Application of wheat TaMRS2-16 protein in regulating photosynthetic rate

By cloning and functionally identifying the wheat TaMRS2-16 protein gene, and regulating magnesium ion transport to bind to core proteins of the photosynthetic system, the technical challenge of improving wheat photosynthetic efficiency was solved, resulting in a significant increase in photosynthetic rate and biomass.

CN122303255APending Publication Date: 2026-06-30HENAN CROP MOLECULAR BREEDING RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610540116.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-22
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In the current technology, research on the role of wheat magnesium ion transporter genes in regulating photosynthesis is relatively scarce, especially since their specific functions in the photosynthetic system are not clear, making it difficult to improve the photosynthetic efficiency of wheat through molecular design.

Method used

The wheat TaMRS2-16 protein gene was cloned and functionally identified. By overexpressing or knocking out this gene in wheat, magnesium ion transport was regulated to enhance magnesium ion transport in the chloroplast membrane system, which in turn enhanced the photosynthetic rate by binding to core proteins of the photosynthetic system.

Benefits of technology

It significantly improves the photosynthetic rate, chlorophyll content, and biomass of wheat, enhances photosynthetic capacity, and provides new target genes and molecular markers for high photosynthetic efficiency breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303255A_ABST
    Figure CN122303255A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the wheat TaMRS2-16 protein in regulating photosynthetic rate. The purpose of this invention is to provide a novel use for the wheat TaMRS2-16 gene, namely, its application in regulating wheat photosynthetic rate. Through functional genomics, this invention, for the first time, clarifies the positive regulatory role of the TaMRS2-16 gene in wheat photosynthetic rate, providing new target genes and molecular markers for molecular breeding of high-efficiency wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of wheat TaMRS2-16 protein in regulating photosynthetic rate. Background Technology

[0002] Photosynthesis is the core physiological process by which green plants convert light energy into chemical energy, and it is the foundation of crop yield. Improving the photosynthetic efficiency of crops is considered one of the key ways to further increase crop yield. However, it is becoming increasingly difficult to further increase wheat yield through traditional breeding methods.

[0003] Magnesium ions are essential mesonutrients for plant growth and development, and are the central atom of chlorophyll molecules, playing a crucial role in maintaining chloroplast structure and the integrity of the photosynthetic electron transport chain. Furthermore, magnesium ions are activators of key photosynthetic enzymes such as Rubisco (ribulose-1,5-bisphosphate carboxylase / oxygenase). Although the importance of magnesium ions in photosynthesis has long been recognized, research on the molecular mechanisms regulating magnesium ion transport and distribution in chloroplasts, particularly the specific gene functions in major crops such as wheat, remains relatively scarce.

[0004] Currently, although there are some reports on magnesium ion transporter genes in plants, these studies are mostly focused on the model plant Arabidopsis thaliana, and most studies focus on the nutrient absorption of magnesium ions and stress response. There is a lack of detailed functional verification on the direct regulation of the activity of core protein complexes in the photosynthetic system and the overall photosynthetic rate by specific magnesium ion transporter genes. Therefore, discovering and identifying key functional genes that can significantly affect wheat photosynthesis is of significant theoretical and practical value for breeding new wheat varieties with high photosynthetic efficiency through molecular design breeding. Summary of the Invention

[0005] This invention provides the cloning, functional identification, and application of a specific wheat magnesium ion transporter gene, TaMRS2-16 (TraesCS4A02G286400), in regulating the rate of plant photosynthesis, particularly its use in increasing the rate of wheat photosynthesis, chlorophyll content, and biomass.

[0006] The purpose of this invention is to provide a novel application for the wheat TaMRS2-16 gene, specifically its role in regulating the rate of wheat photosynthesis. Through functional genomics, this invention, for the first time, clarifies the positive regulatory role of the TaMRS2-16 gene in the rate of wheat photosynthesis, providing new target genes and molecular markers for molecular breeding of high-efficiency wheat.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] The application of the TaMRS2-16 protein (amino acid sequence as shown in SEQ ID NO:4), the nucleic acid encoding the TaMRS2-16 protein, and biological materials containing said nucleic acid in regulating the rate of wheat photosynthesis, wherein said biological material is an expression cassette, transposon, plasmid vector, viral vector, or host cell. The nucleic acid sequence is shown in SEQ ID NO:3, or a homologous sequence with equivalent function obtained by substituting, deleting, or adding one or more nucleotides to that sequence.

[0009] Specifically, the regulation refers to positively regulating the photosynthetic rate of wheat, that is, increasing the photosynthetic rate of wheat. Therefore, this invention also provides the application of TaMRS2-16 protein with the amino acid sequence shown in SEQ ID NO:4, nucleic acid encoding TaMRS2-16 protein, and biomaterials containing said nucleic acid in increasing the photosynthetic rate of wheat.

[0010] The present invention also provides a method for increasing the photosynthetic rate of wheat, comprising: enhancing the activity of the TaMRS2-16 protein shown in SEQ ID NO:4 or increasing the expression level of the nucleic acid encoding the TaMRS2-16 protein.

[0011] In a further embodiment, the method includes driving the expression of the nucleic acid using a constitutive promoter or a photosynthesis-related tissue-specific promoter (such as a chloroplast-specific promoter).

[0012] In a further embodiment, the method includes: overexpressing nucleic acid encoding TaMRS2-16 protein in recipient wheat to obtain transgenic wheat; the photosynthetic rate of the transgenic wheat is higher than that of the recipient wheat.

[0013] In a further approach, a plant expression vector containing nucleic acid encoding the TaMRS2-16 protein was transformed into immature wheat embryos, and transgenic positive lines were screened.

[0014] The present invention has the following beneficial effects:

[0015] Functional verification experiments revealed that the TaMRS2-16 gene described in this invention has a significant ability to regulate wheat photosynthesis.

[0016] When this gene is knocked out: the plant exhibits reduced Rubisco activity, reduced chlorophyll content, reduced net CO2 fixation rate in leaves, weakened photosynthetic capacity, and slower growth.

[0017] When this gene is overexpressed: plants exhibit enhanced Rubisco activity, significantly increased chlorophyll content, enhanced net CO2 fixation rate in leaves, significantly enhanced photosynthetic capacity, better plant growth, and increased biomass.

[0018] Molecular mechanism studies have shown that the TaMRS2-16 gene encodes a magnesium ion transporter protein that can be localized to chloroplasts or related membrane systems. By regulating magnesium ion transport, this protein binds to core proteins in the photosynthetic system (such as TaPsaA and TaPsaB), thereby enhancing the photosynthetic rate. This indicates that TaMRS2-16 is a key gene for improving wheat photosynthetic performance and yield potential, possessing extremely high commercial breeding value.

[0019] This invention provides a novel, specific gene target for breeding high photosynthetic efficiency in wheat. While existing technologies clearly demonstrate the importance of magnesium ions in photosynthesis and studies have shown the presence of magnesium ion transporters in Arabidopsis thaliana, the gene functions of Arabidopsis thaliana and wheat, as model plants and food crops respectively, exhibit species-specific characteristics. Existing technologies have not disclosed any direct association between wheat MRS2 family genes (especially TaMRS2-16) and photosynthesis, nor have they demonstrated that this gene can directly bind to core photosynthetic proteins and enhance photosynthetic rates by regulating chloroplast magnesium ion transport.

[0020] This invention is the first to clone and functionally validate the wheat TaMRS2-16 gene, clarifying its subcellular localization in the chloroplast membrane and its direct interaction mechanism with TaPsaA / B. It breaks through the limitations of existing technologies that focus only on "nutrient absorption / stress response" in magnesium ion transporter research, and for the first time directly links it to the activity regulation of the core protein complex of the photosynthetic system, providing a unique gene target for molecular breeding of wheat with high light efficiency, rather than a simple "species migration". Attached Figure Description

[0021] Figure 1 : Structure and phylogenetic tree analysis of the TaMRS2-16 gene. (A) TaMRS2-16 gene; (B) MRS2 family proteins are divided into five types: A, B, C, D, and E.

[0022] Figure 2 Analysis of TaMRS2-16 gene overexpression lines compared with wild-type lines.

[0023] Figure 3 Analysis of knockout sites in the gene-edited TaMRS2-16 strain.

[0024] Figure 4 Effects of TaMRS2-16 gene overexpression on wheat photosynthetic indicators. (A) Phenotypic comparison between wild-type and transgenic plants; (B) Net photosynthetic rate measurement results; (C) Rubisco enzyme activity detection results; (D) Plant height measurement results; (E) Chlorophyll content measurement results; (F) Fresh weight measurement results.

[0025] Figure 5 Effects of CRISPR-Cas9 knockout of the TaMRS2-16 gene on wheat photosynthesis. (A) Phenotypic identification of gene-edited plants; (B) Net photosynthetic rate measurement results; (C) Rubisco enzyme activity detection results; (D) Plant height measurement results; (E) Chlorophyll content measurement results; (F) Fresh weight measurement results.

[0026] Figure 6 Subcellular localization analysis of TaMRS2-16 protein.

[0027] Figure 7 Validation results of the interaction between TaMRS2-16 protein and photosynthetic system proteins (TaPsaA / B). (A) Validation of the interaction between Y2H and (B) LUC. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0029] Example 1

[0030] The CDS, gDNA, and protein sequences of the TaMRS2-16 gene (TraesCS4A02G286400) were downloaded from the wheat genome database Ensembl Plants. Simultaneously, MRS2 homologous protein sequences from rice, maize, Arabidopsis thaliana, *Sedum morganianum*, *Triticum aestivum*, tomato, and rapeseed were also downloaded. Using TBtools software, an exon-intron structure diagram was drawn; using MEGA X software, a phylogenetic tree was constructed using the neighbor-joining (NJ) method, and then visualized using the iTol website (iTOL: Interactive Tree Of Life). Figure 1 As shown, phylogenetic analysis of five monocotyledonous plants (rice O. sativa, maize Z. mays, wheat T. aestivum, sweetgrass S. spontaneum, and wheat paniculata T. turgidum) and three dicotyledonous plants (Arabidopsis thaliana, tomato S. lycopersicum, and rapeseed B. napus) revealed that MRS2 family proteins are classified into five types: A, B, C, D, and E, with TaMRS2-16 belonging to type E.

[0031] Example 2: Cloning and vector construction of the wheat TaMRS2-16 gene

[0032] Total RNA was extracted from the wheat variety Zhengmai 1860, and cDNA was obtained by reverse transcription. Using the TraesCS4A02G286400 sequence from the Ensembl Plants database as a reference sequence, specific amplification primers TaMRS2-16-CDS-F: 5'-GCCCTCCACCTCGCCATT-3' (SEQ ID NO:1) and TaMRS2-16-CDS-R: 5'-GATCCATACGTGCCTCCA-3' (SEQ ID NO:2) were designed. Then, using the obtained cDNA from Zhengmai 1860 as a template, the full-length CDS sequence of TaMRS2-16 was amplified by PCR. The amplified product was ligated into the pMD19-T vector for sequencing verification. The obtained full-length CDS of TaMRS2-16 is shown in SEQ ID NO:3, and the amino acid sequence encoding the TaMRS2-16 protein is shown in SEQ ID NO:4.

[0033] Subsequently, the verified fragment was subcloned into the BamHI restriction site of the plant overexpression vector pWMB110 to construct the overexpression vector Ubi::TaMRS2-16 driven by the Ubi promoter.

[0034] Simultaneously, a specific sgRNA sequence (CAGGCCATATTACTCAACCTTGG (SEQ ID NO:5), where TGG is a PAM sequence) targeting the TaMRS2-16 gene was designed, and a DNA fragment containing the sgRNA sequence was ligated into the CRISPR / Cas9-carrying vector pBUE411 to obtain the TaMRS2-16 gene knockout vector.

[0035] Example 3: Genetic transformation of wheat and acquisition of transgenic plants

[0036] Using Agrobacterium-mediated transformation, the constructed overexpression vector or gene knockout vector was transformed into wheat (Fielder variety) embryos. After callus induction, selection, and differentiation, T0 generation transgenic plants were obtained. These were then propagated through sowing until T3 generation TaMRS2-16 transgenic wheat and T3 generation TaMRS2-16 gene-edited wheat were obtained.

[0037] Then, the TaMRS2-16 transgenic wheat was identified by kanamycin resistance screening and qPCR. Total RNA was extracted from leaves of T3 generation TaMRS2-16 transgenic wheat (Ubi TaMRS2-16 transgenic wheat) and recipient wheat, and cDNA was obtained by reverse transcription. Using the cDNA template, PCR products were obtained by amplification using primers (TaMRS2-16 qRTF and TaMRS2-16 qRTR) and (ActinF RTF and ActinR RTR), respectively. Actin was used as an internal control gene.

[0038] The primers used to detect the TaMRS2-16 gene are as follows:

[0039] TaMRS2-16 qRTF: 5'-TCCATGCTCTTCATATCAGCCG-3' (SEQ ID NO: 6);

[0040] TaMRS2-16 qRTR: 5'-TAGGATGGGAGTTGCATCGAC-3' (SEQ ID NO:7);

[0041] The primers used to detect the Actin gene are as follows:

[0042] ActinF RTF: 5'-GAGGCAAGATGAGCACCAAG-3' (SEQ ID NO: 8);

[0043] ActinR RTR: 5'-TTCAAGCCAGTTGGGGGA-3' (SEQ ID NO:9).

[0044] like Figure 2 As shown, compared with the wild type, the expression level of TaMRS2-16 gene was significantly increased in the overexpression lines OE-3 and OE-7.

[0045] DNA was extracted from T3 generation TaMRS2-16 gene-edited plants for sequencing to confirm the mutation status of the gene editing sites. The sequencing primers are as follows:

[0046] The primers used to detect the TaMRS2-16 gene editing site sequence are as follows:

[0047] Primers for detecting TraesFLD4A01G298900:

[0048] Q-122496-4A-F1: 5'-GTCATTGCTTGTCGTGACCG-3' (SEQ ID NO: 10);

[0049] Q-122496-4A-R1: 5'-ATGTGTAGTGGTGGTATATG-3' (SEQ ID NO: 11);

[0050] Primers for detecting TraesFLD4B01G031700:

[0051] Q-122496-4B-F2: 5'-GGTGTTTCAGACTGCAACTGT-3' (SEQ ID NO: 12);

[0052] Q-122496-4B-R2: 5'-AATGTGTAGTAGTGGTATATAGAG-3' (SEQ ID NO: 13);

[0053] Primers for detecting TraesFLD4D01G027800:

[0054] Q-122496-4D-F3: 5'-GTGTCGTTGCGTGTATGTGA-3' (SEQ ID NO: 14);

[0055] Q-122496-4D-R3: 5'-AAAGTAACGTGTGGTGGC-3' (SEQ ID NO: 15).

[0056] like Figure 3 As shown, the two gene-edited wheat lines, tamrs2-16-2 and tamrs2-16-5, all underwent mutations in all three subgenomes of ABD, and both were homozygous mutations.

[0057] Example 4: Phenotypic analysis of transgenic plants

[0058] The obtained overexpression lines, gene knockout lines, and wild-type control plants were planted in greenhouses or artificial climate chambers. The following indicators were measured.

[0059] (1) Measurement of photosynthetic physiological indicators:

[0060] The net CO2 fixation rate (i.e., net photosynthetic rate) of leaves was determined using a portable photosynthesis measurement system.

[0061] The total chlorophyll content of leaves was determined using an enzyme-linked immunosorbent assay (ELISA) reader.

[0062] Rubisco enzyme activity was extracted and measured using spectrophotometry.

[0063] (2) Growth index records:

[0064] Record plant growth data such as plant height and fresh weight.

[0065] like Figure 4 As shown, compared with the wild type, the chlorophyll content of transgenic wheat plants overexpressing the TaMRS2-16 gene was significantly increased ( Figure 4 E); Rubisco activity enhanced ( Figure 4 C); Net photosynthetic rate significantly increased ( Figure 4 B); the plants grew more vigorously, as evidenced by a significant increase in plant height and fresh weight ( Figure 4 (A, D, F).

[0066] On the contrary, such as Figure 5 As shown, mutant plants with the CRISPR-Cas9 gene knocked out TaMRS2-16 exhibited reduced chlorophyll content ( Figure 5 E); Rubisco activity decreased ( Figure 5 C); Net photosynthetic rate decreased ( Figure 5 B); slow growth, manifested in a significant reduction in plant height and fresh weight ( Figure 5 (A, D, F).

[0067] Example 5: Molecular Mechanism Study

[0068] Subcellular localization experiments confirmed that the TaMRS2-16 protein is located in the chloroplast membrane, such as... Figure 6 As shown.

[0069] Further experiments using yeast two-hybrid (Y2H) or bimolecular fluorescence complementation (LUC) were conducted to verify the interaction between TaMRS2-16 protein and proteins such as TaPsaA and TaPsaB in the photosynthetic system. Figure 7 The results show that TaMRS2-16 directly participates in and enhances the assembly or activity of the photosynthetic complex by transporting magnesium ions, thus explaining its regulatory mechanism on photosynthesis.

[0070] In summary, this invention successfully cloned the TaMRS2-16 gene and confirmed its crucial role in regulating wheat photosynthesis through reverse genetics experiments. Overexpression of this gene significantly improves wheat photosynthetic efficiency and growth potential, demonstrating broad application prospects.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of TaMRS2-16 protein with the amino acid sequence shown in SEQ ID NO:4, nucleic acid encoding TaMRS2-16 protein, and biological material containing said nucleic acid in regulating the rate of wheat photosynthesis, wherein said biological material is an expression cassette, transposon, plasmid vector, viral vector, or host cell.

2. The application according to claim 1, characterized in that, The sequence of the nucleic acid is shown in SEQ ID NO:

3.

3. The TaMRS2-16 protein with the amino acid sequence shown in SEQ ID NO:4, the nucleic acid encoding the TaMRS2-16 protein, and the application of biomaterials containing the nucleic acid in improving the photosynthetic rate of wheat.

4. The application according to claim 3, characterized in that, The sequence of the nucleic acid is shown in SEQ ID NO:

3.

5. A method for increasing the photosynthetic rate of wheat, comprising: This can be achieved by enhancing the activity of the TaMRS2-16 protein shown in SEQ ID NO:4 or by increasing the expression level of the nucleic acid encoding the TaMRS2-16 protein.

6. The method according to claim 5, characterized in that, The method includes: using constitutive promoters and photosynthesis-associated tissue-specific promoters to drive the expression of the nucleic acid.

7. The method according to claim 5, characterized in that, The method includes: overexpressing nucleic acid encoding TaMRS2-16 protein in recipient wheat to obtain transgenic wheat; the photosynthetic rate of the transgenic wheat is higher than that of the recipient wheat.

8. The method according to claim 7, characterized in that, Plant expression vectors containing nucleic acids encoding the TaMRS2-16 protein were transformed into immature wheat embryos, and transgenic positive lines were obtained by screening.