Primers, methods, and applications for detecting the Y4667D / C mutation of the nicotine receptor in the mole davidii.
By designing a primer combination for detecting the Y4667D/C mutation of the nicotine receptor in the rice stem borer, a rapid and flexible mutation screening was achieved using the LAMP reaction, solving the problem of lagging field resistance monitoring and providing an efficient and convenient detection solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA NAT RICE RES INST
- Filing Date
- 2026-04-17
- Publication Date
- 2026-06-30
AI Technical Summary
Current technologies cannot quickly and accurately screen for nicotine receptor Y4667D/C mutations in rice stem borers in the field, resulting in a lag in drug resistance monitoring and a lack of suitable technical means for field testing.
A detection primer set was designed, including primer sets for primary screening and secondary typing. The Y4667D and Y4667C mutations can be detected simultaneously or separately in a single tube via LAMP reaction. Combined with the color interpretation of the reaction solution, rapid and flexible mutation screening can be achieved.
It achieves efficient, convenient and accurate detection of the Y4667D/C mutation of the nicotinic receptor in the mole spp., reducing operation steps and costs, and is suitable for high-throughput screening in the field to guide scientific drug use and delay the development of resistance.
Smart Images

Figure CN122303439A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of pesticide resistance detection technology for agricultural pests, and in particular to a primer, method and application for detecting the Y4667D / C mutation of the nicotine receptor in the rice stem borer. Background Technology
[0002] The rice stem borer (Chilo suppressalis) is one of the most significant borer pests in my country's rice production, seriously threatening rice yield and quality. It has been listed as a Class I crop pest by the Ministry of Agriculture and Rural Affairs. For over a decade, diamide insecticides, represented by chlorantraniliprole, have become the core pesticides for controlling lepidopteran pests like the rice stem borer in my country due to their high efficiency, low toxicity, and unique mechanism of action. However, due to long-term, high-frequency, and high-dose use, resistance to diamide pesticides in field populations of the rice stem borer in my country is becoming increasingly serious. In some areas, the population has reached a high level of resistance, and the efficacy of pesticides has significantly decreased. Blindly increasing pesticide application will further exacerbate resistance development and environmental risks. Therefore, it is necessary to conduct resistance monitoring to guide the scientific and rational use of pesticides.
[0003] Mutations in the ryanodine receptor gene are the core molecular mechanism underlying the high-level resistance of rice stem borer to diamide antibiotics. Y4667D (TAC→GAC, tyrosine→aspartic acid) and Y4667C (TAC→TGC, tyrosine→cysteine) are key functional mutation sites. These sites are located in the transmembrane domain of the receptor; mutations alter the receptor's spatial conformation, reducing its binding affinity to antibiotics and directly mediating resistance. Functional validation confirmed that a single mutation in Y4667D confers extremely high levels of resistance (439.3–1464.3 times) to diamide antibiotics in rice stem borers, while the Y4667C mutation is frequently detected in highly resistant populations across multiple regions, serving as an important molecular marker for resistance evolution. Currently, most highly resistant populations carry multiple mutations; the type and frequency of these mutations directly determine the level of resistance in the population. Accurate detection of mutations at this site is one of the core prerequisites for monitoring and controlling antibiotic resistance in rice stem borers.
[0004] Existing resistance mutation detection technologies, such as allele-specific PCR, real-time quantitative PCR, and gene sequencing, while highly accurate, rely on expensive and sophisticated instruments, are cumbersome to operate, and have long detection cycles, making them unsuitable for rapid field screening needs. Traditional bioassays, while reflecting phenotypic resistance, take several days to weeks, require feeding a large number of test insects, and cannot reveal the molecular mechanisms of resistance, easily leading to biased resistance assessments and delayed early warnings. In particular, there is a lack of rapid field detection technologies that can simultaneously screen for both Y4667D and Y4667C mutations in a single reaction system.
[0005] Therefore, there is an urgent need to develop a rapid field detection technology that is low in equipment dependence, easy to operate, provides intuitive results, and is inexpensive, so as to achieve efficient and accurate simultaneous screening of nicotine receptor Y4667D / C mutations in rice stem borer, and provide reliable technical support for regional resistance management and precision medicine. Summary of the Invention
[0006] The purpose of this application is to provide a primer, method, and application for detecting the Y4667D / C mutation of the nicotine receptor in rice stem borer. This method can simultaneously screen for both Y4667D and Y4667C resistance mutations in a single reaction, significantly simplifying the operation process. Furthermore, it allows for the flexible use of independent detection systems for precise typing verification at each specific site, providing efficient and reliable technical support for monitoring rice stem borer resistance and guiding scientific pesticide use in rice-producing areas.
[0007] To achieve the above objectives, this application provides the following technical solution:
[0008] In one aspect, this application provides a primer set for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt, including a first primer set for initial screening to simultaneously detect the Y4667D and Y4667C mutations, a second primer set for secondary typing to specifically detect the Y4667D mutation, and a third primer set for secondary typing to specifically detect the Y4667C mutation.
[0009] The first primer set consists of outer primer F3-A, outer primer F3-B, outer primer B3, inner primer FIP-A, inner primer FIP-B, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to simultaneously detect two mutations, Y4667D and Y4667C, in a single reaction system.
[0010] The second primer set consists of outer primer F3-A, outer primer B3, inner primer FIP-A, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to specifically detect the Y4667D mutation;
[0011] The third primer set consists of outer primer F3-B, outer primer B3, inner primer FIP-B, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to specifically detect the Y4667C mutation.
[0012] The primer sequences are as follows:
[0013] F3-A: TAGATCTGTCTCAGTACACGAAG (SEQ ID NO. 1);
[0014] F3-B: GCCGTCTCTTTCTTGGCGCGAA (SEQ ID NO. 2);
[0015] B3: GTCTGCTCCTACACTTCTG (SEQ ID NO.3);
[0016] FIP-A: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGG (SEQ ID NO.4);
[0017] FIP-B: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGGTG (SEQ ID NO. 5);
[0018] BIP: CGTGGGGGAATTATACATGGTTTCCTCCAAAATAATTC (SEQ ID NO.6);
[0019] LoopF:GATGCAGAAGGCGAGCAC (SEQ ID NO.7);
[0020] LoopB:ATTGGCTTTTTTACATAAG (SEQ ID NO.8);
[0021] The target gene fragment amplified by the primer set is 244 bp in length, and the corresponding typical wild-type nucleotide sequence is as follows:
[0022] TAGATCTGTCTCAGTACACGAAGCGCCGTCTCTTTCTTGGCGCGAAACTTCTACAACCTGAAGTACGTCGCGTTAGTGCTCGCCTTCTGCATCAACTTCGTACTGCTGTTTTATAAGGTGAGTAAGTTTATTATTTCGTGGGGGAATTATACATGAAAGATTATTGGCTTTTTTTACATAAGAATGAGACTAGGAATTATTTTGGAGGAAAACAGTCGCATATCAGAAGTGTAGGAGCAGAC (SEQ ID NO.9);
[0023] The core design principle of primers is to precisely locate the Y4667D mutation recognition site at the 3' end of inner primer FIP-A and the Y4667C mutation recognition site at the 3' end of inner primer FIP-B. This leverages the base differences between wild-type and mutant types to achieve specific recognition, completely avoiding non-specific amplification and ensuring detection accuracy. The first primer set uses FIP-A and FIP-B simultaneously in the same reaction system to achieve simultaneous screening of both mutations. The second and third primer sets, respectively, perform specific amplification for a single mutation, used for secondary genotyping verification.
[0024] Secondly, this application provides a method for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt, comprising the following steps:
[0025] S1. Extraction of genomic DNA from the rice stem borer:
[0026] Genomic DNA was extracted from single rice stem borer samples using a commercial insect genomic DNA extraction kit or a simple, self-made rapid extraction reagent. The extracted DNA was then diluted to a concentration of 0.1–10 ng / μL for later use.
[0027] S2. Prepare LAMP reaction system as needed:
[0028] Each LAMP reaction system has a total volume of 15-30 μL (e.g., 15 μL, 20 μL, 25 μL, 30 μL), comprising LAMP premix, 10× primer mixture A, 10× primer mixture B, or 10× primer mixture C, the DNA template obtained in step S1, and the remainder being nuclease-free water; wherein the 10× primer mixture A, 10× primer mixture B, and 10× primer mixture C are respectively mixtures of the first primer set, the second primer set, and the third primer set described in the first aspect;
[0029] In the 10× primer mixture A, the final concentrations of each primer are as follows: 8~25 μM each for FIP-A, FIP-B and BIP, 0.5~5 μM each for F3-A, F3-B and B3, and 1~8 μM each for LoopF and LoopB; preferably, the final concentration ratio of each primer is FIP-A:FIP-B:BIP:F3-A:F3-B:B3:LoopF:LoopB = 8:8:16:1:1:2:(4~8):(4~8);
[0030] In the 10× primer mixture B, the final concentrations of each primer are: 8~25μM for FIP-A and BIP, 0.5~5μM for F3-A and B3, and 1~8μM for LoopF and LoopB; preferably, the final concentration ratio of each primer is FIP-A:BIP:F3-A:B3:LoopF:LoopB = 8:8:1:1:(2~4):(2~4);
[0031] In the 10× primer mixture C, the final concentrations of each primer are: 8~25 μM for FIP-B and BIP, 0.5~5 μM for F3-B and B3, and 1~8 μM for LoopF and LoopB; preferably, the final concentration ratio of each primer is FIP-B:BIP:F3-B:B3:LoopF:LoopB = 8:8:1:1:(2~4):(2~4);
[0032] S3, Isothermal Amplification Reaction:
[0033] Place the prepared reaction system in a constant temperature water bath or metal bath and amplify it for 10-30 minutes at a constant temperature of 60-68℃ to complete the specific amplification of nucleic acid. For example, amplify at 60℃ for 30 minutes, at 63-65℃ for 20 minutes, at 65-67℃ for 15 minutes, and at 67-68℃ for 10 minutes; preferably, amplify at 63-67℃ for 10-20 minutes.
[0034] S4. Visual interpretation of results:
[0035] After amplification, the detection results can be directly interpreted based on the color change of the reaction solution, without the need for electrophoresis or sequencing. Under the detection system and reaction conditions established in this invention, a magenta color in the reaction solution indicates a negative result, meaning no target mutation was detected; a yellow or orange color in the reaction solution indicates a positive result, meaning the target mutation allele is present in the sample. Yellow typically corresponds to a homozygous mutation, and orange typically corresponds to a heterozygous mutation. It should be noted that the interpretation between orange and yellow colors is affected by factors such as reaction time, template concentration, template quality, and system stability; therefore, the above color correspondence is an empirical interpretation rule under this detection system.
[0036] During testing, a LAMP reaction system containing the first primer set was first used for initial screening to detect the two mutations. If the reaction solution turned rose-red (negative), the sample was determined to be wild-type, and no Y4667D or Y4667C mutations were detected. If the reaction solution turned yellow or orange (positive), the sample was determined to carry at least one mutant allele. For samples that tested positive in the initial screening, a second genotyping test was performed using LAMP reaction systems containing the second and third primer sets, respectively, to determine the specific mutation type. A positive reaction with the second primer set indicated that the sample carried the Y4667D mutation, and a positive reaction with the third primer set indicated that the sample carried the Y4667C mutation.
[0037] Typical colorimetric results are shown in Figure 1 The DNA concentrations of the wild-type, heterozygous mutant, and homozygous mutant samples shown in the figure are approximately 5 ng / μL. Under this template concentration, all three primer sets exhibit a consistent color development pattern: the heterozygous mutant reaction solution is orange, and the homozygous mutant reaction solution is yellow.
[0038] It should be noted that the color development process of the homozygous mutant reaction solution typically follows a pattern of magenta → orange-red → orange-yellow → yellow. Under the same target DNA input conditions, homozygous mutant samples, containing more copies of the target sequence, generally have a faster isothermal amplification rate than heterozygous samples. Therefore, when a homozygous mutant sample has turned yellow, a heterozygous mutant sample may still appear orange. Furthermore, the color development result is affected by the initial DNA template concentration. In actual testing, the DNA extraction quality of different individual samples may vary, and the DNA concentration measurement itself has a certain margin of error, resulting in the amount of template added to the reaction system not being absolutely consistent. When the actual template concentration of a heterozygous sample is higher, or the actual template concentration of a homozygous sample is lower, the difference in amplification efficiency between the two may be weakened, leading to some heterozygous samples also appearing yellow at the reaction endpoint. Therefore, yellow is more suitable as a primary criterion for interpreting homozygous mutants than as an absolute criterion. For samples whose colors are at the boundary and difficult to distinguish accurately, the template can be appropriately diluted and retested. Generally, homozygotes tend to remain yellow after dilution, while heterozygotes may revert to orange.
[0039] When the method of the present invention is used for rapid detection of specific mutation sites related to resistance in rice stem borer in the field, multiple individuals in the field population can be detected sequentially, and the number of individuals with the Y4667D mutation or the Y4667C mutation can be counted respectively, thereby obtaining the mutation frequency of Y4667D or Y4667C.
[0040] Thirdly, this application proposes a detection reagent for the Y4667D / C mutation of the nicotine receptor in the mole smelt, comprising the detection primer combination described in the first aspect (including a first primer set, a second primer set, and a third primer set).
[0041] Fourthly, this application proposes a detection kit for the Y4667D / C mutation of the nicotine receptor in the mole spp., comprising the detection primer combination described in the first aspect or the detection reagent described in the third aspect. Preferably, the kit contains a first primer set mixture, a second primer set mixture, and a third primer set mixture, respectively, for initial screening to simultaneously detect two mutations and for secondary genotyping detection.
[0042] Fifthly, the detection primer combination and detection method proposed in this application can be applied to any of the following scenarios:
[0043] (1) Rapidly detect the genotypes and frequencies of Y4667D and Y4667C mutations in field populations of rice stem borer;
[0044] (2) Assess the resistance level of rice stem borer to diamide insecticides, including chlorantraniliprole, tetrazolium acetamiprid, bromocyanamide, thiophanate-methyl, flubendiamide, tetrachlorantraniliprole, etc.
[0045] (3) Conduct field resistance risk early warning and guide the scientific rotation and alternation of insecticides with different mechanisms of action;
[0046] (4) Assist in the formulation of regional integrated management strategies for rice stem borer resistance to delay the development of resistance.
[0047] The beneficial effects of this invention are:
[0048] Compared with existing technologies such as traditional PCR, sequencing, and bioassay, this invention has the following core advantages:
[0049] (1) One tube for multiple tests, efficient and convenient: The innovative design of 8 primer combinations (first primer set) places the recognition sites of the two mutations Y4667D and Y4667C at the 3' ends of the two inner primers FIP-A and FIP-B, respectively, to achieve simultaneous screening of two key resistance mutations in a single tube reaction. Compared with the traditional separate detection scheme, it reduces the operation steps and reagent consumption by about 50%, and significantly improves the detection efficiency;
[0050] (2) Flexible splitting and selection as needed: For each specific site, it can be split into an independent 6-primer detection system (second and third primer sets), which can be used alone for specific detection or as a secondary typing verification of positive samples in the initial screening, meeting the needs of different scenarios such as high-throughput screening and accurate typing;
[0051] (3) Excellent specificity: Each primer set targets the corresponding mutation site, accurately distinguishing between wild type and Y4667D and Y4667C mutants, with no cross-specific amplification and reliable detection results;
[0052] (4) Fast and convenient: The entire process is isothermal amplification can be completed in 10 to 30 minutes. The operation process is simple, no professional technical training is required, and it is suitable for grassroots plant protection stations and field operations.
[0053] (5) The results are intuitive: the color change of the reaction solution can be directly interpreted by the naked eye, without the need for subsequent steps such as gel electrophoresis and gene sequencing, and the results are clear at a glance;
[0054] (6) High sensitivity: It can stably detect trace amounts of genomic DNA as low as 0.001 ng / μL, meeting the detection requirements of single-headed rice stem borer larvae, pupae or adult remains;
[0055] (7) Low cost: No expensive and precision instruments are required, and the cost of reagents and consumables is much lower than that of conventional molecular detection technology. It is suitable for high-throughput screening of large batches of field samples and is easy to promote and apply on a large scale.
[0056] (8) This technology has important production and application value for real-time monitoring of field resistance dynamics, guiding scientific drug use, delaying the development of resistance, and extending the service life of diamide agents. It is especially suitable for early warning and control in areas with low to medium resistance. Attached Figure Description
[0057] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments and descriptions of this application are used to explain this application and do not constitute an undue limitation of this application. Wherein:
[0058] Figure 1 This diagram illustrates the colorimetric results of primary screening and genotyping of different genotype samples using primer sets 1, 2, and 3. From left to right in each image: blank control, wild-type negative control, heterozygous mutant, and homozygous mutant. Primer set 1 (8 primers) is used for primary screening to simultaneously detect Y4667D and Y4667C mutations, displaying a yellow or orange color when positive. Primer set 2 (6 primers) specifically detects the Y4667D mutation; primer set 3 (6 primers) specifically detects the Y4667C mutation.
[0059] Figure 2 To verify the sensitivity test results of the first, second, and third primer sets in the example.
[0060] Figure 3 To verify the specificity test results of the first, second, and third primer sets in the example.
[0061] Figure 4 Comparison of LAMP staining and sequencing results for different field populations of the rice stem borer Y4667D / Y4667C mutant. Detailed Implementation
[0062] The present application will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are merely illustrative and do not constitute a limitation on the scope of protection of the present application. Those skilled in the art can make reasonable modifications and optimizations without departing from the core concept and scope of protection of the present application, and all such modifications and optimizations shall fall within the scope of protection of the present application.
[0063] Example 1: Primer Design and Synthesis
[0064] This embodiment aims to illustrate the design and synthesis of primers for detecting the Y4667D / C mutation of the nicotine receptor in the mole spp., including the following steps:
[0065] (1) Target sequence acquisition: The full-length sequence of the nicotine receptor gene of the mole spp. was retrieved from the NCBI gene database. The accession number is GenBank accession: KP213290.2. Two key resistance mutation sites, Y4667D (TAC→GAC) and Y4667C (TAC→TGC), were precisely located.
[0066] (2) Primer design: Three sets of specific LAMP primer combinations were designed targeting conserved gene fragments containing mutation sites:
[0067] The first primer set (8 primers, used for simultaneous detection in the initial screening): consists of outer primers F3-A, F3-B, B3, inner primers FIP-A, FIP-B, BIP, and loop primers LoopF and LoopB, which simultaneously detect two mutations, Y4667D and Y4667C, in one reaction system.
[0068] The second primer set (6 primers, used for specific detection of Y4667D) consists of outer primers F3-A and B3, inner primers FIP-A and BIP, and loop primers LoopF and LoopB.
[0069] The third primer set (6 primers, used for specific detection of Y4667C) consists of outer primers F3-B and B3, inner primers FIP-B and BIP, and loop primers LoopF and LoopB.
[0070] The design process strictly controls core parameters such as primer melting temperature, GC content, and secondary structure. The Y4667D mutation identification site is precisely placed at the 3' end of the inner primer FIP-A, and the Y4667C mutation identification site is precisely placed at the 3' end of the inner primer FIP-B to ensure the specificity of genotype discrimination.
[0071] (3) Primer synthesis and purification: The primers were synthesized by a professional biotechnology company and purified by high performance liquid chromatography (HPLC) to ensure primer purity and amplification stability;
[0072] (4) The nucleotide sequences of each primer are as follows:
[0073] F3-A: TAGATCTGTCTCAGTACACGAAG (SEQ ID NO. 1);
[0074] F3-B: GCCGTCTCTTTCTTGGCGCGAA (SEQ ID NO. 2);
[0075] B3: GTCTGCTCCTACACTTCTG (SEQ ID NO.3);
[0076] FIP-A: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGG (SEQ ID NO.4);
[0077] FIP-B: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGGTG (SEQ ID NO. 5);
[0078] BIP: CGTGGGGGAATTATACATGGTTTCCTCCAAAATAATTC (SEQ ID NO.6);
[0079] LoopF:GATGCAGAAGGCGAGCAC (SEQ ID NO.7);
[0080] LoopB:ATTGGCTTTTTTACATAAG (SEQ ID NO.8);
[0081] The target fragments amplified by the above primers are all 244 bp in length, and the typical wild-type sequence is shown in SEQ ID NO.9. The first primer set achieves simultaneous screening of two mutations by using FIP-A and FIP-B in the same reaction system; the second and third primer sets specifically identify the Y4667D and Y4667C mutations, respectively, for secondary typing verification.
[0082] TAGATCTGTCTCAGTACACGAAGCGCCGTCTCTTTCTTGGCGCGAAACTTCTACAACCTGAAGTACGTCGCGTTAGTGCTCGCCTTCTGCATCAACTTCGTACTGCTGTTTTATAAGGTGAGTAAGTTTATTATTTCGTGGGGGAATTATACATGAAAGATTATTGGCTTTTTTTACATAAGAATGAGACTAGGAATTATTTTGGAGGAAAACAGTCGCATATCAGAAGTGTAGGAGCAGAC (SEQ ID NO.9).
[0083] Example 2
[0084] A method for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt includes the following steps:
[0085] S1. Extraction of genomic DNA from the rice stem borer:
[0086] Genomic DNA was extracted from single rice stem borer samples using a commercial insect genomic DNA extraction kit or a simple, self-made rapid extraction reagent. The extracted DNA was then diluted to a concentration of 0.1–10 ng / μL for later use.
[0087] S2. Prepare LAMP reaction system as needed:
[0088] Simultaneous detection during initial screening: Prepare a LAMP reaction system with a total volume of 20 μL, including LAMP premix (ColorDetect LAMP / RT-LAMP 2×Master Mix), 10× primer mixture A (containing 8 primers from the first primer set shown in SEQ ID NO.1~8), 1 μL of DNA template obtained in step S1, and the remainder being nuclease-free water; in the 10× primer mixture A, the final concentrations of each primer are as follows: FIP-A and FIP-B 8 μM each, BIP 16 μM, F3-A and F3-B 1 μM each, B3 2 μM, LoopF and LoopB 4 μM each (final concentration ratio of 8:8:16:1:1:2:4:4).
[0089] Secondary genotyping specificity detection: For initially positive samples, prepare the following two LAMP reaction systems:
[0090] The reaction system for the second primer set was as follows: 10× primer mixture B (containing F3-A, B3, FIP-A, BIP, LoopF, and LoopB) was used. The final concentrations of each primer were: 16 μM each for FIP-A and BIP, 2 μM each for F3-A and B3, and 4 μM each for LoopF and LoopB (final concentration ratio 8:8:1:1:4:4).
[0091] The reaction system for the third primer set was as follows: 10× primer mixture C (containing F3-B, B3, FIP-B, BIP, LoopF, and LoopB) was used. The final concentrations of each primer were: 16 μM each for FIP-B and BIP, 2 μM each for F3-B and B3, and 4 μM each for LoopF and LoopB (final concentration ratio 8:8:1:1:4:4).
[0092] S3, Isothermal Amplification Reaction:
[0093] The two prepared reaction systems were placed in a constant temperature water bath or metal bath and amplified for 15 minutes at a constant temperature of 67±1℃ to complete the specific amplification of nucleic acid.
[0094] S4. Visual interpretation of results:
[0095] After amplification, directly observe the color change of the reaction solution; no further electrophoresis or sequencing is required. A rose-red reaction solution indicates a negative result, meaning no target mutation was detected; a yellow reaction solution indicates a positive result, meaning the sample contains a mutation site, and the genotype may be heterozygous or homozygous. As explained above, under conditions of roughly the same sample DNA concentration, yellow is used to determine homozygous mutants, and orange is used to determine heterozygous mutants. Typical color development results are shown below. Figure 1 As can be seen from the figure, the color of the heterozygous Y4667D / Y4667C mutant is darker than that of the homozygous Y4667D / Y4667C mutant, which is orange.
[0096] Interpretation logic:
[0097] Initial screening: Simultaneous detection using the first primer set (8 primers). If the reaction solution is magenta, it indicates that the sample is wild-type and no Y4667D or Y4667C mutation was detected; if the reaction solution is yellow or orange, it indicates that the sample carries at least one mutation (Y4667D and / or Y4667C).
[0098] Secondary genotyping: For initially positive samples, the second primer set (specifically detecting Y4667D) and the third primer set (specifically detecting Y4667C) are used for testing. A positive reaction with the second primer set indicates carrying the Y4667D mutation; a positive reaction with the third primer set indicates carrying the Y4667C mutation. Positive reactions with both primer sets indicate carrying both mutations simultaneously (compound heterozygous).
[0099] A detection kit for the Y4667D / C mutation of the nicotine receptor in the mole smelt includes:
[0100] (1) LAMP primer sets: The first primer set mixture (8 primers), the second primer set mixture (6 primers), and the third primer set mixture (6 primers) are provided in lyophilized powder or liquid form, respectively.
[0101] (2) Controls: Positive control is a DNA template containing the Y4667D and / or Y4667C mutation sites; negative control is a DNA template containing the wild-type target gene sequence; blank control is sterile nuclease-free water.
[0102] (3) DNA rapid extraction kit: commercial insect genomic DNA extraction kit or rapid extraction lysis buffer.
[0103] (4) LAMP premix: Color Detect LAMP / RT-LAMP 2×Master Mix (Nanjing Novizan Biotechnology Co., Ltd.) or other equivalent products can be used.
[0104] When using this method, the first primer set is used for initial screening and simultaneous detection. For samples that are positive in the initial screening, the second and third primer sets are used for secondary typing to determine the specific mutation type.
[0105] Verification Example
[0106] 1. Sensitivity test:
[0107] Genomic DNA samples of the rice stem borer (Y4667D and Y4667C mutant homozygous types) at known concentrations, as well as an equal volume mixture of both (simulating a compound heterozygous type carrying both mutations), were serially diluted 10-fold to obtain concentrations of 1.0 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, and 10-fold. -4 ng / μL, 10 -5 ng / μL. LAMP amplification was performed using the first primer set (simultaneous detection of Y4667D and Y4667C), the second primer set (specific detection of Y4667D), and the third primer set (specific detection of Y4667C), respectively. The results are as follows. Figure 2 As shown.
[0108] Figure 2 In the image, the first row shows the detection results of the first primer set on the mixed DNA sample; the second row shows the detection results of the second primer set on the Y4667D mutant homozygous DNA; and the third row shows the detection results of the third primer set on the Y4667C mutant homozygous DNA. The results show that the DNA concentration decreased to 10... -5The reaction solution turns rose-red (negative) at 0.001 ng / μL and yellow (positive) at 0.001 ng / μL, indicating that this method can stably detect trace amounts of DNA template down to 0.001 ng / μL, with extremely high detection sensitivity, fully meeting the detection requirements for single-headed rice stem borer larvae, pupae, or adult remains.
[0109] 2. Specificity test:
[0110] Using wild-type genomic DNA of the rice stem borer, homozygous Y4667D mutant genomic DNA, homozygous Y4667C mutant genomic DNA, and a mixed heterozygous Y4667D / Y4667C compound DNA (mixed in equal amounts), as well as genomic DNA from other common rice paddy pests (rice stem borer, rice leaf roller, rice leaf beetle, and brown planthopper) as templates (DNA concentration approximately 5 ng / μL), LAMP amplification was performed using the three primer sets of this invention. The results are as follows: Figure 3 As shown.
[0111] Figure 3 In the diagram, the first row shows the detection results of the first primer set (simultaneous detection of two mutations), with the first tube containing Y4667D / Y4667C heterozygous mixed DNA (yellow positive); the second row shows the detection results of the second primer set (specifically detecting the Y4667D mutation), with the first tube containing Y4667D mutant homozygous DNA (yellow positive); and the third row shows the detection results of the third primer set (specifically detecting the Y4667C mutation), with the first tube containing Y4667C mutant homozygous DNA (yellow positive). All primer sets showed no amplification of wild-type rice stem borer and other rice paddy pests (the reaction solution was rose-red), indicating that the detection method of this invention has excellent species and genotype specificity, with no cross-specific amplification.
[0112] Application examples
[0113] This application example aims to verify the practical effect of the invention through field samples and to illustrate its application in prevention and control.
[0114] 1. Field sample collection and rearing: Before the overwintering generation emerges in April 2025, mature larvae of the rice stem borer were collected from rice fields in high-risk control areas for diamide pesticides in Nanchang, Jiangxi and Hangzhou, Zhejiang. They were reared under standard laboratory conditions (temperature 27±1℃, relative humidity 70%~80%, photoperiod 16L:8D) for future use.
[0115] 2. Field sample testing and results:
[0116] Offspring larvae samples from two random geographical populations were used for initial mutation screening and genotyping using three sets of specific primers constructed in this application. The results were verified by PCR amplification followed by sequencing. Figure 4 As shown. Simultaneously, the chlorantraniliprole toxicity was determined in the laboratory using the rice seedling immersion method on the second instar larvae of the aforementioned populations.
[0117] The results showed that the LAMP detection results of 10 field samples were completely consistent with the sequencing results, and the mutation site detection accuracy reached 100%, indicating that the detection system is highly reliable. Notably, the mutation detected in the Nanchang population of Jiangxi Province was Y4667D, while that in the Hangzhou population of Zhejiang Province was Y4667C, showing that this mutation type has significant population specificity. This further verifies the specific recognition capability of the three primer sets designed in this invention (simultaneous primary screening detection + secondary genotyping specific detection).
[0118] Previous studies have shown a significant positive correlation between the resistance level of rice stem borers (Chilodonella esculenta) to diamide pesticides and the mutation frequency at the Y4667 site. In the Hangzhou, Zhejiang population, the Y4667C mutation frequency was approximately 60% (30% homozygous), with a resistance fold increase >200-fold; in the Nanchang, Jiangxi population, the Y4667D mutation frequency was approximately 70% (50% homozygous), with a resistance fold increase >350-fold, both reaching high resistance levels. These results confirm that both the Y4667D and Y4667C mutations are key molecular markers for resistance to diamide insecticides. The primer combinations and methods established in this study can accurately identify specific mutation types in different populations, providing reliable technical support for field resistance monitoring and precision pesticide application.
[0119] 3. Differentiated prevention and control guidance in the field:
[0120] Based on the LAMP detection system of this invention, the precise identification of the Y4667 site mutation frequency and resistance level assessment of the rice stem borer population in two regions are proposed, and the following regional resistance management strategies are proposed:
[0121] 1) Areas with high mutation frequency and high resistance: Strictly control the frequency of use of diamide pesticides, fully rotate pesticides with different mechanisms of action, and block the further expansion of resistant populations;
[0122] 2) Areas with low mutation frequency and low drug resistance: Scientifically manage the dosage and frequency of pesticide use, and coordinate with agricultural control and ecological regulation measures to provide early warning of resistance;
[0123] 3) Regional Promotion: With the rapid detection technology of this invention as support, implement precise drug use and drug rotation programs to improve quality and efficiency, delay the development of resistance, and extend the service life of diamide drugs.
[0124] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A primer combination for detecting the Y4667D / C mutation of the nicotine receptor in the mole davidii, characterized in that, It includes a first primer set for initial screening that simultaneously detects Y4667D and Y4667C mutations, a second primer set for secondary typing that specifically detects Y4667D mutations, and a third primer set for secondary typing that specifically detects Y4667C mutations. The first primer set consists of outer primer F3-A, outer primer F3-B, outer primer B3, inner primer FIP-A, inner primer FIP-B, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to simultaneously detect two mutations, Y4667D and Y4667C, in a single reaction system. The second primer set consists of outer primer F3-A, outer primer B3, inner primer FIP-A, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to specifically detect the Y4667D mutation; The third primer set consists of outer primer F3-B, outer primer B3, inner primer FIP-B, inner primer BIP, loop primer LoopF, and loop primer LoopB, and is used to specifically detect the Y4667C mutation. The primer sequences are as follows: F3-A: TAGATCTGTCTCAGTACACGAAG (SEQ ID NO. 1); F3-B: GCCGTCTCTTTCTTGGCGCGAA (SEQ ID NO. 2); B3: GTCTGCTCCTACACTTCTG (SEQ ID NO.3); FIP-A: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGG (SEQ ID NO.4); FIP-B: TAAACTTACTCACCTTATAAAACAGCCTTCTACAACCTGAAGGTG (SEQ ID NO. 5); BIP: CGTGGGGGAATTATACATGGTTTCCTCCAAAATAATTC (SEQ ID NO.6); LoopF:GATGCAGAAGGCGAGCAC (SEQ ID NO.7); LoopB: ATTGGCTTTTTTCATAAG (SEQ ID NO. 8).
2. The primer combination for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt according to claim 1, characterized in that, The target gene fragment amplified by the primer set is 244 bp in length, and the corresponding typical wild-type nucleotide sequence is as follows: TAGATCTGTCTCAGTACACGAAGCGCCGTCTCTTTCTTGGCGCGAAACTTCTACAACCTGAAGTACGTCGCGTTAGTGCTCGCCTTCTGCATCAACTTCGTACTGCTGTTTTATAAGGTGAGTAAGTTTATTATTTCGTGGGGGAATTATACATGAAAGATTATTGGCTTTTTTTACATAAGAATGAGACTAGGAATTATTTTGGAGGAAAACAGTCGCATATCAGAAGTGTAGGAGCAGAC (SEQ ID NO.9).
3. A method for detecting the Y4667D / C mutation of the nicotine receptor in the mole mullet, characterized in that, Includes the following steps: S1. Extract genomic DNA from the rice stem borer sample to be tested, and dilute it to a concentration of 0.1~10 ng / μL for later use; S2. Prepare LAMP reaction system as needed: The total volume of each LAMP reaction system is 15~30μL, including LAMP premix, 10× primer mixture A or 10× primer mixture B or 10× primer mixture C, DNA template obtained in step S1, and the remainder is nuclease-free water. 10× primer mixture A, 10× primer mixture B, and 10× primer mixture C are respectively mixtures of the first primer set, the second primer set, and the third primer set as described in claim 1; S3. Place the prepared LAMP reaction system under constant temperature conditions of 60~68℃ and amplify isothermally for 10~30 minutes. S4. After the reaction, observe the color change with the naked eye to interpret the results; a rose-red reaction solution indicates a negative result, meaning no corresponding mutation was detected; an orange or yellow reaction solution indicates a positive result, meaning the sample contains a mutation site and the genotype may be heterozygous or homozygous. The initial screening process involves using a LAMP reaction system containing the first primer set to detect two mutations simultaneously. If the reaction solution is magenta, it indicates that the sample is wild-type and no Y4667D or Y4667C mutations were detected. If the reaction solution is yellow or orange, it indicates that the sample carries at least one mutation. For samples that are positive in the initial screening, a second genotyping test is performed using a LAMP reaction system containing the second and third primer sets to determine whether the specific mutation type is Y4667D or Y4667C.
4. The method for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt according to claim 3, characterized in that, In step S2, the final concentrations of each primer in the 10× primer mixture A are as follows: 8~25 μM for FIP-A, FIP-B and BIP, 0.5~5 μM for F3-A, F3-B and B3, and 1~8 μM for LoopF and LoopB. In the 10× primer mixture B, the final concentrations of each primer are as follows: FIP-A and BIP 8~25μM each, F3-A and B3 0.5~5μM each, LoopF and LoopB 1~8μM each; In the 10× primer mixture C, the final concentrations of each primer are as follows: FIP-B and BIP 8~25μM each, F3-B and B3 0.5~5μM each, and LoopF and LoopB 1~8μM each.
5. The method for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt according to claim 4, characterized in that, In the 10× primer mixture A, the final concentration ratio of each primer is FIP-A:FIP-B:BIP:F3-A:F3-B:B3:LoopF:LoopB = 8:8:16:1:1:2:(4~8):(4~8); in the 10× primer mixture B, the final concentration ratio of each primer is FIP-A:BIP:F3-A:B3:LoopF:LoopB = 8:8:1:1:(2~4):(2~4); in the 10× primer mixture C, the final concentration ratio of each primer is FIP-B:BIP:F3-B:B3:LoopF:LoopB = 8:8:1:1:(2~4):(2~4).
6. The method for detecting the Y4667D / C mutation of the nicotine receptor in the mole smelt according to claim 3, characterized in that, The isothermal amplification reaction conditions described in step S3 are: isothermal amplification at 63~67℃ for 10~20 minutes.
7. A detection reagent for the Y4667D / C mutation of the nicotine receptor in the mole mullet, characterized in that, The detection reagent includes the detection primer combination as described in claim 1.
8. A detection kit for the Y4667D / C mutation of the nicotine receptor in the mole mullet, characterized in that, The detection kit includes the detection primer combination of claim 1 or the detection reagent of claim 7.
9. The application of a detection primer for the Y4667D / C mutation of the nicotine receptor in rice stem borer in assessing the resistance level of rice stem borer to diamide insecticides, characterized in that, The mutant genotype and frequency of the nicotinic acid receptor Y4667D / C site in the mole spp. can be detected using the detection primer combination described in claim 1 or the detection method described in claim 3, thereby achieving an assessment of drug resistance levels.
10. The application according to claim 9, characterized in that, The application specifically includes any of the following scenarios: (1) Analyze and evaluate the resistance genotype composition of field rice stem borer populations; (2) Monitor the frequency of occurrence of resistance alleles in field populations of rice stem borer; (3) Guide the scientific rotation of insecticides with different mechanisms of action and formulate regional integrated management strategies for insecticide resistance in rice stem borers.