Method for screening transcription factor regulating synthesis of kiwifruit flavonoids and application thereof

Abstract

This invention belongs to the field of bioengineering technology and provides a method for screening transcription factors that regulate flavonoid synthesis in kiwifruit and its application. This invention systematically evaluates the 'Hongyang' kiwifruit variety using transcriptome sequencing and dual-luciferase analysis, assessing the activation effects of ERF122 and HZP66 proteins on key genes involved in flavonoid synthesis. Results show that both ETH and 1-MCP significantly promote flavonoid accumulation. Transcriptome sequencing identified 285 differentially expressed genes and identified 10 potential regulatory transcription factors, among which ERF122 and HZP66 proteins can directly bind to and activate the promoters of the key flavonoid synthesis genes AcPAL1 / 2, respectively. This invention improves the molecular regulatory network of flavonoid metabolism in kiwifruit and provides theoretical support and molecular targets for related breeding and postharvest quality control.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to the regulation of flavonoid synthesis in kiwifruit, specifically to a method for screening transcription factors that regulate flavonoid synthesis in kiwifruit and its application. Background Technology

[0002] Kiwifruit, a perennial woody plant belonging to the genus Actinidiaceae in the family Actinidiaceae, is a popular fruit due to its unique flavor and rich content of vitamin C, amino acids, and organic acids. Kiwifruit also contains various substances that have anti-cancer, anti-inflammatory, antibacterial, and cardiovascular protective properties; moderate consumption can help boost immunity in patients. However, ripe kiwifruit softens and rots quickly, resulting in a short shelf life. Therefore, most kiwifruit is harvested unripe, requiring preservation treatments during transportation and storage to extend its market life. When kiwifruit arrives at the sales location, most fruits are still unripe and unsuitable for direct sale, necessitating ripening treatments. In post-harvest fruit processing, ethylene ripening and 1-methylcyclopropene (1-MCP) preservation are the two most widely used techniques. Ethylene is an important plant hormone that binds to ethylene receptors in plant cells to accelerate fruit softening and is commonly used for postharvest ripening. 1-Methylcyclopropene (1-MCP) is an ethylene inhibitor and can be used as a preservative to delay fruit ripening and softening, thus extending shelf life. While ethylene and 1-MCP are widely used for postharvest ripening and preservation of fruits, their effects on the intrinsic nutrients of fruits remain relatively unstudied, particularly regarding their underlying molecular mechanisms.

[0003] Previous studies, through combined metabolomics and transcriptomics analysis, comprehensively revealed the changes in metabolic substances in kiwifruit fruits under ethylene and 1-MCP treatments, and found that both promoted the accumulation of flavonoids in the fruit. Flavonoids, as an important class of secondary metabolites in the plant kingdom, possess strong antioxidant capabilities, can scavenge free radicals in the body, prevent various chronic diseases such as cancer and cardiovascular diseases, and also have multiple biological activities such as anti-inflammatory and antibacterial effects. The biosynthesis of flavonoids involves a series of enzymatic reactions that proceed sequentially in the cytoplasm, ultimately generating various flavonoid compounds with different structures and functions. Flavonoid biosynthesis begins with phenylalanine. Phenylalanine is catalyzed by phenylalanine ammonia-lyase (PAL) to produce trans-cinnamic acid, which is then converted to coumaric acid by 4-cinnamic acid hydroxylase (C4H). Coumaric acid combines with coenzyme A (CoA) to form coumaroyl-CoA. Subsequently, coumaroyl-CoA and malonyl-CoA condense under the catalysis of chalcone synthase (CHS) to form chalcone. Chalcone is rapidly converted to flavanones by chalcone isomerase (CHI), and flavanones are further hydroxylated by flavanone 3-hydroxylase (F3H) to form dihydroflavonols. From this point, the flavonoid biosynthesis pathway branches, forming various different flavonoid compounds. Dihydroflavonols can be reduced to colorless anthocyanins by dihydroflavonol 4-reductase (DFR), or oxidized to flavones by flavonol synthase (FNS), or converted to flavonols by flavonol synthase (FLS). In addition, some flavanones can be catalyzed by isoflavone synthases (IFS) to produce isoflavones. The genes encoding these enzymes play an important role in the synthesis of flavonoids, and their expression levels directly affect the synthesis and accumulation of flavonoids.

[0004] Currently, many studies have revealed the regulatory effects of transcription factors on flavonoid synthesis genes under different conditions. Zhou et al. found that in Arabidopsis thaliana, the R2R3-MYB transcription factors (MYB4, MYB7, MYB32) of Sub-group 4 can interact with SAD2 protein (importin β-like protein) and enter the cell nucleus through SAD2-mediated entry; among them, MYB4 plays a core inhibitory role, directly inhibiting the expression of the flavonoid-related pathway gene C4H (cinnamic acid 4-hydroxylase gene), thereby reducing the accumulation of flavonoid metabolic branch product sinapicoyl malic acid. When the conserved GY / FDFLGL motif at the C-terminus of these MYB transcription factors undergoes an aspartate-to-asparagine mutation, such as the D261N mutant of MYB4 and the D252N mutant of MYB7, the mutant transcription factor cannot bind to SAD2, remains in the cytoplasm, and loses its ability to enter the nucleus; its inhibitory effect on the flavonoid pathway gene C4H is completely lost, leading to upregulation of C4H gene expression and an overall increase in the expression level of genes related to flavonoid synthesis. Xie et al. found that under low temperature (17℃) and UVB binding conditions, the expression of the bHLH transcription factor MdbHLH3 in apples was upregulated. Its N-terminus (amino acid regions 1-23 and 186-228) interacts with MdMYB1 to form a complex, which directly binds to the promoters of flavonoid pathway genes MdDFR and MdUFGT, as well as the promoter of the regulatory gene MdMYB1 (which recognizes the E-box and the low-temperature response element LTR), activating the expression of these genes. Furthermore, low temperature may induce phosphorylation of MdbHLH3, enhancing its promoter binding ability and further promoting anthocyanin accumulation. At high temperature (27℃), the expression and activity of MdbHLH3 decreased, the activation effect on MdDFR and MdUFGT was weakened, and anthocyanin accumulation decreased. Shin et al. found that in Arabidopsis thaliana, under far-red light (FRc) conditions, transcription factors PIF3 and HY5 synergistically positively regulate anthocyanin synthesis. They do not mutually regulate each other's expression, but both can directly bind to the promoters of flavonoid pathway genes CHS (chalcone synthase gene), CHI (chalcone isomerase gene), F3H (flavonol 3-hydroxylase gene), F3'H (flavonol 3'-hydroxylase gene), DFR (dihydroflavonol 4-reductase gene), and LDOX (colorless anthocyanin dioxygenase gene). PIF3 binds to G-box elements, while HY5 binds to ACGT-containing elements. The regulatory effect of PIF3 depends on a functional HY5. Together, they activate the expression of these pathway genes, promoting anthocyanin accumulation. In previous studies, Li et al. found that ethylene and 1-MCP treatments can induce the expression of AcPAL1 / 2, a key enzyme gene in the flavonoid biosynthesis pathway, thereby promoting flavonoid synthesis (Li et al., 2024). However, it is still unclear how ethylene and 1-MCP treatments specifically regulate the expression of the AcPAL1 / 2 gene.

[0005] This invention aims to use 'Hongyang' kiwifruit as the research object, and screen for candidate transcription factors that regulate flavonoid synthesis by analyzing differentially expressed genes under ethylene and 1-MCP treatments. Furthermore, it will analyze the regulatory mechanisms of these candidate transcription factors on the key flavonoid metabolism genes AcPAL1 / 2 using tobacco dual-luciferase assays and EMSA. Summary of the Invention

[0006] The purpose of this invention is to provide a method for screening transcription factors that regulate the synthesis of flavonoids in kiwifruit and its application. The screened transcription factors are applied to regulate the synthesis of flavonoids in kiwifruit, thereby improving the molecular regulatory network of flavonoid metabolism in kiwifruit.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides the application of transcription factors in regulating the metabolism of flavonoids in kiwifruit, wherein the transcription factors include HZP66 and ERF122.

[0009] Preferably, the application specifically involves the transcription factor directly binding to and activating the promoters of AcPAL1 and AcPAL2, key genes for flavonoid synthesis, thereby promoting flavonoid metabolism in kiwifruit and accelerating flavonoid accumulation.

[0010] Preferably, the combination specifically involves the combination of HZP66 and AcPAL1, or the combination of ERF122 and AcPAL2.

[0011] This invention also provides a screening method for the above-mentioned transcription factors HZP66 and ERF122, the screening method specifically including:

[0012] (1) After grinding frozen kiwifruit samples into powder, sequencing analysis was performed, and differentially expressed genes were screened as candidate transcription factors.

[0013] (2) Primers were designed to verify the expression levels of candidate transcription factor genes. Candidate transcription factors were further screened based on the criteria of being upregulated by both ETH and 1-MCP treatment and having an expression pattern consistent with the accumulation trend of flavonoid metabolites.

[0014] (3) The in vivo regulatory effects of the transcription factors screened in (2) on the relevant promoters were detected by the tobacco dual-luciferase assay, and the transcription factors were further screened.

[0015] (4) The interaction between the transcription factors screened in (3) and the AcPAL1 / 2 promoter was analyzed using EMSA to obtain the final effective transcription factors.

[0016] Preferably, the primers include HZP66 F1 / R1 and ERF122 F2 / R2, wherein HZP66 F1 / R1 and ERF122F2 / R2 are specifically:

[0017] HZP66 F1: CAAAGTGATCCCATCCATCC,

[0018] HZP66 R1:TTTGGCTGAAGTGCTCCT;

[0019] ERF122 F2: CCGGAGCAGTCTTTGTCATC,

[0020] ERF122 R2: ATCGTCCAAAATGTGTGCAA.

[0021] The beneficial effects of this invention are:

[0022] This invention systematically evaluates the 'Hongyang' kiwifruit variety using transcriptome sequencing, dual-luciferase analysis, and gel migration assays, assessing the activation effects and application prospects of ERF122 and HZP66 proteins on key genes for flavonoid synthesis. Results show that both ETH and 1-MCP significantly promote flavonoid accumulation. Transcriptome sequencing screening revealed that ERF122 and HZP66 proteins can directly bind to and activate the promoters of AcPAL1 / 2, key genes for flavonoid synthesis, thus improving the molecular regulatory network of flavonoid metabolism in kiwifruit and providing theoretical support and molecular targets for related breeding and postharvest quality control. Attached Figure Description

[0023] Figure 1 This is the composition of 285 differentially expressed genes under ethylene and 1-MCP treatment in this invention;

[0024] Figure 2 This is an analysis of the gene expression levels of candidate transcription factors in this invention;

[0025] Figure 3 This invention analyzes the transcriptional regulatory effects of candidate transcription factors on the AcPAL1 and AcPAL2 promoters.

[0026] Figure 4 This is the EMSA result of ERF122 binding to the AcPAL1 promoter in this invention (A is the probe sequence on the AcPAL1 promoter used in the EMSA experiment, and the bold underlined part shows the binding sequence of the ERF122 protein; B is the EMSA result of ERF122 binding to the AcPAL1 promoter, and the competitive probe (cold probe) is a probe without 3' biotin labeling).

[0027] Figure 5This is the EMSA result of HZP66 binding to the AcPAL2 promoter in this invention (A is the probe sequence on the AcPAL2 promoter used in the EMSA experiment, and the bold underlined part shows the binding sequence of HZP66 protein; B is the EMSA result of HZP66 binding to the AcPAL2 promoter, and the competitive probe (cold probe) is a probe without 3' biotin labeling). Detailed Implementation

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0031] Example

[0032] 1. Materials and Methods

[0033] 1.1 Transcriptome Sequencing Analysis

[0034] Fruit samples that reached edible condition under different treatments were selected. Frozen fruit samples were ground into powder, placed in 10 mL cryovials, stored on dry ice, and sent to Metawell Biotechnology Co., Ltd. for sequencing analysis. Transcriptome analysis was performed using the Illumina sequencing platform to compare differences between ethylene, 1-MCP-treated groups, and naturally ripened samples. Differential expression analysis was performed between sample groups using DESeq2 to obtain differentially expressed gene sets under different treatment conditions. The Benjamini-Hochberg method was then used to perform multiple hypothesis testing to correct the hypothesis test probability (P-value), obtaining the false discovery rate (FDR). Finally, differentially expressed genes (DEGs) were selected based on the screening criteria of log2FoldChange>=1 and FDR<0.05.

[0035] 1.2 RNA extraction and cDNA synthesis

[0036] Total RNA was extracted from kiwifruit fruit using the CTAB method described by Yin et al. (2012). Reverse transcription was performed using the Hifair® Vone-step RT-gDNA digestion SuperMix for qPCR kit (Yisheng Biotechnology (Shanghai) Co., Ltd.). Each sample was subjected to three biological replicates.

[0037] 1.3 Real-time quantitative PCR analysis

[0038] Real-time quantitative PCR analysis was performed using a quantitative PCR instrument (CFXConnect, Bio-Rad Laboratories, USA) and the fluorescent dye TBGreen® Premix ExTaq™ II (Takara). PCR reactions and procedures were performed according to the method of Wu et al. (2023b). Primers for real-time quantitative PCR were designed using the Primer3 website (http: / / bioinfo.ut.ee / primer3-0.4.0 / ) (Table 1), and their specificity was double-validated using amplification curves and control templates. ACTIN was selected as an internal reference gene to measure the expression levels of other genes. The relative expression level of each gene was calculated using 2^-ΔCt. Finally, the data obtained from quantitative PCR for each different gene were summarized into a table, and the minimum significant difference (LSD) value was calculated using the formula LSD=T*SQRTMS(2 / n) for significance analysis.

[0039] Table 1 Amplification Primers

[0040]

[0041] 1.4 LUC / REN dual-luciferase analysis

[0042] The in vivo regulatory effects of screened transcription factors on their respective promoters were detected using a tobacco dual-luciferase assay. The full-length coding regions of the screened transcription factor genes (ERF122, ARR6, HZP64, BHLH143, HZP66, ERF15, ERF82, NAC125, ERF89, and HZP55) were constructed into the pGreenII62-SK vector (empty vector served as a control), and the structural gene promoters were constructed into the pGreenII0800-LUC vector. Primers for vector construction are shown in Table 2. Both the recombinant SK and LUC vectors were transformed into Agrobacterium using liquid nitrogen freeze-thaw technology. The transformed Agrobacterium was cultured on LB solid medium (containing 50 μg / mL kanamycin and 25 μg / mL gentamicin) for 2 days. A small portion of the bacteria was then scraped off and spread onto a fresh culture medium of the same type, and activated after 12 hours of incubation.

[0043] Table 2 Primers for vector construction

[0044]

[0045] Activated Agrobacterium was scraped and resuspended in a permeation buffer (pH 5.6, containing 0.15 mM AS, 10 mM MES, and 10 mM MgCl2), and the concentration was adjusted to an OD600 of 0.75. Agrobacterium culture was prepared as a 10:1 ratio of transcription factor to promoter for injection into the abaxial surface of tobacco epidermis. After 3 days of incubation, the results were analyzed. The ratio of fluorescence signals (LUC and REN) catalyzed by firefly luciferase and Renilla luciferase in the infected leaf area was determined using a Dual-Luciferase® Reporter Assay System and a Luminoskan Ascent chemiluminescence analyzer (Thermo, USA). Three biological replicates were performed. By comparing changes in the ratio of transcription factor / promoter to empty SK / promoter, the regulatory effect of transcription factors on the target promoter was predicted.

[0046] 1.5 Gel migration assay (EMSA analysis)

[0047] This invention uses EMSA to analyze the interaction between ERF122 and HZP66 and the promoter AcPAL1 / 2. The full-length ORF sequences of transcription factors ERF122 and HZP66 were constructed into the pGEX-4T-1 vector (GE, USA). Primers for vector construction are shown in Table 3. The recombinant plasmid was transformed into *E. coli* Rosetta(DE3)pLys (Novagen, Germany) using a heat shock method. The culture was inoculated into 5–10 mL of LB liquid medium containing ampicillin (Amp) and chloramphenicol (Chl) and cultured at 37°C with shaking at 200 r / min for 12–14 h. The activated bacterial culture was then transferred to fresh resistant LB medium at a 1:100 ratio and cultured at 37°C with shaking until the OD600 value reached 0.6–0.8. Isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 1 mM, and the culture was induced at 16°C for 20 h to achieve soluble expression of the target protein.

[0048] After induction, bacterial cells were collected and the target protein was purified using a GST-tagged protein purification kit (Beyotime, Shanghai). The purified products were first analyzed by SDS-PAGE to verify protein expression and purification effectiveness: Protein solutions from each elution fraction were mixed with 5×SDS loading buffer at a 4:1 volume ratio and boiled in a water bath for 5 min to completely denature the protein; a gel system of 12% separating gel and 5% stacking gel was used, and electrophoresis was performed at a constant voltage of 180 V for 30 min; after electrophoresis, the gel was peeled off and stained with BeyoBluePlus Coomassie Brilliant Blue staining solution (Beyotime, Shanghai) at room temperature for 2 h. After destaining with destaining solution until the bands were clear, the target protein bands were observed.

[0049] The target protein, validated by SDS-PAGE, was used for electrophoresis (EMSA) to detect the in vitro binding activity of ERF122 and HZP64 transcription factors to the target DNA sequence. The specific steps were as follows: Complementary oligonucleotide chains of the target DNA fragment were synthesized by Qingke Biotechnology Co., Ltd., with one strand biotin-labeled at the 3' end. The labeled and unlabeled strands were mixed in equimolar amounts, denatured at 95°C for 5 min, and then slowly cooled to room temperature for annealing to form a double-stranded DNA probe. A chemiluminescent EMSA kit (Beyotime, China) was used for binding reaction and detection. The reaction system contained 2× binding buffer, the target protein, the biotin-labeled probe, and 5% glycerol, and incubated at room temperature for 20 min. To verify the specificity of binding, a competition experiment was set up: different concentrations of non-biotin-labeled cold probe and biotin-labeled probe were added to compete for binding to the target protein. Electrophoresis and chemiluminescence detection were then performed according to the kit instructions to analyze the protein-DNA interaction.

[0050] Table 3 Vector Construction

[0051]

[0052] 1.6 Statistical Analysis

[0053] Use software such as Excel 2010 and GraphPad Prism for graphing, data statistics, data organization, and analysis.

[0054] 2 Results and Analysis

[0055] 2.1 Screening and analysis of candidate transcription factors related to flavonoid metabolism

[0056] Transcriptome sequencing analysis identified 285 differentially expressed genes. Among these, two PAL genes, AcPAL1 / 2, were identified, and their expression changes were closely related to flavonoid content. However, the specific mechanisms by which ethylene and 1-MCP treatments regulate AcPAL1 / 2 gene expression remain unclear. Based on this, further analysis of the 285 differentially expressed genes revealed 27 transcription factors, including the largest number of ERF families (12), four BHLH families, three MYB families, three HD-ZIP families, and five families with only one member each: C3H, bZIP, Trihelix, NAC, and HSF. Figure 1 This distribution characteristic suggests that the ERF family may play a central role in gene regulation in this research system, while the BHLH, MYB, and HD-ZIP families may also have a high degree of involvement.

[0057] 2.2 Validation of expression levels of candidate transcription factors

[0058] To further identify transcription factors related to flavonoid metabolism, this example validated the expression levels of the screened candidate transcription factors. The results showed that ( Figure 2 Under 1-MCP treatment, the relative expression levels of ARR6, BZIP55, ERF74 / 82 / 120, HZP55 / 64 / 66, MYBR70, and NAC125 genes generally increased with prolonged storage time. At the same time, the treatment delayed the decline in the expression levels of C3H_75, ERF220, and HST16 genes, making their expression levels significantly higher than those in the control (CK) group during the later stages of storage. ETH treatment significantly upregulated the expression levels of ARR6, BHLH143, ERF15 / 22 / 74 / 82 / 89 / 122 / 162, HZP55 / 64 / 66, MYBR70, and NAC125 genes. Particularly at 2 and 4 days of storage, the expression levels of BHLH143, ERF15 / 22 / 122 / 162, HZP55 / 66, and NAC125 in the ETH-treated group were significantly higher than those in the CK and 1-MCP groups, exhibiting a clear ethylene response. Furthermore, the expression levels of genes such as BHLH119, ERF77, and HST16 showed no significant difference between the two treatments and the CK group, indicating that their expression was less affected by treatment factors. Based on the correlation analysis between gene expression trends and previous changes in flavonoid content, as well as the results of expression level verification, 10 transcription factors were screened out: ARR6, BHLH143, ERF15 / 82 / 89 / 122, HZP55 / 64 / 66, and NAC125. The expression of these genes was upregulated by both ETH and 1-MCP treatment, and their expression patterns were consistent with the accumulation trends of flavonoid metabolites. It is speculated that they may be potential regulatory factors involved in flavonoid metabolism in kiwifruit.

[0059] 2.3 Analysis of the regulatory effects of candidate transcription factors on the AcPAL1 / 2 promoter

[0060] Previously, the laboratory had identified AcPAL1 / 2 as a key structural gene in the flavonoid metabolic pathway that is affected by ETH and 1-MCP treatment. Based on this, we further investigated the transcriptional regulatory effects of nine candidate transcription factors (ERF15 was abandoned due to multiple unsuccessful cloning attempts) on the AcPAL1 / 2 promoter.

[0061] from Figure 3The results showed that different transcription factors exhibited significantly different transcriptional regulatory effects on the AcPAL1 / 2 promoter. For example, ERF122 showed a very strong activation effect on the AcPAL1 promoter, with its LUC / REN ratio reaching 2.67 times that of the SK control. HZP66 also showed a certain significant activation effect on the AcPAL1 promoter, but the effect was relatively weak, not exceeding twice that of the control. In addition, transcription factors such as NAC125, ERF89, and BHLH143 all showed weak activation effects on the AcPAL1 promoter, but the differences were not significant. However, for the AcPAL2 promoter, both ERF122 and HZP66 could significantly activate its expression, with HZP66 showing a particularly prominent activation effect, with its LUC / REN ratio exceeding 3 times that of the control. These results indicate that the aforementioned significantly different transcription factors can participate in the expression regulation process of the AcPAL1 / 2 promoter, with HZP66 showing the most significant regulatory effect, and may be a key transcription factor regulating flavonoid metabolism under ethylene and 1-MCP treatment.

[0062] 2.4 Binding ability analysis of HZP66 and ERF122 to ACPAL1 / 2 promoter

[0063] EMSA was used to further investigate the binding interactions of ERF122 and HZP66 to the AcPAL1 and AcPAL2 promoters, respectively. A binding motif CCGAC for ERF122 was predicted on the promoter using JASPAR, and a sequence containing this motif was designed as a probe for EMSA. Figure 4 The results showed that ERF122 can bind to a 3' biotin-labeled probe containing a key binding motif. Furthermore, this binding was attenuated by increasing the concentration of the competing probe (a cold probe without biotin labeling) by 2, 10, and 20 times, respectively.

[0064] The unique GGCAATAATTCAT motif, predicted by JASPAR, was used to determine the unique binding of HZP66. Figure 5 EMSA results showed that ERF122 can bind to a 3' biotin-labeled probe containing a key binding motif. Furthermore, this binding was attenuated by increasing concentrations of the competitive probe (a cold probe without biotin labeling) by 10, 50, and 100 times, respectively. These results indicate that HZP66 and ERF122 proteins directly bind to the ACPAL1 and AcPAL2 promoters, respectively, and regulate their expression.

[0065] In summary, this invention, using 'Hongyang' kiwifruit as material, systematically elucidated the transcriptional regulatory mechanism of postharvest flavonoid metabolism through ETH and 1-MCP treatments and a CK control, combined with omics sequencing and gel migration experiments. It was found that ERF122 can efficiently activate and directly bind to the AcPAL1 promoter, and HZP66 can strongly activate and directly bind to the AcPAL2 promoter. This invention improves the molecular regulatory network of kiwifruit flavonoid metabolism, identifies several key regulatory transcription factors, provides a theoretical basis for analyzing postharvest nutrient changes in fruit, and also provides molecular targets for the breeding of high-flavonoid kiwifruit varieties.

[0066] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. The application of transcription factors in regulating flavonoid metabolism in kiwifruit, characterized in that, The transcription factors include HZP66 and ERF122.

2. The application according to claim 1, characterized in that, The specific application is as follows: the transcription factor directly binds to and activates the promoters of AcPAL1 and AcPAL2, key genes for flavonoid synthesis, thereby promoting flavonoid metabolism in kiwifruit and accelerating flavonoid accumulation.

3. The application according to claim 2, characterized in that, The specific combinations are HZP66 and AcPAL1, and ERF122 and AcPAL2.

4. The screening method for transcription factors HZP66 and ERF122 as described in claim 1, characterized in that, The screening method specifically includes: (1) After grinding frozen kiwifruit samples into powder, sequencing analysis was performed, and differentially expressed genes were screened as candidate transcription factors. (2) Primers were designed to verify the expression levels of candidate transcription factor genes. Candidate transcription factors were further screened based on the criteria of being upregulated by both ETH and 1-MCP treatment and having an expression pattern consistent with the accumulation trend of flavonoid metabolites. (3) The in vivo regulatory effects of the transcription factors screened in (2) on the relevant promoters were detected by the tobacco dual-luciferase assay, and transcription factors were further screened. (4) The interaction between the transcription factors screened in (3) and the AcPAL1 / 2 promoter was analyzed using EMSA to obtain the final effective transcription factors.

5. The screening method according to claim 4, characterized in that, The primers include HZP66 F1 / R1 and ERF122F2 / R2, and HZP66 F1 / R1 and ERF122 F2 / R2 are specifically: HZP66 F1: CAAAGTGATCCCATCCATCC, HZP66 R1:TTTGGCTGAAGTGCTCCT; ERF122 F2: CCGGAGCAGTCTTTGTCATC, ERF122 R2: ATCGTCCAAAATGTGTGCAA.

Images