A method for constructing and applying an anti-obesity animal model based on ISCA1 / 2 gene regulation.

The ISCA1/2 gene-edited mouse model, constructed using CRISPR-Cas9 gene editing technology, solves the problem that existing obesity models cannot simulate the synergistic regulation of iron metabolism and energy consumption. It achieves effective resistance to obesity and metabolic disorders in a high-fat diet environment and is suitable for drug screening and energy metabolism research.

CN122303328APending Publication Date: 2026-06-30HEFEI INSTITUTE OF PHYSICAL SCIENCE CHINESE ACADEMY OF SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HEFEI INSTITUTE OF PHYSICAL SCIENCE CHINESE ACADEMY OF SCIENCES
Filing Date
2026-05-11
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing obesity models cannot simulate the synergistic regulation of specific metabolic pathways such as iron metabolism and energy consumption. There is a lack of functional animal models targeting the ISCA1/2 pathway in obesity, making it difficult to observe the enhanced effect of iron-dependent fatty acid oxidation.

Method used

Using CRISPR-Cas9 gene editing technology, specific single-stranded guide RNAs were designed for the mouse ISCA1 gene (targeting the exon 3 region) and ISCA2 gene (targeting the exon 2 region) to construct an anti-obesity animal model. F1 generation heterozygous mice were screened out, and ISCA1/2 expression was downregulated to enhance iron-dependent fatty acid oxidation.

Benefits of technology

The constructed anti-obesity model resists weight gain under high-fat diet conditions, improves liver fat accumulation and inflammation, enhances thermogenesis capacity of brown adipose tissue, and activates iron-dependent fatty acid oxidation pathways. It is suitable for screening anti-obesity drugs targeting ISCA1/2 and for energy metabolism research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303328A_ABST
    Figure CN122303328A_ABST
Patent Text Reader

Abstract

This invention discloses a method for constructing and applying an anti-obesity animal model based on ISCA1 / 2 gene regulation, belonging to the field of biomedical technology. The method utilizes CRISPR-Cas9 gene editing technology to design specific single-stranded guide RNAs targeting the ISCA1 and ISCA2 genes in mice. Cas9 mRNA and sgRNA are introduced into fertilized eggs of C57BL / 6J strain mice via microinjection. The injected embryos are then transferred into pseudopregnant mice to obtain F0 generation chimeric mice. By mating F0 generation mice with wild-type C57BL / 6J mice, F1 generation heterozygous mice carrying the target mutation in the germline are selected, thus obtaining the anti-obesity animal model. This model is not only a phenotypic model but also a mechanistic research model, suitable for drug target validation, energy metabolism pathway exploration, and personalized treatment strategy evaluation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a method for constructing and applying an anti-obesity animal model based on ISCA1 / 2 gene regulation. Background Technology

[0002] Obesity has become a global public health problem, seriously affecting human health. Currently, anti-obesity drugs mainly focus on suppressing appetite, while interventions targeting increased energy expenditure remain limited. The link between energy metabolism and iron metabolism has received attention in recent years. Iron, as a key cofactor for many metabolic enzymes, participates in processes such as the mitochondrial electron transport chain and fatty acid oxidation. The iron-sulfur cluster is a core cofactor in mitochondrial energy metabolism, and its biosynthesis depends on scaffold proteins such as ISCA1 and ISCA2.

[0003] In existing technologies, conventional obesity models mostly use wild-type mice fed a high-fat diet. While these models can mimic the obesity phenotype, they lack the ability to precisely regulate specific metabolic pathways, such as iron metabolism and fatty acid oxidation, limiting the screening and validation of novel anti-obesity drugs or mechanisms. Furthermore, existing obesity models cannot simulate the fine-tuning between iron metabolism and energy expenditure; there is a lack of functional animal models targeting the role of the ISCA1 / 2 pathway in obesity; and it is difficult to directly observe the enhanced iron-dependent fatty acid oxidation effect in these models. In addition, there are no reports on constructing anti-obesity animal models by targeting ISCA1 / 2. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to address the limitations of existing obesity models, which are unable to simulate the synergistic regulation mechanism of specific metabolic pathways (such as iron metabolism) and energy consumption.

[0005] The present invention solves the above-mentioned technical problems through the following technical means:

[0006] The first aspect of the present invention proposes a method for constructing an anti-obesity animal model, which uses CRISPR-Cas9 gene editing technology to design specific single-stranded guide RNA (sgRNA) for the mouse ISCA1 gene (targeting the exon 3 region) and ISCA2 gene (targeting the exon 2 region). Cas9 mRNA and sgRNA were introduced into fertilized eggs of C57BL / 6J mice via microinjection. The injected embryos were then transferred into pseudopregnant mice to obtain F0 generation chimeric mice. By mating F0 generation mice with wild-type C57BL / 6J mice, F1 generation heterozygous mice carrying the target mutation in the germline were selected to obtain an anti-obesity animal model.

[0007] Preferably, the sequence of the ISCA1 gene-specific single-stranded guide RNA (ISCA1 sgRNA) is shown in SEQ ID NO:1; and the sequence of the ISCA2 gene-specific single-stranded guide RNA (ISCA2 sgRNA) is shown in SEQ ID NO:2.

[0008] This invention also proposes an anti-obesity animal model obtained by the above construction method.

[0009] A second aspect of the present invention proposes the application of the anti-obesity animal model obtained by the above construction method in the study and screening of anti-obesity drugs targeting ISCA1 / 2.

[0010] Screening strategy: Downregulate ISCA1 / 2 expression → Enhance iron-dependent fatty acid oxidation → Anti-obesity.

[0011] A third aspect of the present invention provides a method for screening anti-obesity drugs targeting ISCA1 / 2, comprising the following steps: (1) In vitro cell screening: Hepatocytes were treated with candidate drugs, and the expression of ISCA1 / 2 mRNA (qPCR) and protein (Western Blot) was examined to see if it decreased. If yes, the next step was performed; otherwise, the process was discarded. (2) Verification of iron dependence: If the iron chelating agent can block the FAO enhancement induced by the candidate drug, proceed to the next step; otherwise, discard the drug. (3) In vivo verification: Using the ISCA1 / 2 + / - Heterozygous or wild-type mice were fed a high-fat diet with the candidate drug, and their weight gain curve and adipose tissue weight were evaluated. If, compared with the control group, their weight gain was significantly slower and their adipose tissue weight was significantly lighter, then the candidate drug was an anti-obesity drug.

[0012] Preferably, in (1), the candidate drug includes, but is not limited to, small molecules, siRNA, shRNA, natural products, etc.

[0013] Preferably, in (1), the hepatocytes include HepG2 cells.

[0014] Preferably, in (2), the iron chelating agent includes DFO.

[0015] Preferably, in (3), the assessment also includes liver lipid content, energy consumption (metabolism cage detection of VO2, EE), brown adipose tissue UCP1 expression, liver FAO gene expression, liver iron content and valence changes.

[0016] Specific screening steps: Step 1: In vitro cell screening. HepG2 cells or other hepatocyte cell lines are treated with candidate compounds / reagents (e.g., small molecules, siRNA, shRNA, natural products, etc.). The expression of ISCA1 / 2 mRNA (qPCR) and protein (Western Blot) is detected to determine if there is a decrease; intracellular Fe²⁺ is also measured. + / Whether the total iron ratio increases (iron ion probe or spectrophotometry); whether key FAO genes (CPT1α, Ehhadh, PGC1α) upregulate fatty acid oxidation rate (e.g., using 14C-labeled fatty acids or hippocampal analyzer), etc.

[0017] Step 2: Verification of iron dependence. If the combined use of an iron chelator (such as DFO) can block the enhancement of FAO induced by the candidate drug, it indicates that its effect is iron-dependent; if the combined use of an iron supplement (such as ferric ammonium citrate FAC) can further enhance the effect, it supports the iron-mediated mechanism.

[0018] Step 3: In vivo validation. Using the described ISCA1 / 2 + / - Heterozygous or wild-type mice plus candidate drugs were fed a high-fat diet to evaluate weight gain curves, adipose tissue weight, liver lipid content, energy expenditure (VO2 and EE detected by metabolic cages), brown adipose tissue UCP1 expression, liver FAO gene expression, and liver iron content and valence changes.

[0019] Step 4: Target specificity confirmation. (In ISCA1 / 2) + / - The candidate drug was administered again to mice to observe whether it still had a further anti-obesity effect. If the effect was weakened or disappeared, it would indicate that its action mainly depends on the ISCA1 / 2 pathway.

[0020] The fourth aspect of this invention proposes the application of the anti-obesity animal model obtained by the above construction method in the study of the relationship between iron metabolism and obesity.

[0021] Preferably, it plays an anti-obesity role by activating fatty acid oxidation by increasing intracellular iron availability.

[0022] Preferably, by regulating the expression level of the iron-sulfur cluster assembly protein ISCA1 / 2, the body is induced to enter a metabolic state that uses iron as a medium and enhances fatty acid oxidation, thereby resisting obesity and related metabolic disorders in a high-calorie diet environment.

[0023] The fifth aspect of the present invention proposes the application of the anti-obesity animal model obtained by the above construction method in the evaluation of the efficacy of energy-consuming therapies.

[0024] The working principle of this invention is as follows: The scientific basis and working principle of this model construction method are based on a newly discovered "ISCA1 / 2 – iron homeostasis – fatty acid oxidation" metabolic axis: (1) Initial perturbation: By genetically reducing the expression of ISCA1 / 2, the biosynthesis and assembly efficiency of the [4Fe-4S] cluster in mitochondria was weakened.

[0025] (2) Iron metabolism reprogramming: Impaired assembly of iron-sulfur clusters leads to a decrease in available iron ions (especially Fe²⁺) in the intracellular free iron pool. + The relative increase is significant. This trend is amplified under high-fat diet stress, partially correcting the diet-induced relative deficiency of liver iron.

[0026] (3) Activation of metabolic pathways: Iron is an essential cofactor for many enzymes, including those involved in mitochondrial fatty acid β-oxidation (such as electron transport chain complexes and iron-sulfur proteins). Increased levels of available intracellular iron act as a metabolic booster, directly enhancing the activity of fatty acid oxidase systems.

[0027] (4) Increased energy expenditure: Enhanced hepatic fatty acid oxidation reduces abnormal lipid storage in the liver (alleviating fatty liver). At the same time, through the potential liver-BAT endocrine axis, signals are transduced to brown adipose tissue, activating the thermogenic program centered on UCP1, dissipating chemical energy as heat.

[0028] (5) Systemic anti-obesity phenotype: The above-mentioned changes at the cellular and tissue levels are integrated to show an increase in overall energy consumption and an improvement in the reduction of lipid storage in adipose tissue, thereby effectively resisting excessive weight gain and related metabolic complications in the context of high calorie input.

[0029] (6) Uniqueness of the model: Compared with traditional diet-induced obesity models, this model, through precise gene modification, sets iron availability as a controllable variable, creating a physiological environment in which high-fat dietary input and iron-dependent high energy expenditure output are dynamically balanced. This allows researchers to directly observe and quantify the regulatory role of iron metabolism on energy balance in a living system, providing an invaluable preclinical research tool for developing novel weight-loss therapies targeting this pathway.

[0030] The beneficial effects of this invention are as follows: 1. This invention provides a method for constructing an anti-obesity animal model by downregulating ISCA1 / 2 expression. The constructed model can: resist weight gain under high-fat diet conditions; improve liver fat accumulation and inflammation; enhance the thermogenesis capacity of brown adipose tissue; and activate iron-dependent fatty acid oxidation pathways.

[0031] 2. This invention provides a method for constructing an anti-obesity animal model capable of simulating and studying the "iron-dependent lipid burning" pathway. Its core lies in inducing the body to enter a metabolic state mediated by iron and enhanced fatty acid oxidation by regulating the expression level of the iron-sulfur cluster assembly protein ISCA1 / 2, thereby resisting obesity and related metabolic disorders under a high-calorie diet. This model is not only a phenotypic model but also a mechanistic research model, suitable for drug target validation, energy metabolism pathway exploration, and personalized treatment strategy evaluation.

[0032] 3. High model stability: ISCA1 / 2 + / - Mice on a high-fat diet exhibited a stable anti-obesity phenotype, with significantly lower weight gain than wild-type mice; 4. Multi-dimensional phenotypic detection: The model can systematically evaluate multiple dimensions such as weight, blood lipids, liver lipids, inflammation, and energy metabolism; 5. Clear mechanism: The model directly links iron metabolism and fatty acid oxidation, which facilitates the study of iron-dependent energy consumption pathways; 6. Wide range of applications: It can be used to screen anti-obesity drugs targeting ISCA1 / 2, study the relationship between iron metabolism and obesity, and evaluate energy-consuming therapies; 7. Strong clinical translation potential: It provides experimental model support for developing new strategies to treat obesity by regulating iron metabolism.

[0033] 8. A method for constructing an animal model with an anti-obesity phenotype by regulating the expression of iron-sulfur cluster assembly proteins ISCA1 / 2, and its application in obesity mechanism research and drug screening.

[0034] Of course, implementing any product or method of the present invention does not necessarily require achieving all of the advantages described above at the same time. Attached Figure Description

[0035] Figure 1 ISCA1 / 2 in Embodiment 1 of the present invention + / - A schematic diagram of mouse construction, where a and b are schematic diagrams of CRISPR-Cas9 targeting the ISCA1 and ISCA2 genes, respectively; Figure 2 ISCA1 / 2 in Embodiment 1 of the present invention + / - Figure 1 shows the knockdown level detection in mice, where a and b represent ISCA1 levels, respectively. + / - Mice, ISCA2 + / - Mouse gene level detection diagram, c and d are the ISCA1 gene and ISCA2 gene protein level detection diagrams respectively; Figure 3 This is a comparison chart of the weight gain of mice in each group in Example 1 of the present invention, where a and d represent the weight gain of ISCA1 mice during the entire 16-week high-fat diet feeding period. + / -Mice, ISCA2 + / - Mouse weight gain curves; b and e represent ISCA1 at the end of 16 weeks of high-fat diet feeding. + / - Mice, ISCA2 + / - Mouse body weight; c and f are ISCA1 at the end of 16 weeks of high-fat diet feeding. + / - Mice, ISCA2 + / - The rate of increase in body weight in mice.

[0036] Figure 4 These are comparative photographs of representative organs of mice in each group in Example 1 of this invention; where a represents the difference between WT and ISCA1 at the experimental endpoint. + / - Whole-body photographs, brown adipose tissue, white epididymal adipose tissue, and liver photographs of mice in each experimental group. b represents the experimental endpoint, WT and ISCA2. + / - Full-body photographs, brown adipose tissue, white adipose tissue in the epididymis, and liver of mice in each experimental group.

[0037] Figure 5 The images show H&E staining of liver and adipose tissue in mice from each group in Example 1 of this invention. A and D show H&E staining of liver; B and E show H&E staining of brown adipose tissue; C and F show H&E staining of white adipose tissue in the abdomen. The bar chart on the right shows the quantification of adipose tissue vacuolation.

[0038] Figure 6 These are oil red oxygen staining images of the livers of mice in each group in Example 1 of this invention, where a and b are oil red oxygen staining images, and the bar charts on the right are quantitative representations of lipid droplet deposition.

[0039] Figure 7 This is the result of quantitative detection of liver triglyceride (TG) content in mice in each group in Example 1 of the present invention, where a is ISCA1. + / - Mouse group; b is ISCA2 + / - Mouse group.

[0040] Figure 8 These are energy metabolism monitoring graphs of mice in each group in Example 1 of the present invention, where a and b are real-time monitoring graphs of energy consumption of experimental mice, and the right side is a quantitative graph of energy consumption of experimental mice.

[0041] Figure 9 This is a graph showing the expression of brown adipose thermogenic protein in mice in each group in Example 1 of the present invention. A and b are Western Blot results, and the right side shows quantitative bar graphs of PGC1a and UCP1, respectively.

[0042] Figure 10 This is a graph showing the expression of fatty acid oxidation genes in the livers of mice in Example 1 of this invention, where a and b are bar graphs showing ISCA1 in qRT-PCR. + / -Mice, ISCA2 + / - mRNA levels of several key genes involved in fatty acid oxidation (FAO) (such as Cpt1a and Ehhadh) in mouse liver.

[0043] Figure 11 This is a graph showing the liver iron content and valence state analysis of mice in each group in Example 1 of the present invention, where a and d are ISCA1 + / - Mice, ISCA2 + / - ferrous iron (Fe²⁺) in mouse liver + Content comparison chart; b and e are ISCA1 content comparison charts; + / - Mice, ISCA2 + / - Comparison of total iron content in mouse livers; c and f represent ISCA1. + / - Mice, ISCA2 + / - Bar chart showing the ratio of ferrous to ferric iron in mouse liver.

[0044] Figure 12 The figures shown are Western Blot results from Example 1 of this invention and the detection of fatty acid oxidase CPT1α expression after interfering with ISCA1 / 2 in combination with the iron chelator DFO. a and b are the detection results of knocking down ISCA1 and ISCA2 in Hep G2 cells, respectively; where "+" represents present and "-" represents absent.

[0045] In the picture, This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. P < 0.0001, and ns indicates no statistical significance. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0047] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0048] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0049] Example 1: Model building phase (1) Construction of genetically modified animal models (e.g.) Figure 1 (As shown) Target selection and design: Encoding iron-sulfur cluster assembly proteins ISCA1 Genes and ISCA2 These two genes are highly conserved evolutionarily and are key factors in the maturation and translocation of the [4Fe-4S] cluster in mice and humans. Using CRISPR-Cas9 gene editing technology, specific single-stranded guide RNAs were designed for the mouse ISCA1 gene (NCBI gene ID: 69046, targeting exon 3 region) and ISCA2 gene (NCBI gene ID: 74316, targeting exon 2 region), respectively. (ISCA1 sgRNA: TCAGCCTCACAAGCGAGTGCTGG; (SEQ ID NO:1) ISCA2 sgRNA:GTAAAGAAGGGAGACGAACCCGG (SEQ ID NO: 2)).

[0050] (2) Animal birth and reproduction: Cas9 mRNA and sgRNA were introduced into the fertilized eggs of C57BL / 6J mice via microinjection. The injected embryos were then transferred into pseudopregnant mice to obtain F0 generation chimeric mice. F0 generation mice were mated with wild-type C57BL / 6J mice to screen for F1 generation heterozygous mice carrying the target mutation in the germline. Genotyping of the F1 generation mice was performed: genomic DNA was extracted from the tails, the target gene region was amplified by PCR, and mutation types, including frameshifts, deletions, and insertions, were analyzed. Simultaneously, Western blotting was used to detect the protein expression levels of ISCA1 and ISCA2 in liver tissue, confirming that their expression levels were significantly reduced compared to wild-type (approximately 50%-70%), establishing a stable ISCA1 expression level. + / - and ISCA2 + / - Mouse strains.

[0051] Experimental results are as follows Figure 2 As shown, CRISPR-Cas9 gene editing successfully obtained ISCA1 / 2 + / - Mouse strains, such as Figure 2As shown in Figures a and b, ISCA1 / 2 was rapidly identified and screened using blood collected from mouse tails. + / - Mice. For example... Figure 2 As shown in Figures c and d, ISCA1 / 2 was detected simultaneously using Western blotting. + / - ISCA1 / 2 protein expression was downregulated in the heart, liver, spleen, lungs, kidneys, and fat of mice.

[0052] (3) Experimental group design and high-fat diet induction Animal preparation and grouping: Select 8-10 week old male ISCA1 mice. + / - ISCA2 + / - Mice and their littermate wild-type (WT) controls. Mice of each genotype were randomly assigned to two groups: a normal control group (ISCA1) and a control group (WHO). + / - -NCD, ISCA1 + / - -NCD group): High-fat diet feeding group (ISCA2) + / - -HFD, ISCA2 + / - -HFD group). Obesity induction group: normal control group (WT-NCD group): high-fat diet feeding group (WT-HFD). The average weight of wild-type mice in the high-fat diet group was about 45 g, which was significantly increased by about 10 g compared with the normal diet control group (P<0.05), indicating that dietary intervention successfully induced obesity and established a stable diet-induced obesity animal model.

[0053] Basic physiological monitoring: The weight and blood glucose of each mouse, as well as the food intake and water consumption of each cage, were measured and recorded weekly to ensure that phenotypic differences were not caused by feeding behavior. At the end of the feeding cycle, the mice were fasted for 4-6 hours, and fasting blood glucose was measured. Subsequently, the mice were euthanized by anesthesia, and samples of serum, liver, epididymal white adipose tissue (eWAT), and interscapular brown adipose tissue (BAT) were collected. These samples were quickly weighed and aliquoted, with some stored in liquid nitrogen or frozen at -80°C, and others fixed with paraformaldehyde or OCT embedding agents.

[0054] (4) Systematic phenotypic characterization and verification: Compare the weight gain curves, final weight and weight gain rate of mice in each group.

[0055] The results are as follows Figure 3 As shown, after 16 weeks of rearing under normal dietary conditions, WT-NCD and ISCA1 / 2 + / - - There was no significant difference in body weight gain among the NCD group mice. Under high-fat diet conditions, the WT-HFD group showed sustained and rapid body weight gain, while the ISCA1 / 2 group showed... + / - - The HFD group showed a significant slowdown in weight gain. End-point weight comparisons showed ISCA1 / 2 + / - - The final body weight of the HFD group was on average 18-25% lower than that of the WT-HFD group.

[0056] The mice, liver, eWAT, and BAT were photographed to visually compare organ size and the appearance of lipid deposition.

[0057] The results are as follows Figure 4 As shown, after 16 weeks of rearing, the overall body size of the mice was ISCA1 / 2. + / - -HFD group mice were significantly smaller than WT-HFD group mice; liver images showed ISCA1 / 2 + / - - The liver volume in the HFD group was significantly smaller than that in the WT-HFD group; adipose tissue images showed ISCA1 / 2 + / - The size of the white and brown adipose tissue in the epididymis of the -HFD group was significantly smaller than that of the WT-HFD group.

[0058] (5) Histopathological and morphological analysis: Liver H&E staining: Paraffin-embedded liver, eWAT, and BAT sections were stained to observe hepatocyte steatosis (lipid droplet vacuolation), adipocyte size, BAT lipid droplet morphology, and tissue inflammatory infiltration.

[0059] The results are as follows Figure 5 As shown, histopathological analysis, compared with the WT-HFD group, revealed that liver H&E staining showed ISCA1 / 2 + / - - The HFD group of mice showed a significant reduction in liver fat vacuoles and hepatocyte morphology that was closer to normal.

[0060] Oil Red O staining of liver: Staining frozen sections of liver to specifically show the degree of accumulation of neutral lipids (mainly triglycerides) and perform semi-quantitative image analysis.

[0061] The results are as follows Figure 6 As shown, Oil Red O staining of the liver reveals ISCA1 / 2 + / - -Lipid droplet deposition was significantly reduced in the HFD group.

[0062] Quantitative analysis of liver triglycerides confirmed ISCA1 / 2 + / - - The HFD group had reduced lipid accumulation in the liver.

[0063] The results are as follows Figure 7 As shown, quantitative analysis of liver triglycerides revealed ISCA1 / 2 + / - - The HFD group had reduced lipid accumulation in the liver.

[0064] Mechanism verification phase (6) Assessment of energy metabolism and thermogenic function: Mice were continuously monitored in metabolic cages for 48 hours using the Integrated Laboratory Animal Monitoring System (CLAMS).

[0065] The following parameters were directly measured and calculated: oxygen consumption rate (VO2), carbon dioxide production rate (VCO2), respiratory exchange rate (RER), total energy expenditure (EE), and spontaneous activity.

[0066] Key observation: ISCA1 / 2 under HFD feeding + / - Whether mice exhibit significantly higher EE levels compared to WT mice during both resting and active periods.

[0067] The results are as follows Figure 8 As shown, an energy metabolism parameter was monitored using a metabolic cage system, ISCA1 / 2 + / - -HFD mice showed higher energy expenditure (EE) and higher oxygen consumption (VO2).

[0068] (7) Validation of thermogenesis and metabolic pathway activation: Western blotting analysis was used to analyze the expression of key proteins, including those related to heat and energy expenditure: uncoupling protein 1 (UCP1) in BAT and peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α).

[0069] The results are as follows Figure 9 As shown, Western blotting analysis of the heat production of brown adipose tissue revealed ISCA1 / 2. + / - The expression of UCP1, a key protein for heat production, and PGC1α, a key protein for fatty acid oxidation, was significantly upregulated in the brown adipose tissue of mice in the HFD group.

[0070] The mRNA expression changes of key genes in the fatty acid oxidation pathway (such as Ehhadh, Plin2, and Cyp4a10) in the liver were detected by qRT-PCR.

[0071] The results are as follows Figure 10 As shown, analysis of the liver fatty acid oxidation pathway, qRT-PCR detection revealed ISCA1 / 2 + / - The mRNA levels of several key genes for fatty acid oxidation (such as Cpt1α and Ehhadh) in the livers of mice in the HFD group were significantly upregulated.

[0072] (8) Quantitative analysis of iron metabolism status: Ferric iron (Fe²⁺) in liver tissue homogenate was determined using iron ion spectrophotometry. + ) and trivalent iron (Fe³⁺) + The relative proportion of iron is used to assess the iron reduction state.

[0073] The results are as follows Figure 11 As shown, the iron valence state and content in the liver were detected and analyzed, and the results showed that ISCA1 / 2 + / --HFD group mice showed liver ferrous iron (Fe²⁺) + As the proportion of iron increases, the total iron content tends to rise, and the proportion of iron valence states also changes accordingly.

[0074] In vitro validation and mechanism confirmation phase (9) An in vitro validation model was established using the human hepatocellular carcinoma cell line HepG2. Cells were transfected with interfering RNA (siRNA) to knock down the expression of ISCA1 and / or ISCA2, simulating the gene downregulation state in animal models. Cells were treated with palmitic acid (PA, 0.2-0.3 mM) for 24-48 hours to simulate lipid accumulation in hepatocytes induced by a high-lipid environment. Iron supplementation and iron deprivation were added to establish the core effector role of iron downstream of ISCA1 / 2. Specifically, in the iron supplementation group, ferric ammonium citrate (FAC, e.g., 100 µM) was added during PA treatment to increase intracellular available iron. In the iron deprivation group, deferoxamine (DFO, e.g., 100 µM) was added during PA treatment to chelate intracellular iron.

[0075] The results are as follows Figure 12 As shown, Western blot results indicated that knocking down ISCA1 / 2 with siRNA (sequence: GCCOUUCUUAUACUCUAGATT (SEQ ID NO:3)) upregulated the expression of key fatty acid oxidation enzymes CPT1α and PGC1α, similar to the PA-mimicking effect. This effect was further amplified by the addition of the iron supplement FAC. However, when ISCA1 / 2 was knocked down with siRNA in combination with the iron chelator DFO, the PA-induced upregulation of CPT1α and PGC1α was completely blocked. These results suggest that ISCA1 / 2 knockdown activates fatty acid oxidation by increasing intracellular iron availability.

[0076] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing an anti-obesity animal model, characterized in that, This method uses CRISPR-Cas9 gene editing technology to design specific single-stranded guide RNAs for the mouse ISCA1 and ISCA2 genes, respectively. Cas9 mRNA and sgRNA were introduced into fertilized eggs of C57BL / 6J mice via microinjection. The injected embryos were then transferred into pseudopregnant mice to obtain F0 generation chimeric mice. By mating F0 generation mice with wild-type C57BL / 6J mice, F1 generation heterozygous mice carrying the target mutation in the germline were selected to obtain an anti-obesity animal model.

2. The construction method according to claim 1, characterized in that, The sequence of the specific single-stranded guide RNA of the ISCA1 gene is shown in SEQ ID NO:1; the sequence of the specific single-stranded guide RNA of the ISCA2 gene is shown in SEQ ID NO:

2.

3. The application of the anti-obesity animal model obtained by the construction method described in claim 1 in the study and screening of anti-obesity drugs targeting ISCA1 / 2.

4. The anti-obesity animal model obtained by the construction method described in claim 1 can be used to study the relationship between iron metabolism and obesity.

5. The application according to claim 4, characterized in that, It activates fatty acid oxidation by increasing intracellular iron availability, thereby playing an anti-obesity role.

6. The application of the anti-obesity animal model obtained by the construction method of claim 1 in evaluating the efficacy of energy-consuming therapies.

7. A method for screening anti-obesity drugs targeting ISCA1 / 2, characterized in that, Includes the following steps: (1) In vitro cell screening: Hepatocytes were treated with candidate drugs, and the expression of ISCA1 / 2 mRNA and protein was examined to see if it decreased. If so, the next step was performed; otherwise, the process was discarded. (2) Verification of iron dependence: If the iron chelating agent can block the FAO enhancement induced by the candidate drug, proceed to the next step; otherwise, discard the drug. (3) In vivo verification: Using the ISCA1 / 2 + / - Heterozygous or wild-type mice were fed a high-fat diet with the candidate drug, and their weight gain curve and adipose tissue weight were evaluated. If, compared with the control group, their weight gain was significantly slower and their adipose tissue weight was significantly lighter, then the candidate drug was an anti-obesity drug.

8. The screening method according to claim 7, characterized in that, (1) The candidate drugs include small molecules, siRNA, shRNA, and natural products.

9. The screening method according to claim 7, characterized in that, (1) Hepatocytes include HepG2 cells; (2) Iron chelating agents include DFO.

10. The screening method according to claim 7, characterized in that, In (3), the assessment also included liver lipid content, energy consumption, brown adipose tissue UCP1 expression, liver FAO gene expression, and liver iron content and valence changes.