Use of nadk inhibitors for the preparation of a medicament for the treatment of liver cancer

Abstract

This invention discloses the application of NADK inhibitors in the preparation of drugs for treating liver cancer, such as siRNA targeting NADK. This invention demonstrates that NADK inhibitors can be used to treat liver cancer, and the siRNA provided by this invention exhibits stronger cytotoxicity against HepG2 cells compared to previously disclosed NADK target sequences, effectively inhibiting the proliferation of liver cancer cells both in vitro and in vivo, achieving a tumor-suppressive effect. Furthermore, the siRNA designed in this invention can simultaneously knock down the mRNA levels of both human and mouse NADK genes, facilitating scientific research and the development of tumor drugs.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, and in particular relates to the application of NADK inhibitors in the preparation of drugs for treating liver cancer. Background Technology

[0002] Gene therapy is a treatment method that involves transferring specific genetic material into a patient's body through various means to regulate the expression levels of key genes involved in disease development, thereby modulating the levels of abnormally expressed genes to achieve the goal of treating the disease. Gene therapy strategies are diverse, including compensatory gene therapy, which involves introducing normal genes and enabling their expression to compensate for disease types caused by endogenous expression defects; replacement gene therapy, which uses homologous recombination and other methods to replace existing defective genes to restore gene function and achieve the goal of treating the disease; and regulatory gene therapy, which involves introducing exogenous nucleic acids to specifically regulate the expression levels of disease-related genes to achieve the goal of treating the disease, including gene silencing and gene activation. With the continuous development of science and technology, gene therapy strategies are gradually becoming richer and more sophisticated, providing new hope and possibilities for the treatment of various diseases, especially genetic diseases and tumors.

[0003] In recent years, small interfering RNA (siRNA) has shown great potential in disease treatment. siRNA, through RNA interference mechanisms, targets and silences the expression of target genes at the post-transcriptional level, thereby regulating the metabolism of specific proteins in cells and participating in biological activities. In anti-tumor therapy, siRNA precisely targets the expression of key genes involved in pathways related to tumor cell proliferation, migration, apoptosis, and drug resistance, inhibiting malignant biological behaviors such as tumor cell proliferation, demonstrating significant potential in the development of anti-tumor therapies. Currently, several commercially available siRNA products exist, including Patisiran, the world's first FDA-approved RNAi therapy developed by Alnylam Pharmaceuticals, for the treatment of adult-onset TTR amyloidosis polyneuropathy. This drug uses lipid nanoparticles as a delivery system to deliver small interfering RNA targeting and silencing transthyretin mRNA at specific levels, thereby inhibiting the expression of wild-type and mutant TTR proteins and contributing to their clearance. Furthermore, Inclisiran, developed by Novartis, is used to treat adults with primary hypercholesterolemia (heterozygous familial and non-familial) or mixed dyslipidemia. It is the world's first and currently only small interfering RNA (siRNA) drug to lower LDL-C. It precisely targets the liver, degrading the mRNA level of proprotein convertase subtilisin / kexin type 9 (PCSK9) in hepatocytes, blocking PCSK9 protein synthesis, and thus lowering LDL-C levels. Currently, the number of siRNA drugs under development is growing rapidly, with over 300 siRNA drugs in development as of the end of 2023. In addition to siRNA primarily used to treat hereditary and metabolic diseases, the development of siRNA drugs has gradually expanded to areas such as oncology, cardiovascular, nervous system, and immune system diseases.

[0004] Lipid nanoparticles (LNPs) are a widely researched and applied drug delivery system in recent years, and also an important method for non-viral gene delivery. Lipid nanoparticles offer significant advantages in delivery systems. First, they can protect the delivered drugs, especially nucleic acid drugs, from degradation, improving their stability and half-life. They can also reduce the amount of drug used, improve bioavailability, and reduce drug toxicity. Furthermore, nanoliposome delivery can achieve precise drug delivery through both passive and active targeting. Particularly in tumor tissue, due to the EPR effect (the high permeability and retention effect of solid tumors), nanoliposomes can penetrate and accumulate in tumor tissue, achieving passive targeting. Simultaneously, by modifying nanoliposomes, targeting molecules such as antibodies and ligands can be anchored to the liposome surface, thereby actively recognizing and binding to tumor cells, achieving active targeting. In addition, by adjusting the raw materials and composition of nanoliposomes, sustained or timed drug release can be achieved, thereby improving therapeutic efficacy. Nanoliposome delivery systems have a wide range of applications, including the delivery of anticancer drugs, mRNA vaccines, and gene therapy drugs (DNA or RNA). The advent of nanoliposome delivery systems provides an effective means for gene therapy of cancer.

[0005] The NAD kinase gene (NADK) is the only ubiquitous enzyme in organisms that catalyzes the phosphorylation of NAD(H) to produce NADP(H), a key enzyme that catalyzes the transfer of phosphate groups from ATP to NAD to generate NADP. This reaction plays a crucial role in regulating the NAD(H) / NADP(H) balance, which is dependent on NADP(H) metabolism within cells. NAD(H) and NADP(H) are important coenzymes in cellular metabolism, participating in multiple redox reactions and significantly influencing the rate and pathways of cellular oxidative metabolism. Maintaining the balance between NAD(H) and NADP(H) helps maintain cellular redox homeostasis to sustain normal cellular physiological functions. Furthermore, NADK has been found to positively regulate insulin secretion in response to glucose stimulation. In obese mice, regulating NADK activity or expression can improve insulin sensitivity, potentially aiding in the treatment of metabolic diseases such as diabetes. By influencing the balance between NAD(H) and NADP(H), NADK can also participate in regulating cell proliferation, apoptosis, metastasis, and metabolism, thereby affecting tumor development and progression. In metastatic breast cancer cells, highly expressed NADK is considered a significant factor in tumor metastasis and an important therapeutic target for metastatic breast cancer. NADK has also been found to participate in metabolic reprogramming by regulating the NAD(H) / NADP(H) balance, adapting the body to the rapid growth and proliferation of tumor cells. NADK can also influence the rate and efficiency of aerobic glycolysis in tumor cells by regulating the NAD(H) / NADP(H) balance, thereby affecting tumor cell growth and proliferation. Therefore, regulating NADK activity or expression levels can affect tumor cell proliferation and activity, providing new insights for targeted cancer therapy. Currently, there are no research or patent reports on targeting NADK for liver cancer treatment. Summary of the Invention

[0006] To address the technical problems existing in the prior art, this invention provides the application of NADK inhibitors in the preparation of drugs for treating liver cancer, such as NADK-targeting siRNA. This invention designs a highly efficient NADK-targeting siRNA sequence with stronger cytotoxicity against HepG2 cells, effectively inhibiting the proliferation of liver cancer cells in vitro and in vivo, achieving a tumor-suppressive effect. Furthermore, the siRNA sequence designed in this invention can efficiently knock down NADK expression in human HepG2 liver cancer cell lines and also knock down NADK gene expression in mouse livers; it can simultaneously interfere with NADK mRNA levels in humans and mice. This allows for the evaluation of the pharmacological efficacy of this nucleic acid drug in mouse models, while also assessing its toxicity to other normal tissues and cells, providing convenience for scientific research and the development of tumor drugs.

[0007] The present invention solves the above-mentioned technical problems by adopting the following technical solutions.

[0008] A first aspect of the present invention provides a nucleic acid molecule comprising a sense strand and an antisense strand forming a reverse complementary double-stranded region, said antisense strand comprising at least 15, 16, 17, 18 or 19 consecutive nucleotides in a sequence as shown in SEQ ID NO:2, 5, 8 or 11.

[0009] In some embodiments of the present invention, the positive chain comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides in a sequence as shown in SEQ ID NO:3, 6, 9, or 12.

[0010] In some embodiments of the present invention, the lengths of the sense strand and the antisense strand each independently comprise 19 to 23 nucleotides; preferably, they each independently comprise 19 to 21 nucleotides.

[0011] In some embodiments of the present invention, the length of the reverse complementary double-stranded region is 17 to 21 bp, for example, 19 bp or 21 bp.

[0012] In some embodiments of the present invention, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:3, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:2; or

[0013] The nucleotide sequence of the sense strand is shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:5; or

[0014] The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or

[0015] The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:11.

[0016] In some embodiments of the present invention, the nucleic acid molecule is shRNA, which further includes a hairpin loop, wherein the 5' end of the hairpin loop is connected to the 3' end of the sense strand, and the 3' end of the hairpin loop is connected to the 5' end of the antisense strand; preferably, the hairpin loop is selected from RNA sequences AUG, CCC, UUCG, CCACC, AAGCUU, CCACACC, and UUCAAGAGA.

[0017] In some embodiments of the present invention, the nucleic acid molecule is siRNA, and the sense and antisense strands complement each other to form an RNA dimer.

[0018] A second aspect of the invention provides a delivery composition comprising a nucleic acid molecule and a delivery vector as described in the first aspect of the invention.

[0019] In some embodiments of the present invention, the delivery vector is selected from lipid carriers, lipid-like carriers, coupling ligands, polymers and exosome carriers; and / or, the reverse complementary double-stranded region or hairpin structure of the nucleic acid molecule is connected to the delivery vector.

[0020] In some embodiments of the present invention, the coupling ligand is selected from carbohydrates, peptides, antibodies, aptamers, and small molecules; the lipid carrier is selected from LNP, cholesterol, Dlin-DMA / MC3-DMA; the lipid carrier is selected from nanoparticles (e.g., endoplasmic reticulum membrane-modified nanoparticles, polymer nanoparticles (PNP), lipid polypolymers (LPP)), PEI particles, PLGA particles, preferably inorganic nanoparticles; the polymer is a dendritic molecule, such as PBAVE polymer, DPC1.0, or DPC2.0; the reverse complementary double-stranded region or hairpin loop is connected to the delivery carrier via a linker with monovalent, divalent, or trivalent branches; preferably, the 3' end of the positive strand of the reverse complementary double-stranded region is connected to the delivery carrier via a linker.

[0021] In some embodiments of the present invention, the carbohydrate is selected from sugars, fatty acid oligosaccharides and polysaccharides, and the fatty acid oligosaccharides preferably include monosaccharides, disaccharides, trisaccharides and tetrasaccharides; the monosaccharide is preferably GalNAc, such as L96; the polypeptide is RGD polypeptide.

[0022] A third aspect of the present invention provides a nucleic acid protein composition comprising a nucleic acid molecule as described in the first aspect of the present invention, and a nuclease; wherein the nuclease is preferably an AGO protein;

[0023] Alternatively, the nucleic acid protein composition comprises an antisense strand of a nucleic acid molecule as described in the first aspect of the invention, and a nuclease; the nuclease is preferably an AGO protein.

[0024] A fourth aspect of the present invention provides a recombinant vector comprising the coding sequence of a nucleic acid molecule as described in the first aspect of the present invention.

[0025] In some embodiments of the present invention, the starting vector of the recombinant vector is a plasmid or a viral vector.

[0026] A fifth aspect of the present invention provides a transformant comprising the coding sequence of a nucleic acid molecule as described in the first aspect of the present invention or a recombinant vector as described in the fourth aspect of the present invention; the host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

[0027] A sixth aspect of the present invention provides a method for preparing nucleic acid molecules as described in the first aspect of the present invention, the method comprising culturing transformants as described in the fifth aspect of the present invention, or directly obtaining the nucleic acid molecules by means of chemical synthesis and mixing.

[0028] A seventh aspect of the present invention provides a pharmaceutical composition comprising a nucleic acid molecule as described in the first aspect of the present invention, a delivery composition as described in the second aspect of the present invention, a recombinant vector as described in the fourth aspect of the present invention, or a transformant as described in the fifth aspect of the present invention, and a pharmaceutically acceptable carrier.

[0029] In some embodiments of the present invention, the carrier is water, saline solution or buffer solution;

[0030] In some embodiments of the invention, the buffering agent in the buffer solution includes acetate, citrate, alcohol-soluble gluten, carbonate or phosphate, Tris-hydrochloric acid or any combination thereof; for example, phosphate.

[0031] An eighth aspect of the present invention provides a kit comprising a kit A containing a reagent kit, the kit comprising one or more of the following: a nucleic acid molecule as described in the first aspect of the present invention, a delivery composition as described in the second aspect of the present invention, a recombinant vector as described in the fourth aspect of the present invention, a transformant as described in the fifth aspect of the present invention, and a pharmaceutical composition as described in the seventh aspect of the present invention.

[0032] In some embodiments of the present invention, the kit further includes a medicine box B, which contains one or more of the following:

[0033] (1) Other drugs that inhibit NADK gene expression or compositions containing the drugs that inhibit NADK gene expression;

[0034] (2) One or more of the following groups: hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines; and,

[0035] (3) Other drugs that inhibit NADK gene expression, compositions containing said drugs that inhibit NADK gene expression, and one or more of the group consisting of hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

[0036] The ninth aspect of the present invention provides the use of one or more of the following in the preparation of products for inhibiting the expression level of the NADK gene, or for the prevention and / or treatment of liver cancer: the nucleic acid molecule as described in the first aspect of the present invention, the delivery composition as described in the second aspect of the present invention, the recombinant vector as described in the fourth aspect of the present invention, the transformant as described in the fifth aspect of the present invention, the pharmaceutical composition as described in the seventh aspect of the present invention, and the kit as described in the eighth aspect of the present invention.

[0037] In some embodiments of the present invention, the expression level of the NADK gene refers to the expression level of the NADK gene in in vivo or in vitro samples from the source human and / or mouse.

[0038] In some embodiments of the present invention, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:5; or

[0039] The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or

[0040] The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:11.

[0041] The tenth aspect of the present invention provides a method for inhibiting the expression level of the NADK gene in vitro or in vivo, the method comprising administering one or more of the following to an in vivo or in vitro sample: a nucleic acid molecule as described in the first aspect of the present invention, a delivery composition as described in the second aspect of the present invention, a nucleic acid protein composition as described in the third aspect of the present invention, a pharmaceutical composition as described in the seventh aspect of the present invention, and a kit as described in the eighth aspect of the present invention, to reduce the expression level of the NADK gene.

[0042] In some embodiments of the present invention, the method is for non-diagnostic purposes, such as for knocking down the expression level of the NADK gene in laboratory experiments, and / or for studying the related mechanisms of NADK in the occurrence and development of diseases.

[0043] In some embodiments of the present invention, the in vivo or in vitro sample is derived from humans and / or mice.

[0044] In some embodiments of the present invention, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:5; or

[0045] The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or

[0046] The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:11.

[0047] In some embodiments of the present invention, the gene expression level of the NADK is reduced by at least 80% or at least 90%.

[0048] The eleventh aspect of the present invention provides the use of NADK inhibitors in the preparation of drugs for the prevention and / or treatment of liver cancer.

[0049] In some embodiments of the present invention, the NADK inhibitor is selected from:

[0050] (1) Compounds that specifically inhibit NADK expression;

[0051] (2) Interfering molecules that specifically interfere with NADK expression;

[0052] (3) Antibodies or ligands that specifically bind to NADK protein;

[0053] (4) NADK gene knockout reagent, wherein the NADK gene knockout reagent is a gene editing reagent that specifically knocks out NADK.

[0054] In some embodiments of the present invention, the NADK inhibitor is selected from one or more of the nucleic acid molecules described in the first aspect of the present invention, the delivery composition described in the second aspect of the present invention, the nucleic acid protein composition as described in claim 5, the pharmaceutical composition described in the seventh aspect of the present invention, and the kit as described in the eighth aspect of the present invention.

[0055] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0056] The reagents and raw materials used in this invention are all commercially available.

[0057] The positive and progressive effects of this invention are as follows:

[0058] This invention demonstrates that NADK inhibitors can be used to treat liver cancer. Furthermore, the siRNA provided in this invention exhibits stronger cytotoxicity against HepG2 cells compared to previously disclosed NADK target sequences, effectively inhibiting the proliferation of liver cancer cells both in vitro and in vivo, thus achieving a tumor-suppressive effect. In addition, the siRNA designed in this invention can simultaneously knock down the mRNA levels of both human and mouse NADK genes, facilitating scientific research and the development of tumor drugs. Attached Figure Description

[0059] Figure 1This demonstrates that si-NADK-2 can target and knock down NADK, thus affecting HepG2 activity.

[0060] Figure 2 The mRNA expression level of NADK in HepG2 cells transfected with siRNA was shown.

[0061] Figure 3 The study showed that targeted knockdown of NADK can inhibit the proliferation of HepG2 tumor cells in mice.

[0062] Figure 4 The results showed that si-NADK-457, si-NADK-458, and si-NADK-459 could reduce the viability of HepG2 cells.

[0063] Figure 5 The results showed that si-NADK-457, si-NADK-458, and si-NADK-459 had no effect on the viability of primary mouse livers.

[0064] Figure 6 The effects of si-NADK-457, si-NADK-458, and si-NADK-459 on the mRNA expression level of NADK in HepG2 cells were shown.

[0065] Figure 7 The effects of si-NADK-457, si-NADK-458, and si-NADK-459 on the mRNA expression level of NADK in primary mouse hepatocytes were shown.

[0066] Figure 8 The results showed that si-NADK-2 could not reduce the mRNA level of NADK in primary mouse hepatocytes.

[0067] Figure 9 The effects of different concentrations of si-NADK-459 and si-NADK-2 on the proliferation of HepG2 cells were shown.

[0068] Figure 10 The study showed that si-NADK-459-targeted knockdown of NADK can inhibit the proliferation of HepG2 tumor cells in mice.

[0069] Figure 11 The effect of si-NADK-459 on NADK transcription levels in HepG2 tumor cells in mice was demonstrated. Detailed Implementation

[0070] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0071] The raw materials and equipment involved in the following embodiments include:

[0072] Experimental instruments: DMSO was purchased from Sigma-Aldrich; DMEM (containing D-glucose 4.5 g / L, L-glutamine, and sodium pyruvate), fetal bovine serum (FBS), and 10×PBS were purchased from Gibco; 0.25% trypsin-EDTA, phenol red, and DMEM / F12 were purchased from Thermo Fisher; Trizol was purchased from Sigma; reverse transcriptase and SYBR Green fluorescent dye were purchased from Takara. The LNP packaging kit was purchased from Cayman (catalog number 36970). 293T cells were ATCC's human embryonic kidney cell line (catalog number CRL-3216).

[0073] Tissue homogenizer (Shanghai Biheng Biotechnology Co., Ltd.), low-temperature high-speed centrifuge (Eppendorf, 5415R), cell culture incubator (Thermo Fisher Scientific, 371), ultrapure water preparation system (Pall Cascada), AppliedBio-system 7500fast real-time PCR instrument (Thremo), and upright / inverted integrated fluorescence microscope (Echo Revolve).

[0074] Experimental cells: HepG2 cells, HEK-293T cells, and primary mouse hepatocytes.

[0075] Experimental animals: Male Balb / c strain mice, weighing 22-25g, purchased from Shanghai Southern Model Biotechnology Co., Ltd.

[0076] Example 1: Design and screening of siRNA sequences that can efficiently knock down NADK mRNA expression levels in human hepatocellular carcinoma cells HepG2.

[0077] Detailed operation steps:

[0078] The target sequence of si-NADK-2 (as shown in SEQ ID NO:1, and the sequences of the sense and antisense strands as shown in SEQ ID NO:2 and 3, respectively) and siNC (as shown in SEQ ID NO:13, and the sequences of the sense and antisense strands as shown in SEQ ID NO:14 and 15, respectively) were designed and synthesized for siRNA LNP packaging. HepG2 cells were transfected with the packaged siRNA at a final concentration of 100 nM. Cells were photographed under a microscope 72 h post-transfection, and their morphology was recorded using trypan blue staining. Results are as follows: Figure 1 As shown, this indicates that targeted knockdown of NADK can affect the activity of HepG2.

[0079] Subsequently, HepG2 cells from each group were collected, RNA was extracted and reverse transcribed, and the mRNA expression level of NADK in each cell was detected using qPCR. The results are as follows: Figure 2 As shown, si-NADK-2 can specifically knock down the mRNA level of NADK in HepG2 cells.

[0080] The target sequence for si-NADK-2 is: GCATTGGAACGTCCGGAAGAA (SEQ ID NO:1)

[0081] The antisense chain of si-NADK-2: UUCUUCCGGACGUUCCAAUGC (SEQ ID NO:2)

[0082] The Chain of Justice of si-NADK-2: GCAUUGGAACGUCCGGAAGAA (SEQ ID NO:3)

[0083] The target sequence of siNC is: TTCTCCGAACGTGTCAGGT (SEQ ID NO:13)

[0084] The ansense chain of siNC: ACCUGACACGUUCGGAGAA (SEQ ID NO:14)

[0085] siNC's Chain of Justice: UUCUCCGAACGUGUCAGGU (SEQ ID NO:15)

[0086] Example 2: Antitumor efficacy of si-NADK-2 in HepG2 tumor-bearing mice

[0087] Detailed operation steps:

[0088] LNPs were packaged based on the screened si-NADK-2. HepG2 was used to subcutaneously implant tumors in mice. After tumor growth, the HepG2-bearing mice were injected intratumorally with siRNA LNP at a dose of 2.5 nmol per mouse, administered twice weekly for two weeks. Tumor size was measured before each administration. Tumor measurement: After the tumor was visibly formed, the short diameter (W) and long diameter (L) of the transplanted tumor were measured using calipers, and the result was calculated using the formula V = (W / L). 2 Calculate the tumor volume using (×L) / 2.

[0089] The tumor-inhibiting effect after administration is as follows: Figure 3 As shown, targeted knockdown of NADK can inhibit the proliferation of HepG2 tumor cells in mice.

[0090] Example 3: Screening for siRNA sequences that are homologous to human and mouse cells and effectively inhibit NADK mRNA levels.

[0091] Detailed operation steps:

[0092] The three siRNAs, si-NADK-457 (si457), si-NADK-458 (si458), and si-NADK-459 (si459), were designed and synthesized, and then packaged as LNPs. HepG2 cells and primary mouse hepatocytes were transfected with the packaged siRNA LNPs at a final concentration of 100 nM. The effects on tumor cells and normal mouse hepatocytes were examined under a microscope 72 hours after transfection.

[0093] The results are as follows Figure 4 As shown, compared with si-NC, si-NADK-457, si-NADK-458, and si-NADK-459 have a certain impact on the viability of HepG2 cells, among which si-NADK-459 has the most significant effect. Figure 5 The results indicate that si-NADK-457, si-NADK-458, and si-NADK-459 had no effect on the viability of primary mouse liver cells. These results suggest that knocking down NADK can effectively inhibit tumor cell proliferation, but has no significant effect on the viability of normal hepatocytes.

[0094] The target sequence of si-NADK-457 is: ATCTGTATGTGGAAAAGAAA (SEQ ID NO:4)

[0095] The ansense chain of si-NADK-457: UUUCUUUUCCACAUACACGAU (SEQ ID NO:5)

[0096] The Chain of Justice of si-NADK-457: AUCGUGUAUGUGGAAAAGAAA (SEQ ID NO:6)

[0097] The target sequence of si-NADK-458 is: CGTGTATGTGGAAAAGAAAGT (SEQ ID NO:7)

[0098] The antisense chain of si-NADK-458: ACUUUCUUUUCCACAUACACG (SEQ ID NO:8)

[0099] The Chain of Justice of si-NADK-458: CGUGUAUGUGGAAAAGAAAGU (SEQ ID NO:9)

[0100] The target sequence of si-NADK-459 is: TTGATGGACGGAAGAGACA (SEQ ID NO:10)

[0101] The ansense chain of si-NADK-459: UGUCUCUUCCGUCCAUCAA (SEQ ID NO:11)

[0102] The Justice Chain of si-NADK-459: UUGAUGGACGGAAGAGACA (SEQ ID NO:12)

[0103] Subsequently, cells from each group were collected, RNA was extracted and reverse transcribed, and the mRNA expression level of NADK in the cells was detected by qPCR. The results showed that si-NADK-457, si-NADK-458, and si-NADK-459 could significantly reduce the expression level of HepG2 cells (…). Figure 6 ) and the mRNA level of NADK in primary mouse hepatocytes ( Figure 7 ), while si-NADK-2 could not reduce the mRNA level of NADK in primary mouse hepatocytes ( Figure 8 The three target sequences si-NADK-457, si-NADK-458, and si-NADK-459 can all be used for subsequent efficacy studies and in vivo safety assessments in mice.

[0104] Example 4: Comparison of the effects of si-NADK-459 and si-NADK-2 on the viability of HepG2 cells

[0105] Detailed operation steps:

[0106] LNPs were packaged using the selected si-NADK-459 and si-NADK-2. 10 nM, 50 nM, 100 nM, and 500 nM of si-NADK-459, si-NADK-2, and the control si-NC were added to 3000 HepG2 cells, respectively. After 48 hours, the activity of HepG2 cells in each group was detected using CCK8. The results are as follows... Figure 9 As shown, si-NADK-459 has a better inhibitory efficiency on HepG2 proliferation than si-NADK-2.

[0107] Example 5: Antitumor efficacy of si-NADK-459 in HepG2 tumor-bearing mice

[0108] Detailed operation steps:

[0109] LNPs were packaged based on the selected si-NADK-459 target sequence. HepG2 was used to subcutaneously implant tumors in mice. After tumor growth, HepG2 was administered intratumorally to the tumor-bearing mice at a dose of 2.5 nmol per mouse, twice weekly for two weeks. Tumor size was measured before each administration. Tumor measurement: After tumor formation was visible to the naked eye, the short diameter (W) and long diameter (L) of the transplanted tumor were measured using calipers. The result was calculated using the formula V = (W / L) * ... 2 The tumor volume was calculated as (×L) / 2. The inhibitory effect on the tumor after drug administration was as follows: Figure 10 As shown, targeted knockdown of NADK can inhibit the proliferation of HepG2 tumor cells in mice.

[0110] Tumor tissues were collected from mice in each group, RNA was extracted and reverse transcribed, and the mRNA expression level of NADK in cells was detected by qPCR. The results are as follows: Figure 11 By using si-NADK-459 to target and knock down NADK, the NADK transcription level in HepG2 tumor cells can be reduced in mice.

Claims

1. A nucleic acid molecule comprising a sense strand and an antisense strand forming an inverted complementary double-stranded region, characterized in that, The antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides in a sequence as shown in SEQ ID NO:2, 5, 8, or 11.

2. The nucleic acid molecule of claim 1, wherein, The positive strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides in a sequence as shown in SEQ ID NO:3, 6, 9, or 12; Preferably, the lengths of the sense strand and the antisense strand each independently comprise 19 to 23 nucleotides; more preferably, they each independently comprise 19 to 21 nucleotides. The length of the reverse complementary double-stranded region is 17 to 21 bp, for example, 19 bp or 21 bp; More preferably, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:3, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:2; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:5; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

11.

3. The nucleic acid molecule of claim 1 or 2, wherein The nucleic acid molecule is shRNA, which further includes a hairpin loop, wherein the 5' end of the hairpin loop is connected to the 3' end of the sense strand, and the 3' end of the hairpin loop is connected to the 5' end of the antisense strand; preferably, the hairpin loop is selected from RNA sequences AUG, CCC, UUCG, CCACC, AAGCUU, CCACACC, and UUCAAGAGA; or The nucleic acid molecule is siRNA, and the sense and antisense strands complement each other to form an RNA dimer.

4. A delivery composition characterized in that, The delivery composition comprises the nucleic acid molecule and delivery vector as described in any one of claims 1 to 3; Preferably, the delivery vector is selected from lipid carriers, lipid-like carriers, coupling ligands, polymers and exosome carriers; and / or, the reverse complementary double-stranded region or hairpin structure of the nucleic acid molecule is connected to the delivery vector; More preferably, the coupling ligand is selected from carbohydrates, peptides, antibodies, aptamers, and small molecules; the lipid carrier is selected from LNP, cholesterol, and Dlin-DMA / MC3-DMA; the lipid carrier is selected from nanoparticles (e.g., endoplasmic reticulum membrane-modified nanoparticles, polymer nanoparticles, lipid polymer complexes), PEI particles, and PLGA particles, preferably inorganic nanoparticles; the polymer is a dendritic molecule, such as PBAVE polymer, DPC1.0, or DPC2.0; the reverse complementary double-stranded region or hairpin loop is connected to the delivery carrier via a linker with monovalent, divalent, or trivalent branches; preferably, the 3' end of the positive strand of the reverse complementary double-stranded region is connected to the delivery carrier via a linker. More preferably, the carbohydrate is selected from sugars, fatty acid oligosaccharides, and polysaccharides, and the fatty acid oligosaccharides are preferably selected from monosaccharides, disaccharides, trisaccharides, and tetrasaccharides; the monosaccharide is preferably GalNAc, such as L96; and the polypeptide is an RGD polypeptide.

5. A nucleic acid protein composition, characterized in that, The nucleic acid protein composition comprises a nucleic acid molecule as described in any one of claims 1 to 3, and a nuclease; the nuclease is preferably an AGO protein; Alternatively, the nucleic acid protein composition comprises the antisense strand of the nucleic acid molecule as described in any one of claims 1 to 3, and a nuclease; the nuclease is preferably an AGO protein.

6. A recombinant vector, characterized in that, The recombinant vector comprises the coding sequence of a nucleic acid molecule as described in any one of claims 1 to 3; preferably, the starting vector of the recombinant vector is a plasmid or a viral vector.

7. A transformant, characterized in that, The transformant comprises the coding sequence of a nucleic acid molecule as described in any one of claims 1 to 3 or the recombinant vector as described in claim 6; the host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

8. A method for preparing the nucleic acid molecule as described in any one of claims 1 to 3, characterized in that, The method includes culturing the transformant as described in claim 7, or directly obtaining the nucleic acid molecule using chemical synthesis and mixing.

9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a nucleic acid molecule as described in any one of claims 1 to 3, a delivery composition as described in claim 4, a recombinant vector as described in claim 6, or a transformant as described in claim 7, and a pharmaceutically acceptable carrier; Preferably, the carrier is water, saline solution or buffer solution; More preferably, the buffer in the buffer solution includes acetate, citrate, alcohol-soluble gluten, carbonate or phosphate, Tris-hydrochloric acid or any combination thereof; for example, phosphate.

10. A medicine box set, characterized in that, The kit includes kit A, which contains a reagent kit, the reagent kit comprising one or more of the following: the nucleic acid molecule as described in any one of claims 1 to 3, the delivery composition as described in claim 4, the recombinant vector as described in claim 6, the transformant as described in claim 7, and the pharmaceutical composition as described in claim 9; Preferably, the pillbox further includes a pillbox B, which contains one or more of the following: (1) Other drugs that inhibit NADK gene expression or compositions containing the drugs that inhibit NADK gene expression; (2) One or more of the following groups: hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines; and, (3) Other drugs that inhibit NADK gene expression, compositions containing said drugs that inhibit NADK gene expression, and one or more of the group consisting of hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

11. The use of one or more of the following in the preparation of a product for inhibiting the expression level of the NADK gene, or for the prevention and / or treatment of liver cancer: the nucleic acid molecule of any one of claims 1 to 3, the delivery composition of claim 4, the recombinant vector of claim 6, the transformant of claim 7, the pharmaceutical composition of claim 9, and the kit of claim 10; Preferably, the expression level of the NADK gene refers to the expression level of the NADK gene in in vivo or in vitro samples from the source human and / or mouse. Further preferably, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:5; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

11.

12. A method for inhibiting the expression level of the NADK gene in vitro or in vivo, characterized in that, The method comprises administering one or more of the following to an in vivo or in vitro sample: a nucleic acid molecule as described in any one of claims 1 to 3, a delivery composition as described in claim 4, a nucleic acid protein composition as described in claim 5, a pharmaceutical composition as described in claim 9, and a kit as described in claim 10, to reduce the expression level of the NADK gene; Preferably, the method is not for diagnostic purposes; And / or, the in vivo or in vitro sample is derived from humans or / or mice; More preferably, the nucleotide sequence of the sense strand is as shown in SEQ ID NO:6, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO:5; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:8; or The nucleotide sequence of the sense strand is shown in SEQ ID NO:12, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

11. More preferably, the gene expression level of the NADK is reduced by at least 80% or at least 90%.

13. Application of NADK inhibitors in the preparation of drugs for the prevention and / or treatment of liver cancer; Preferably, the NADK inhibitor is selected from: (1) Compounds that specifically inhibit NADK expression; (2) Interfering molecules that specifically interfere with NADK expression; (3) Antibodies or ligands that specifically bind to NADK protein; (4) NADK gene knockout reagent, wherein the NADK gene knockout reagent is a gene editing reagent that specifically knocks out NADK; More preferably, the NADK inhibitor is selected from one or more of the nucleic acid molecules as described in any one of claims 1 to 3, the delivery composition as described in claim 4, the nucleic acid protein composition as described in claim 5, the pharmaceutical composition as described in claim 9, and the kit as described in claim 10.

Images