the OD of the bacterial culture reached [value missing]. 600nm When the concentration reaches approximately 0.7, IPTG is added to the bacterial culture to a final concentration of 0.10 mM. A transformed expression strain without IPTG and a strain containing the pET-28a(+) empty plasmid are used as controls. The bacterial culture is then incubated overnight at 37°C and 200 rpm on a shaker. After induction culture, the bacterial culture is centrifuged at 8000 rpm for 5 min, the supernatant is discarded, and 5 mL of sterile water is added to prepare a resuspension. The resuspension is then added to a 2 mL EP tube and sonicated on ice using an ultrasonic disruptor. The ultrasonic disruption program is: ultrasonic power 200 W, 10 s intervals, 10 s intervals, total time 20 min. The entire process is performed on ice. The ultrasonically disrupted bacterial culture is centrifuged at 10000 rpm for 10 min. The supernatant obtained from centrifugation is collected for later use, and an equal volume of sterile water is added to the lower precipitate for resuspension. Take 60 μL of the supernatant sample and 60 μL of the resuspension of the lower precipitate sample, add 20 μL of 2×SDS loading buffer to each sample, mix well, boil in boiling water for about 10 min, and then take 10 μL of each sample for SDS-PAGE gel electrophoresis detection.

[0084] 9. SDS-PAGE gel electrophoresis

[0085] Principle: Based on the different molecular weights of proteins, they move in the electrophoresis gel to achieve separation. SDS is an anionic detergent that can be used as a denaturant and solubilizer. It can break intramolecular and intermolecular hydrogen bonds, causing molecules to unfold and destroying the secondary and tertiary structures of protein molecules.

[0086] step:

[0087] 1. Clean the glass plate and sample comb, let them dry after washing, fix them on the glue-filling bracket, and check for leaks;

[0088] 2. First, prepare the separating gel. Quickly add the separating gel using a pipette up to the top of the front glass plate, cover the separating gel with deionized water to make the gel surface smooth, and let it stand until the gel solidifies and a clear separation interface appears;

[0089] 3. Pour off the top layer of water, blot away any remaining water with filter paper, and prepare the stacking gel. Immediately after preparation, pour the gel into the electrophoresis tank, insert the sample comb, and let it stand for about 30 minutes to allow the two gels to polymerize.

[0090] 4. After the gel solidifies, carefully remove the sample comb, fix the gel plate onto the electrophoresis apparatus, add electrophoresis buffer to the electrophoresis tank, and then correctly install the electrophoresis system. Use a micropipette to pipette 20 μL of sample and load it onto the gel. Turn on the power to start electrophoresis, keeping the electrophoresis voltage constant between 80V and 140V. Stop electrophoresis when the bromophenol blue indicator reaches the bottom, and finally disconnect the power. The total electrophoresis time is approximately 30 minutes.

[0091] 5. Remove the gel plate from the electrophoresis apparatus and carefully peel off the gel, being careful not to damage it. Place it in Coomassie Brilliant Blue staining solution at room temperature and continue staining for about 1 hour. Then remove the gel and rinse it. Finally, place it in destaining solution for destaining. The destaining solution can be changed as needed during destaining until the background is colorless.

[0092] 11. Collect the bacterial cell lysate for CNCA protein purification.

[0093] Steps: Resuspend bacterial cells in PBS → Add PMSF for disruption → Centrifuge → Transfer to membrane → Load onto column → Column loading → Elution

[0094] Resuspend the bacterial cells in PBS: Resuspend 600 mL of bacterial culture in 40 mL of buffer. Add PMSF for disruption: Adjust the PMSF concentration to 1 mM, and perform the entire process on ice. Centrifuge at 11000 g, 4 °C for 60 min. Filter the supernatant through a 0.45 aqueous membrane and load it onto the column. Sterilize the membrane and wash the system with UP water before and after washing, then rinse again with the mobile phase. Use PBS buffer as the mobile phase to bind the tagged protein to the nickel column. Wash with 35 mM imidazole, then elute with 250 mM imidazole and collect the protein.

[0095] 12. Effects of different temperatures and pH on CNCA enzyme activity

[0096] The purified CNCA was treated at different temperatures: 30, 40, 50, 60, 70, and 80 °C for 30 and 60 min respectively. Enzyme activity was then measured, and the changes in enzyme activity were as follows: Figure 4 .

[0097] The purified CNCA was treated with buffer solutions at pH values ​​of 3.0, 5.0, 7.0, 9.0, and 11.0 for 12 hours, and enzyme activity was measured. The changes in enzyme activity are shown below. Figure 4 .

[0098] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A carbonic anhydrase derived from carbon-fixing bacteria, characterized in that: The carbon anhydrase from the carbon-fixing bacteria is derived from the carbon-fixing bacterium *Cupriavidus necator*.

2. The carbonic anhydrase derived from carbon-fixing bacteria according to claim 1, characterized in that: The amino acid sequence of the carbon anhydrase derived from the carbon-fixing bacteria is shown in SEQ ID NO.

1.

3. A gene encoding a carbonic anhydrase derived from the carbon-fixing bacteria of claim 1 or 2.

4. The gene according to claim 3, characterized in that: The gene encoding enables heterologous soluble expression in Escherichia coli.

5. The gene according to claim 3, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

6. A method for preparing carbonic anhydrase derived from carbon-fixing bacteria as described in claim 1 or 2, characterized in that: The carbonic anhydrase gene from carbon-fixing bacteria was amplified by PCR. The amplified product and the expression vector were double-digested with enzymes. The digested amplified product and the expression vector were ligated to obtain a recombinant plasmid carrying the target gene. The recombinant plasmid was transformed and induced to express the carbonic anhydrase from the carbon-fixing bacteria.

7. The application of a carbonic anhydrase derived from carbon-fixing bacteria as described in claim 1 or 2, characterized in that: The carbon anhydrase derived from the carbon-fixing bacteria is used in the field of CO2 absorption.

8. The application according to claim 7, characterized in that: The CO2 is in gaseous form.

9. The application according to claim 7, characterized in that: In a CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the system temperature was controlled at 25–45°C.

10. The application according to claim 7, characterized in that: In a CO2 solution containing carbonic anhydrase derived from the aforementioned carbon-fixing bacteria, the pH of the system was controlled to be between 6 and 8.