A SNP molecular marker related to phosphorus content of arrow leek pea and application thereof

Abstract

This invention discloses a SNP molecular marker related to phosphorus content in *Vaccaria spp.* and its application. The SNP molecular marker consists of SNP1 and SNP2. SNP1 is located at 98,439,964 bp on chromosome 6 of the *Vaccaria spp.* genome, where an A / C base polymorphism exists. SNP2 is located at 98,439,970 bp on chromosome 6 of the *Vaccaria spp.* genome, where a G / C base polymorphism exists. This marker can be used for marker-assisted selection of the high phosphorus trait in *Vaccaria spp.* By detecting the genotype at this locus, the phosphorus content of mature plants can be predicted earlier, thereby significantly shortening the breeding cycle, reducing breeding costs, and improving selection efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetic breeding technology, specifically relating to an SNP molecular marker related to the phosphorus content of arrowhead peas and its application. Background Technology

[0002] Arrowhead pea (Vicia sativa L.) is a legume with strong stress resistance and nitrogen-fixing ability, and is widely cultivated in many parts of my country. Phosphorus (P) is an essential nutrient element for it, participating in key physiological processes such as energy metabolism and nucleic acid synthesis. It can promote root development, enhance stress resistance, and improve forage quality—high-phosphorus arrowhead pea can meet the phosphorus requirements of livestock and poultry, reduce the use of mineral additives, and as green manure, it can also increase the available phosphorus in the soil and promote the growth of subsequent crops.

[0003] With the increasing demand for forage and the expansion of green manure areas, cultivating specialized varieties that are nutrient-efficient, stress-resistant, and yield-stable has become the direction of industry development. However, the breeding of phosphorus nutritional traits in arrowhead pea faces technical bottlenecks: there are significant phenotypic variations in phosphorus absorption and accumulation capacity among different germplasms, with differences reaching several times, and these are quantitative traits. Traditional breeding relies on phenotypic identification, requiring data to be obtained through chemical testing after plant maturity. This process is cumbersome, costly, and has low throughput (such as sample digestion and colorimetric methods), and is a destructive test, making it difficult to achieve large-scale screening at the seedling stage. Secondly, although genome sequencing has made progress, there is still a lack of tightly linked SNP markers for phosphorus content and phosphorus use efficiency, and a molecular marker-assisted breeding system has not yet been established. The industry urgently needs SNP markers that are closely linked to phosphorus content traits, have high specificity, and are easy to detect, in order to compensate for the shortcomings of traditional breeding and accelerate the cultivation of high-quality varieties.

[0004] SNP markers, due to their density, stability, and high-throughput detection capabilities, have become core tools in crop breeding and are widely used in the genetic analysis of mineral elements in leguminous crops such as soybeans and alfalfa. However, their application in the targeted selection of phosphorus content in arrowhead peas remains a gap. Therefore, identifying SNP sites significantly associated with phosphorus content and establishing molecular detection methods is of great significance for shortening the breeding cycle, accelerating the breeding of high-phosphorus varieties, filling technological gaps, and supporting the coordinated development of ecological agriculture and animal husbandry. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker closely related to the phosphorus content of arrowhead pea and its application, so as to achieve efficient and rapid screening of arrowhead pea germplasm with high phosphorus content.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] In a first aspect, the present invention claims protection for an SNP molecular marker related to the phosphorus content of arrowhead peas, the SNP molecular marker comprising a nucleotide sequence as shown in SEQ ID NO:1, wherein the nucleotide sequence contains two SNP sites, SNP1 and SNP2; wherein SNP1 is located at 327 bp of SEQ ID NO:1 and has A / C polymorphism, and SNP2 is located at 333 bp of SEQ ID NO:1 and has G / C polymorphism.

[0008] Furthermore, SNP1 corresponds to position 98439964 bp on chromosome 6 of the *Vicia sativa* genome; SNP2 corresponds to position 98439970 bp on chromosome 6 of the *Vicia sativa* genome, and the Genbank accession number for chromosome 6 of the *Vicia sativa* genome is CM038797.1.

[0009] Furthermore, if SNP1 is an A base and SNP2 is a G base, then the tested arrowhead pea is a high-phosphorus material; if SNP1 is a C base and SNP2 is a C base, then the tested arrowhead pea is a low-phosphorus material.

[0010] Secondly, the present invention claims protection for a primer pair for detecting the SNP molecular marker of claim 1, the primer pair consisting of an upstream primer shown in SEQ ID NO:2 and a downstream primer shown in SEQ ID NO:3.

[0011] Furthermore, the primer pairs were used to perform PCR amplification of the genomic DNA of the target *Vaccaria spp.*, and the amplification products were sequenced. If SNP1 is an A base and SNP2 is a G base, then the target *Vaccaria spp.* is a high-phosphorus material; if SNP1 is a C base and SNP2 is a C base, then the target *Vaccaria spp.* is a low-phosphorus material.

[0012] Thirdly, the present invention claims protection for a kit for detecting phosphorus content in arrowhead peas, the kit comprising the aforementioned primer pair.

[0013] Fourthly, this invention claims protection for a method for identifying or assisting in the identification of phosphorus content in arrowhead peas, comprising the following steps:

[0014] (1) Extract genomic DNA from the arrowhead peas to be tested;

[0015] (2) Detect the bases at the two SNP sites, SNP1 and SNP2, mentioned above;

[0016] (3) Determine the phosphorus content of arrow pea based on the bases of the two SNP sites SNP1 and SNP2: If SNP1 is an A base and SNP2 is a G base, the arrow pea to be tested is a high phosphorus content material; if SNP1 is a C base and SNP2 is a C base, the arrow pea to be tested is a low phosphorus content material.

[0017] Furthermore, the method for detecting the bases of the two SNP sites SNP1 and SNP2 in step (2) is as follows: PCR amplification of the genomic DNA of the target arrowhead pea is performed, and the amplification product is sequenced using the Sanger sequencing method.

[0018] Fifthly, the present invention claims protection for a method for breeding arrow-shaped peas with high phosphorus content, comprising: detecting the bases of the aforementioned two SNP sites, SNP1 and SNP2, during the breeding process, and selecting arrow-shaped pea individuals with SNP1 being an A base and SNP2 being a G base as high phosphorus content materials for subsequent breeding.

[0019] Sixthly, the present invention claims protection for the use of the aforementioned SNP molecular marker, the aforementioned primer pair, or the aforementioned kit in any of the following:

[0020] (a) To identify or assist in the identification of phosphorus content in arrowhead peas;

[0021] (b) Screening or assisted screening of arrowhead pea germplasm resources with high phosphorus content;

[0022] (c) Prepare a product for detecting the phosphorus content of arrowhead peas;

[0023] (d) Molecular marker-assisted breeding of arrow pea with high phosphorus content.

[0024] In the technical solution of this invention, the arrowhead pea includes cultivated arrowhead pea and its closely related germplasm.

[0025] In a specific embodiment of the present invention, the PCR amplification reaction system is as follows: the amplification system consists of 5 μL of 2×PCRMasterMix, 1 μL of 100 ng / μL genomic DNA, 1 μL each of 10 μM upstream and downstream primers, and water is used to bring the volume to 10 μL.

[0026] In a specific embodiment of the present invention, the PCR amplification program is as follows: 98℃ for 30s; 98℃ for 10s, 56℃ for 30s, 72℃ for 30s, for a total of 35 cycles; 72℃ for 2min.

[0027] This invention utilizes whole-genome sequencing of *Vaccaria buergeriana*. Based on the sequencing results, genome-wide association analysis (GWAS) and phenotypic analysis were employed to select SNP markers associated with phosphorus content in *Vaccaria buergeriana* from SNPs with allele frequencies >5%. Specifically, SNP1 (with A / C polymorphism at this locus) and SNP2 (with G / C polymorphism at this locus) were identified on chromosome 6 at 98439964 bp. The results showed that when SNP1 was A and SNP2 was G, the husk phosphorus content in *Vaccaria buergeriana* reached 0.29%; when both SNP1 and SNP2 were C, the husk phosphorus content was 0.23%, with a highly significant difference (P < 0.01).

[0028] The beneficial effects of this invention are:

[0029] This invention investigates and statistically analyzes the phosphorus content phenotype of 93 *Vaccinium bracteatum* resource populations, and performs GWAS analysis using resequencing genotype data to identify major loci for high phosphorus content. Furthermore, it develops molecular markers associated with high phosphorus content in *Vaccinium bracteatum*. These markers enable rapid screening of high-phosphorus *Vaccinium bracteatum* materials, shortening the breeding cycle, improving selection efficiency, and reducing detection costs, thus providing key technical support for the quality improvement of *Vaccinium bracteatum*. Attached Figure Description

[0030] Figure 1 A distribution map of phosphorus content in 93 *Vaccinium bracteatum* germplasm resource populations.

[0031] Figure 2 GWAS results of phosphorus content in 93 *Vaccinium bracteatum* germplasm resources; where A is the Manhattan plot and B is the QQ plot.

[0032] Figure 3 This is a sequencing peak diagram of the molecular marker PCR amplification results; where A represents samples with SNP1 and SNP2 containing A and G bases, and B represents samples with SNP1 and SNP2 containing C and C bases.

[0033] Figure 4 A comparison chart of phosphorus content between two samples with different genotypes (A / G, C / C). Detailed Implementation

[0034] This invention provides a SNP molecular marker related to the phosphorus content of *Vaccaria spp.*, comprising two SNP sites, SNP1 and SNP2. SNP1 is located at 98,439,964 bp on chromosome 6 of the *Vaccaria spp.* genome, exhibiting an A / C base polymorphism. SNP2 is located at 98,439,970 bp on chromosome 6 of the *Vaccaria spp.* genome, exhibiting a G / C base polymorphism. In this invention, when SNP1 is an A base and SNP2 is a G base, the hay phosphorus content of *Vaccaria spp.* reaches 0.29%, classifying it as a high-phosphorus material; when SNP1 is a C base and SNP2 is a C base, the hay phosphorus content is 0.23%, classifying it as a low-phosphorus material. The difference between the two is highly significant (P<0.01).

[0035] The SNP molecular marker developed in this invention is associated with the phosphorus content of *Vigna angularis*, and the SNP molecular marker contains the nucleotide sequence shown in SEQ ID NO:1. The preferred method for determining the phosphorus content described in this invention is ultraviolet spectrophotometry (NY / T2017-2011).

[0036] This invention also develops a primer pair for detecting the aforementioned SNP molecular markers. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, specifically: 5'-CAACAAGGAGATGAGATAGTGAA-3'; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3, specifically: 5'-TGATAGGACCATTTCCCAG-3'. The target fragment amplified using this primer pair is 579 bp in size, and its nucleotide sequence is shown in SEQ ID NO:1, containing the target SNP site.

[0037] The present invention also provides the application of the above-mentioned SNP molecular markers or primer sets in screening high-phosphorus arrowhead pea germplasm and assisting in the creation of high-phosphorus arrowhead peas.

[0038] In this invention, the arrowhead pea preferably includes cultivated arrowhead pea and its closely related germplasm.

[0039] This invention also provides a method for screening arrowhead pea germplasm with high phosphorus content, comprising the following steps:

[0040] Using the primers described above, PCR amplification was performed on the genomic DNA of the target *Vaccaria spp.*. If the sequencing verification of the PCR amplification product showed A and G bases, then the target *Vaccaria spp.* plant was a high-phosphorus material; if the sequencing verification of the PCR product showed C and C bases, then the target *Vaccaria spp.* plant was a low-phosphorus material.

[0041] In this invention, the preferred PCR amplification reaction system is: 5 μL of 2×PCR MasterMix, 1 μL of 100 ng / μL genomic DNA, 1 μL each of 10 μM upstream and downstream primers, and water to bring the volume to 10 μL; the preferred PCR amplification program is: 98℃ for 30s; 98℃ for 10s, 56℃ for 30s, 72℃ for 30s, for a total of 35 cycles; 72℃ for 2min.

[0042] This invention utilizes the aforementioned primer pairs to perform PCR amplification on different *Vaccinium bracteatum* genotypes, preferably detecting the target PCR products by agarose gel electrophoresis and identifying the target PCR products using Sanger sequencing. This invention does not have specific limitations on the method of obtaining the *Vaccinium bracteatum* genomic DNA to be tested; conventional extraction methods in the industry are acceptable. In this embodiment, the CTAB method is preferably used to extract *Vaccinium bracteatum* leaf DNA. The specific steps are as follows: Take 0.1 g of fresh leaves, grind them into powder using liquid nitrogen, add 500 μL of CTAB extraction solution preheated to 65℃, and incubate in a water bath for 30 min; add 500 μL of chloroform-isoamyl alcohol (24:1, v / v), vortex to mix, centrifuge and collect the supernatant; add an equal volume of isopropanol to precipitate the DNA, wash with 75% ethanol, dissolve in ddH2O, and detect the DNA concentration using an Eppendorf BioSpectrometer basic analyzer.

[0043] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides an SNP molecular marker related to phosphorus content in arrowhead peas and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0045] Example 1: Detection of phosphorus content in a population of arrowhead pea germplasm resources

[0046] Ninety-three accessions of *Vaccaria spp.* were used as samples, and all germplasm was planted at the Baima Experimental Base of Nanjing Agricultural University under routine field management. Hay samples were collected at the initial flowering stage, and phosphorus content was determined using a UV spectrophotometer (NY / T2017-2011). Each sample was replicated three times, and the average value was taken as the phenotypic value.

[0047] The phosphorus content distribution of 93 *Vaccinium bracteatum* germplasm resource populations is shown in the figure below. Figure 1 As shown.

[0048] Data analysis results show that the phosphorus content of arrowhead peas is continuously distributed, with a median of 0.24% and an average of 0.24% in the hay of the population, and a wide range of variation (0.13%-0.43%), which is consistent with the genetic characteristics of quantitative traits.

[0049] Example 2: Extraction and GWAS analysis of leaf DNA from a *Vaccinium bracteatum* resource population

[0050] Total DNA was extracted from the leaves of 93 *Vaccaria spp.* in Example 1 using the CTAB method. After extraction, the resource population was resequencing to obtain genotype data.

[0051] SNP variation analysis was performed on the genotype data using the GATK software toolkit. After obtaining the SNP variation data, a generalized linear model (LM) was used in the GEMMA software to perform GWAS analysis on the genotype and phosphorus content phenotypic data. The analysis results are as follows: Figure 2 As shown in the figure. The results showed that the SNP1 marker (Chr6-98439964) and SNP2 marker (Chr6-98439970) located on chromosome 6 were significantly associated with the phosphorus content in the hay of *Vigna arvense* (-log). 10 (p) > 5).

[0052] Example 3: Development of specific molecular markers associated with phosphorus traits in arrowhead peas

[0053] For the variant sites SNP1 and SNP2 obtained in Example 2, upstream primer F and downstream primer R were designed using Primer 3.0 software in conjunction with the *Pistacia chinensis* genome sequence. The nucleotide sequence of upstream primer F is shown in SEQ ID NO:2, specifically: 5'-CAACAAGGAGATGAGATAGTGAA-3'; the nucleotide sequence of downstream primer R is shown in SEQ ID NO:3, specifically: 5'-TGATAGGACCATTTCCCAG-3'. The target fragment amplified using this primer pair was 579 bp in size, and its nucleotide sequence is shown in SEQ ID NO:1, containing the target SNP sites.

[0054] Example 4: Application of molecular markers in high-phosphorus breeding of arrowhead pea.

[0055] Materials with different phosphorus contents were randomly selected from the *Vaccinium bracteatum* germplasm of Example 1, and genomic DNA was extracted from the leaves. Using the genomic DNA as a template, PCR amplification was performed using the specific molecular marker primer pair (upstream primer F and downstream primer R) designed in Example 3. The PCR reaction system (10 μL system) consisted of: 1 μL DNA template (concentration 100 ng / μL), 1 μL each of upstream and downstream primers (concentration 10 μM), 5 μL 2×PCR MasterMix, and 2 μL ddH2O. The PCR amplification program was as follows: 98℃ for 30 s; 98℃ for 10 s, 56℃ for 30 s, 72℃ for 30 s, for a total of 35 cycles; 72℃ for 2 min. The PCR products were detected by electrophoresis on a 1% agarose gel, and the successfully amplified products were verified by Sanger sequencing.

[0056] Test results as follows Figure 3 As shown in the figure. Sequencing revealed that materials with target sites of A and G bases had an average phosphorus content of 0.29%, while materials with target sites of C and C bases had an average phosphorus content of 0.23%. The difference between the two was highly significant (P<0.01), indicating that this molecular marker has excellent screening effect. Figure 4 ).

[0057] In summary, by utilizing the SNP molecular markers closely related to the phosphorus content of arrowhead peas as described in this invention, we can rapidly screen germplasm with high phosphorus content, predict phosphorus content levels, significantly improve the efficiency of arrowhead pea quality breeding, and provide reliable technical support for the breeding of high-phosphorus arrowhead pea varieties.

[0058] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

[0059] sequence list

[0060] SEQ ID NO:1

[0061] CAACAAGGAGATGAGATAGTGAAAATATATGAGCAATAGCAGAGTTGAAATTCGATGAGATTGTTTCCACATAGCTTTTATTATTTTCTAAACTTTTCTAAAAATTTCCTCTTACTAGGATATTTACTTTTCAATATTAATACAATTTCCCTTTTCCAGTTCCAAACTTTTACTTTTATCTGTTTGTATGCATAAAGTCCAATGTTTGCTTTGAATGATTATATGCATCTGAAAATAAATATATGTTCATAAATACACGAAAAGAAAATAGAAACATCAGTTACTATAGGCTCTAGGAACTGAGATAACAACCCAAGTCACCAACA(A / C)ATCTC(G / C)GTAGAGTCAGTTTCACAGAAAAATTCCCACAGAATAATCTCTACGAATCCTCGCAGAGCCATCTCTCCCTCGATAGAGATAGATTTCCCAACAAGATTACTAATCTATCATCTCCATTCAGCAATGTACAACGCTTTTGTTCATCACGTTAGTCCCCGAGCAGTGATCATATAAACTCATCACATTAGTCCCCGAGCAGTGATTGTCTCAATTCATCACGTTAGTCCCTGGGAAATGGTCCTATCA。

Claims

1. A SNP molecular marker associated with phosphorus content in arrowhead peas, characterized in that, The SNP molecular marker contains a nucleotide sequence as shown in SEQ ID NO:1, which contains two SNP sites, SNP1 and SNP2. SNP1 is located at 327 bp of SEQ ID NO:1 and has an A / C polymorphism, while SNP2 is located at 333 bp of SEQ ID NO:1 and has a G / C polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP1 corresponds to position 98439964 bp on chromosome 6 of the *Vaccinium bracteatum* genome; the SNP2 corresponds to position 98439970 bp on chromosome 6 of the *Vaccinium bracteatum* genome, and the Genbank accession number for chromosome 6 of the *Vaccinium bracteatum* genome is CM038797.

1.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, If SNP1 is an A base and SNP2 is a G base, then the tested arrowhead pea is a high-phosphorus material; if SNP1 is a C base and SNP2 is a C base, then the tested arrowhead pea is a low-phosphorus material.

4. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair consists of the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:

3.

5. The primer pair according to claim 4, characterized in that, The primer pairs were used to amplify the genomic DNA of the target *Vaccaria spp.* by PCR. The amplified products were sequenced. If SNP1 is an A base and SNP2 is a G base, the target *Vaccaria spp.* is a high-phosphorus material. If SNP1 is a C base and SNP2 is a C base, the target *Vaccaria spp.* is a low-phosphorus material.

6. A reagent kit for detecting the phosphorus content of arrowhead peas, characterized in that, It contains the primer pair as described in claim 4 or 5.

7. A method for identifying or assisting in the identification of phosphorus content in arrowhead peas, characterized in that, Includes the following steps: (1) Extract genomic DNA from the arrowhead peas to be tested; (2) Detect the bases of the two SNP sites, SNP1 and SNP2, as described in claim 1; (3) Determine the phosphorus content of arrow pea based on the bases of the two SNP sites SNP1 and SNP2: If SNP1 is an A base and SNP2 is a G base, the arrow pea to be tested is a high phosphorus content material; if SNP1 is a C base and SNP2 is a C base, the arrow pea to be tested is a low phosphorus content material.

8. The method according to claim 7, characterized in that, The method for detecting the bases of the two SNP sites SNP1 and SNP2 in step (2) is as follows: PCR amplification of the genomic DNA of the target arrowhead pea is performed, and the amplification product is sequenced using the Sanger sequencing method.

9. A method for breeding arrowhead peas with high phosphorus content, characterized in that, include: During the breeding process, the bases of the two SNP sites, SNP1 and SNP2, as described in claim 1 are detected, and individuals of *Vaccinium bracteatum* with SNP1 being an A base and SNP2 being a G base are selected as high-phosphorus materials for subsequent breeding.

10. The use of any of the SNP molecular markers of claims 1-3, any of the primer pairs of claims 4-5, or the kit of claim 6 in any of the following: (a) To identify or assist in the identification of phosphorus content in arrowhead peas; (b) Screening or assisted screening of arrowhead pea germplasm resources with high phosphorus content; (c) Prepare a product for detecting the phosphorus content of arrowhead peas; (d) Molecular marker-assisted breeding of arrow pea with high phosphorus content.

Images