Antibody to the antigen of the human papillomavirus type 16

Abstract

This invention discloses a germplasm screening and identification kit for anthracnose-resistant Camellia oleifera and its application, belonging to the technical field of germplasm screening and identification of anthracnose resistance genes in Camellia oleifera. Based on eight anthracnose resistance genes in Camellia oleifera, this invention develops a germplasm screening and identification kit for anthracnose-resistant Camellia oleifera. This invention enables rapid and efficient identification of anthracnose-resistant Camellia oleifera germplasm and can be used for high-throughput screening of anthracnose-resistant Camellia oleifera lines, providing a new method for disease-resistant breeding of Camellia oleifera.

Description

Technical Field

[0001] This invention belongs to the field of germplasm screening and identification technology for anthracnose resistance genes in Camellia oleifera, specifically involving a germplasm screening and identification kit for anthracnose resistance in Camellia oleifera and its application. Background Technology

[0002] Camellia oleifera, a perennial evergreen plant belonging to the Theaceae family, can grow into either a shrub or a tree. As an ancient woody oil crop in my country, it is ranked alongside olive, oil palm, and coconut as one of the world's four major sources of woody oil. Camellia oleifera is highly adaptable, with cultivation covering major producing areas south of the Yangtze River and the Qinling Mountains, and also found in some areas north of the Yangtze River. It tolerates poor and acidic soils, is easy to cultivate and manage, and has low costs, making it suitable for promotion in difficult-to-cultivate hillside forests.

[0003] However, anthracnose is a major disease affecting leaves and fruits in camellia oleifera, leading to fruit drop, bud drop, and shoot dieback. Currently, the development of anthracnose-resistant camellia oleifera germplasm is limited by the need for specialized experimental conditions and isolated, purified anthracnose strains for susceptibility testing. Furthermore, after inoculation, multiple observations and recordings of the disease index by professionals are required, and the analysis process is cumbersome and time-consuming. In addition, the susceptibility to anthracnose in camellia oleifera under artificial inoculation conditions in the laboratory is affected by factors such as the tenderness of the tea leaves and the state of the mycelium, potentially resulting in differences between different batches. Therefore, there is an urgent need for a simple, stable, and accurate method for detecting the susceptibility of camellia oleifera to anthracnose. Summary of the Invention

[0004] The primary objective of this invention is to design a germplasm screening and identification kit for anthracnose-resistant Camellia oleifera based on the discovery of eight new genes possessing anthracnose resistance. This kit not only enriches the gene resources for disease resistance in Camellia oleifera, providing a potential pathway for research and practical application of anthracnose resistance in Camellia oleifera, but also fills a gap in the field of multi-gene detection for screening and identification of anthracnose-resistant Camellia oleifera germplasm.

[0005] The aforementioned anthracnose-resistant Camellia oleifera germplasm screening and identification kit includes reagents for detecting anthracnose resistance genes in Camellia oleifera; the anthracnose resistance genes in Camellia oleifera are:

[0006] maker-HiC_scaffold_13-snap-gene-1046.11、

[0007] maker-HiC_scaffold_8-snap-gene-364.30、

[0008] maker-HiC_scaffold_11-snap-gene-4.23、

[0009] maker-HiC_scaffold_7-snap-gene-1941.27、

[0010] maker-HiC_scaffold_10-snap-gene-1273.2、

[0011] maker-HiC_scaffold_6-snap-gene-818.12、

[0012] augustus_masked-HiC_scaffold_10-processed-gene-1874.40,

[0013] snap_masked-HiC_scaffold_1-processed-gene-286.57,

[0014] The sequences are shown in SEQ ID NO.1-8.

[0015] Furthermore, the reagents used to detect the anthrax resistance gene in camellia oleifera include PCR detection reagents.

[0016] Furthermore, the primer names and sequences used in the PCR detection reagent are as follows:

[0017] Primer name Primer sequence

[0018] 1046.11-F1 ACACGTCTAGCTGTTGCCTC

[0019] 1046.11-R1 CTTGGTTATGTTGCTCGGCG

[0020] 364.30-F1 AGCACGAAGAGCATGGACAA

[0021] 364.30-R1 TGCCGGAGCTTTTTCTGGAT

[0022] 4.23-F1 CCTGTCTCATCATCGGCTCC

[0023] 4.23-R1 AGTGTAGAATGGGTTGGCGG

[0024] 1941.27-F1 CCTACACCTACGCCGATGTC

[0025] 1941.27-R1 AGTGTAGAACGGGTTGGCTG

[0026] 1273.2-F1 CTCGGTGCTGACTCGTTCTT

[0027] 1273.2-R1 TCCCGTAAGCAACGGGAAAA

[0028] 1874.40-F1 ATGAGTACGTGCGCATAGGG

[0029] 1874.40-R1 TCGAGCCACTCCAACAACTC

[0030] 818.12-F1TCGGCAAGCTCACCAATCTT

[0031] 818.12-R1 AATCCGTGCTTGTTTGGCAC

[0032] 286.57-F1 CAATGCCCACAACACAGCTC

[0033] 286.57-R1CCCTTAGCAAGGTTCTCCCC.

[0034] The second objective of this invention is to provide the application of the aforementioned anthracnose-resistant Camellia oleifera germplasm screening and identification kit for screening and identifying anthracnose-resistant Camellia oleifera germplasm.

[0035] The above application specifically includes the following steps:

[0036] (1) Extract total RNA from Camellia oleifera and reverse transcribe it to synthesize cDNA as a reaction template;

[0037] (2) Use primers to amplify the cDNA of the camellia oil sample to be tested by qPCR;

[0038] (3) The higher the expression level, the stronger its anthrax resistance.

[0039] qPCR is a technique that monitors the entire PCR process in real time by detecting changes in fluorescence signals during DNA amplification. Its core principle is based on conventional PCR, where a specific fluorescent group is added to the reaction system while exponential amplification is performed using a DNA template, primers, and DNA polymerase. As the PCR cycle progresses, amplification products accumulate, and the fluorescence signal intensity is proportional to the amount of product. The instrument collects the fluorescence signal in real time, thus plotting the amplification curve.

[0040] In qPCR analysis, the Ct value (cycle threshold) is the most important analytical data. Its definition comprises two key parts: first, the threshold, which is an artificially set horizontal line during the exponential growth phase of the fluorescence amplification curve, typically set as 10 times the standard deviation of the background noise of the fluorescence signal intensity; and second, the Ct value, which refers to the number of cycles required for the fluorescence signal intensity in each reaction tube to reach the set threshold during PCR amplification. Simply put, the Ct value can be considered the number of cycles required for a significant peak to be detected in the target gene in the sample. The basic rule is: the smaller the Ct value, the higher the amount of initial template, and the fewer cycles required to detect the signal; conversely, the larger the Ct value, the lower the amount of initial template, and the more amplification cycles are needed to detect the signal. In this invention, the smaller the Ct value obtained from qPCR amplification, the higher the expression level of the target Camellia oleifera disease resistance-related gene, indicating stronger anthracnose resistance.

[0041] Furthermore, the expression levels of eight anthracnose resistance genes in the tested Camellia oleifera samples were compared with those in the anthracnose-sensitive Camellia oleifera control varieties. Higher expression levels indicate stronger anthracnose resistance.

[0042] Furthermore, the Ct values ​​of the anthracnose resistance gene in the tested Camellia oleifera sample were compared with the corresponding gene values ​​in the anthracnose-sensitive Camellia oleifera control variety. The lower the Ct value, the higher the expression level of the tested gene and the stronger the anthracnose resistance of the tested Camellia oleifera variety.

[0043] Furthermore, the more genes with high anthracnose resistance gene expression levels in the tested Camellia oleifera sample, the stronger the anthracnose resistance of the tested Camellia oleifera variety.

[0044] Specifically, the anthrax-susceptible Camellia oleifera control variety, Camellia oleifera, has the following corresponding anthrax resistance genes and CT values:

[0045] Gene mean Ct value ± SD

[0046] maker-HiC_scaffold_13-snap-gene-1046.11 28.075±0.56

[0047] maker-HiC_scaffold_8-snap-gene-364.30 23.331±0.75

[0048] maker-HiC_scaffold_11-snap-gene-4.23 28.979±0.48

[0049] maker-HiC_scaffold_7-snap-gene-1941.27 28.284±0.78

[0050] maker-HiC_scaffold_10-snap-gene-1273.2 32.588±0.38

[0051] augustus_masked-HiC_scaffold_10-processed-gene-1874.40 32.625±0.71

[0052] maker-HiC_scaffold_6-snap-gene-818.12 33.269±0.35

[0053] snap_maske-HiC_scaffold_1-processed-gene-286.57 31.914±0.56.

[0054] Advantages of this invention:

[0055] Conventional analysis of Camellia oleifera disease resistance and screening of resistant germplasm requires fungal inoculation and in vivo assays on Camellia oleifera leaves to analyze anthracnose resistance. This invention enables rapid and efficient identification of anthracnose-resistant Camellia oleifera germplasm, providing a new method for breeding Camellia oleifera disease resistance. Compared with conventional methods, this invention has significant advantages in efficiency for screening anthracnose-resistant Camellia oleifera germplasm, and can be used for high-throughput screening of large-scale anthracnose-resistant Camellia oleifera germplasm, greatly shortening the breeding cycle for disease resistance in Camellia oleifera. Attached Figure Description

[0056] Figure 1 Clustering of 13,349 differentially expressed genes in Camellia oleifera var. ...

[0057] Figure 2 Genes highly associated with sinapeptide in the phenylpropane biosynthesis pathway and salicylic acid in the salicylic acid signal transduction pathway;

[0058] in: Figure 2 A: Classification and number statistics of genes highly associated with sinapoxetine, a lignin precursor in the phenylpropane biosynthesis pathway; different colors represent different gene categories; Figure 2 B: Classification and number statistics of genes highly associated with salicylic acid in the salicylic acid signaling pathway; different colors represent different gene categories.

[0059] Figure 3 Expression heatmap of key genes in the phenylpropane biosynthesis pathway and salicylic acid signal transduction pathway;

[0060] in: Figure 3 A: Heatmap of expression abundance (log2 transformed FPKM value) of key genes in the phenylpropane biosynthesis pathway; Figure 3 B: Heatmap of expression abundance of key genes in the salicylic acid signal transduction pathway (FPKM value after log2 transformation), red and blue represent high expression and low expression, respectively; HS_mock and CR_mock represent the expression abundance of key genes in Huashuo and Cenxi soft branch at 0h after inoculation with Camellia oleifera anthracnose, respectively; HS_18h and CR_18h represent the expression abundance of key genes in Huashuo and Cenxi soft branch at 18h after inoculation with Camellia oleifera anthracnose, respectively; HS_48h and CR_48h represent the expression abundance of key genes in Huashuo and Cenxi soft branch at 48h after inoculation with Camellia oleifera anthracnose, respectively.

[0061] Figure 4 PCR detection of the amplification specificity of specific primers for the core gene related to anthrax resistance in Camellia oleifera.

[0062] Figure 5 Real-time quantitative PCR (qPCR) was used to detect the expression levels of eight molecular marker genes related to anthracnose resistance in the anthracnose-susceptible cultivar Camellia oleifera (HS) and the anthracnose-resistant cultivar Camellia oleifera (CR).

[0063] Figure 6 : In vivo detection of anthracnose resistance in the tested camellia oleifera varieties. Detailed Implementation

[0064] The following examples are intended to further illustrate the present invention, but not to limit it.

[0065] The Camellia oleifera varieties involved in this invention, namely Huashuo (Camellia oleifera, HS) and Cenxi soft branch Camellia oleifera (Camellia oleifera, CR) Huajin, Huaxin, Xianglin 210, and Xianglin No. 1, are all commercially available varieties. Xianglin No. 22 is from the Hunan Academy of Forestry Sciences, while Haikeda No. 1, Haikeda No. 2, and Haikeda No. 3 are from the state-owned Chengmai Forest Farm in Hainan Province.

[0066] The fungal pathogen *Colletotrichum fructicola* was isolated and preserved by the Key Laboratory of Pest and Disease Control in Southern Plantations, State Forestry and Grassland Administration, Central South University of Forestry and Technology (Reference: Li, H., Zhou, GY, Liu, JA, and Xu, J. 2016. Population genetic analyses of the fungalpathogen *Colletotrichum fructicola* on tea-oil trees in China. PLoS One 11:e0156841. https: / / doi.org / 10.1371 / journal.pone.0156841).

[0067] Example 1:

[0068] During long-term cultivation, it was discovered that different Camellia oleifera varieties naturally exhibit differences in resistance to anthracnose. This invention involves artificially inoculating the anthracnose-susceptible cultivar Camellia oleifera (HS) and the resistant cultivar Camellia oleifera (CR) with the dominant anthracnose pathogen *Colletotrichum fructicola*. Transcriptomic and metabolomic analyses were performed at multiple time points (0h, 18h, and 48h post-inoculation). From the 42,462 coding sequences in the Camellia oleifera genome, eight key genes related to anthracnose defense were systematically screened. The screening process mainly included: First, based on transcriptomic data from the resistant cultivar CR and the susceptible cultivar Camellia oleifera at different time points, a total of 13,349 differentially expressed genes (DEGs) were identified. Most of these genes showed higher expression levels in the resistant cultivar CR than in the susceptible cultivar Camellia oleifera (see [link to study]). Figure 1 The phenylpropane biosynthesis pathway and the salicylic acid signaling pathway are considered core pathways in plant disease resistance responses. To screen key genes in these two pathways, Pearson correlation analysis (PCC ≥ 0.7, P < 0.05) was used to correlate differentially expressed genes in the phenylpropane biosynthesis pathway with their key metabolite sinapeptide, and differentially expressed genes in the salicylic acid signaling pathway with their key metabolite salicylic acid. This identified a group of core genes, including structural genes such as PAL, 4CL, COMT, and CAD in the phenylpropane pathway, and key regulatory genes such as NPR1, TGA, and PR1 in the salicylic acid pathway (see...). Figure 2Finally, the transcriptome heatmap showed that eight genes were expressed at higher levels in the resistant variety *Camellia oleifera* than in the susceptible variety *Huashuo*, or were significantly upregulated in the early stages of soft branch treatment, exhibiting a rapid activation expression characteristic, suggesting that they may be closely related to resistance to anthracnose in *Camellia oleifera* (see [link to heatmap]). Figure 3 ). Figure 3 In A, red and blue represent high and low expression, respectively. It can be seen that, compared with HS treatment, the key genes in this pathway show higher overall expression levels under CR conditions, especially in the early stage of CR, where they are significantly upregulated. Figure 3 B: Heatmap of expression abundance (FPKM value after log2 transformation) of key genes in the salicylic acid signal transduction pathway. Red and blue represent high expression and low expression, respectively. It can be seen that, compared with HS treatment, the key genes in this pathway show a higher overall expression level under CR conditions.

[0069] Among them, eight molecular markers (genes) highly expressed in anthracnose-resistant Camellia oleifera were identified for screening and identification (Table 1), and related information is shown in Table 2. The screened genes can be practically applied to the screening of anthracnose-resistant Camellia oleifera germplasm. This invention further designed specific primers for the eight core genes related to anthracnose resistance in Camellia oleifera, including transcription factors related to the phenylpropane and salicylic acid pathways (Table 3). First, the amplification specificity of the above primers was verified using conventional PCR and agarose gel electrophoresis. All reactions yielded a single bright target product band. Figure 4 Using cDNA synthesized from total mRNA reverse transcription of the anthracnose-susceptible cultivar Camellia oleifera (HS) and the resistant cultivar Camellia oleifera (CR) as templates, qPCR amplification was performed using the specific primers for the core anthracnose resistance gene of Camellia oleifera provided in Table 3 to verify the expression of the above eight anthracnose-related molecular markers in plant tissues. Figure 5The qPCR results were consistent with the transcriptomic / metabolomic analysis results; the expression levels of all eight genes in the resistant variety CR were higher than those in the anthracnose-susceptible variety HS. Combining omics sequencing data and qPCR results, this invention proposes the following gene sequences: maker-HiC_scaffold_13-snap-gene-1046.11, maker-HiC_scaffold_8-snap-gene-364.30, maker-HiC_scaffold_11-snap-gene-4.23, maker-HiC_scaffold_7-snap-gene-1941.27, maker-HiC_scaffold_10-snap-gene-1273.2, and augustu. The expression levels of eight Camellia oleifera anthracnose resistance-related genes, including s_masked-HiC_scaffold_10-processed-gene-1874.40, maker-HiC_scaffold_6-snap-gene-818.12, and snap_masked-HiC_scaffold_1-processed-gene-286.57, are shown in Table 4. After detecting the expression levels of target genes in the tested Camellia oleifera samples using qPCR, the resistance of the tested Camellia oleifera samples to anthracnose was determined by simply comparing the expression levels of Camellia oleifera anthracnose resistance-related genes.

[0070]

[0071] Reference genome website: https: / / zenodo.org / records / 5768785#.YwRqgnZBwdU

[0072] This linked website contains genomic resources for Camellia oleifera var. "Nanyongensis", including genome assembly, genome annotation, and other relevant information. It also includes the original scripts for comparative genome analysis.

[0073]

[0074]

[0075]

[0076] The results in Table 4 above include three biological replicates (three individuals of each variety planted independently) and three technical replicates (three qPCR tests on each cDNA sample). The data are presented in the form of "mean ± standard deviation" to ensure statistical reliability and reproducibility.

[0077] The gene sequences of the eight molecular markers provided by this invention for screening and identification of resistant Camellia oleifera are as follows:

[0078] The gene ID is maker-HiC_scaffold_13-snap-gene-1046.11, and the specific sequence is as follows:

[0079]

[0080] The gene ID is maker-HiC_scaffold_8-snap-gene-364.30, and the specific sequence is as follows:

[0081]

[0082] The gene ID is maker-HiC_scaffold_11-snap-gene-4.23, and the specific sequence is as follows:

[0083]

[0084] The gene ID is maker-HiC_scaffold_7-snap-gene-1941.27, and the specific sequence is as follows:

[0085]

[0086] The gene ID is maker-HiC_scaffold_10-snap-gene-1273.2, and the specific sequence is as follows:

[0087]

[0088] The gene ID is augustus_masked-HiC_scaffold_10-processed-gene-1874.40, and the specific sequence is as follows:

[0089]

[0090] The gene ID is maker-HiC_scaffold_6-snap-gene-818.12, and the specific sequence is as follows:

[0091]

[0092] The gene ID is snap_masked-HiC_scaffold_1-processed-gene-286.57, and the specific sequence is as follows:

[0093] ATGGTGCTGTGTAAGCTTTCATTAGCTTTTGTATGTCTCTTGAGCTTAGCCTTGGTTCATCCTTCCTATGCCCAAAACTCACCACAAGACTACCTCAATGCCCACAACACAGCTCGTGCCCAAGTGGGTGTTGGACCTATGACATGGGACAACAACATTGCCACTTATGCACAAAGGTATGCTAATTTGAGGAAGGGTGATTGCAATCTCATCCACTCCGATGGGCCTTATGGGGAGAACCTTGC TAAGGGTAGCGGTTCATTTACAGGTACTGACGGAGTGAACCTTTGGATAGGAGAGAAGCCTTACTATAAGTACAACTCCAACTCATGTGTTAGGGGAAAAGATTGCTTGCATTATACCCAGGTGATATGGAGAAACTCGACCCGTCTTGGATGCGCTAGGGTTCGGTGTACCAATAATGGTTGGTGGTTTGTGATCTGCAGTTATGATCCCCGAGGCAACTACATTGGACAACGTCCTTATTAG.

[0094] Example 2:

[0095] Rapid identification or screening of anthracnose-resistant Camellia oleifera germplasm, and its application in the breeding of anthracnose-resistant Camellia oleifera varieties. Specific application steps are as follows:

[0096] (1) Extract total RNA from Camellia oleifera and reverse transcribe it to synthesize cDNA as a reaction template;

[0097] (2) Use the 8 molecular marker genes for screening and identification of resistant Camellia oleifera provided in Table 3 to design specific qPCR primers, and use the cDNA synthesized by reverse transcription of total mRNA from the Camellia oleifera sample to be tested as a template for qPCR amplification;

[0098] (3) Compare the expression levels of eight anthrax resistance-related genes in the camellia oil samples to the expression levels of the corresponding genes in Table 4. The higher the expression level, the stronger the potential anthrax resistance.

[0099] qPCR reaction system: The total volume is 20 μL, and the specific components are as follows: This reaction system consists of 1 μL of cDNA obtained by reverse transcription of 1 ng / μL total RNA, 10 μL of SYBR Green qPCR MasterMix, and 1 μL each of 10 μmol forward and reverse primers. The PCR reaction system is brought up to 20 μL with sterile double-distilled water.

[0100] The qPCR amplification program was as follows: pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 5 seconds, annealing at 60℃ for 30 seconds, for 40 cycles; melting curves were performed according to the default settings of the real-time quantitative PCR instrument. The CT values ​​of anthrax resistance-related genes in the tested Camellia oleifera samples were read and compared with the corresponding gene amplification CT values ​​listed in Table 4. A lower CT value indicates a higher expression level of the tested gene and stronger anthrax resistance, thus determining the resistance of the tested Camellia oleifera samples to anthrax.

[0101] (4) Results of the test sample:

[0102] This test collected eight common Camellia oleifera cultivars from Hunan and Hainan, including Huajin (Hunan), Huaxin (Hunan), Xianglin 210 (Hunan), Xianglin No. 1 (Hunan), Xianglin No. 22 (Hunan), Haikeda No. 1 (Hainan), Haikeda No. 2 (Hainan), and Haikeda No. 3 (Hainan).

[0103] Total RNA was extracted from plant leaves using the Trizol method. 100 mg of leaf tissue was taken from each *Camellia oleifera* plant sample, cryogenically ground into powder, and 1 mL of Trizol was added and homogenized thoroughly. The mixture was allowed to stand at room temperature for 5 minutes. 200 μL of chloroform was added to the lysis buffer, followed by vigorous shaking for 15 seconds. The mixture was then centrifuged at 12000 rpm for 15 minutes at 4°C, and the supernatant was collected. 500 μL of isopropanol was added to the collected supernatant, and the mixture was gently mixed. The mixture was allowed to stand at room temperature for 10 minutes, and then centrifuged at 12000 rpm for 10 minutes at 4°C to collect the RNA precipitate. The RNA precipitate was washed three times with 1 mL of 75% ethanol, dried, and dissolved in an appropriate amount of DEPC water. The concentration and purity of the extracted RNA were determined using a spectrophotometer.

[0104] Then, the qPCR reaction and Ct value reading were performed using the methods described above.

[0105] According to the Ct values ​​of the corresponding genes listed in Table 4, the higher the Ct value of the corresponding gene in the tested Camellia oleifera sample, the lower the gene expression level, and the lower the resistance of the tested Camellia oleifera to anthracnose. According to the qPCR results (Table 5), compared with anthracnose-sensitive Camellia oleifera (Huashuo, HS), the Ct values ​​of each gene in Huajin, Huaxin, Xianglin 210, Xianglin 1, and Xianglin 22 were similar to or higher than those in Huashuo, indicating lower gene expression levels and greater sensitivity to anthracnose, making them susceptible varieties. The Ct values ​​of most target genes in Haikeda 1, 2, and 3 were significantly lower than those in Huashuo (P<0.05), indicating higher gene expression levels and relatively stronger resistance to anthracnose. Compared with the resistance control (Cenxi Soft Branch, CR), Haikeda No. 3, a variety in the Haikeda series, showed strong resistance with similar Ct values ​​in qPCR amplification of multiple genes, such as maker-HiC_scaffold_11-snap-gene-4.23, maker-HiC_scaffold_7-snap-gene-1941.27, and snap_maske-HiC_scaffold_1-processed-gene-286.57, as Cenxi Soft Branch. Haikeda No. 1 and No. 2 showed slightly lower gene expression levels than Cenxi Soft Branch, but were still significantly better than the sensitive varieties.

[0106] To verify the qPCR test results, leaves of *Camellia oleifera* var. *huajin*, *Huaxin*, *Xianglin 210*, *Xianglin 1*, *Xianglin 22*, *Haikeda 1*, *Haikeda 2*, and *Haikeda 3* were artificially inoculated with conidia of *Camellia oleifera* var. *huajin*, and the incidence of anthracnose was observed. Figure 6 As shown, 48 hours after inoculation with the pathogen, visible necrotic lesions appeared on the leaf surfaces of Huajin, Huaxin, Xianglin 210, Xianglin 1, and Xianglin 22, while no obvious leaf tissue necrosis was observed at the inoculation sites of Haikeda 1, 2, and 3. The results of inoculation of isolated Camellia oleifera leaves with *Anthracnose spores* were statistically analyzed (Table 6), and were consistent with the Ct values ​​determined by qPCR, demonstrating the feasibility of applying the proposed molecular markers related to anthracnose resistance in Camellia oleifera in the screening of anthracnose-resistant germplasm.

[0107] This application example successfully utilized the eight anthracnose resistance genes and qPCR detection method provided by this invention to rapidly screen the disease resistance of eight Camellia oleifera varieties, including Huajin, Huaxin, Xianglin 210, Xianglin 1, Xianglin 22, Haikeda 1, Haikeda 2, and Haikeda 3. The results showed that the Haikeda series varieties exhibited strong anthracnose resistance, while the Xianglin series and Huajin and Huaxin varieties were susceptible. This screening method is simple to operate, has a short cycle time, and provides reliable results, making it suitable for high-throughput screening of anthracnose-resistant Camellia oleifera germplasm on a large scale.

[0108]

[0109]

[0110]

[0111]

[0112] "+++" indicates obvious necrotic lesions, "++" indicates mild lesions, and "-" indicates no lesions are seen.

Claims

1. A kit for screening and identifying anti-oak anthracnose germplasm, characterized in that, The kit includes reagents for detecting anthrax resistance genes in camellia oleifera; the anthrax resistance gene in camellia oleifera is: maker-HiC_scaffold_13-snap-gene-1046.11、 maker-HiC_scaffold_8-snap-gene-364.30、 maker-HiC_scaffold_11-snap-gene-4.23、 maker-HiC_scaffold_7-snap-gene-1941.27、 maker-HiC_scaffold_10-snap-gene-1273.2、 maker-HiC_scaffold_6-snap-gene-818.12、 augustus_masked-HiC_scaffold_10-processed-gene-1874.40, snap_masked-HiC_scaffold_1-processed-gene-286.57, The sequences are shown in SEQ ID NO.1-8.

2. The kit of claim 1, wherein The reagents used to detect anthrax resistance genes in camellia oleifera include PCR detection reagents.

3. The kit of claim 2, wherein The primer names and sequences used in the PCR detection reagent are as follows: Primer name Primer sequence 1046.11-F1 ACACGTCTAGCTGTTGCCTC 1046.11-R1 CTTGGTTATGTTGCTCGGCG 364.30-F1 AGCACGAAGAGCATGGACAA 364.30-R1 TGCCGGAGCTTTTTCTGGAT 4.23-F1 CCTGTCTCATCATCGGCTCC 4.23-R1 AGTGTAGAATGGGTTGGCGG 1941.27-F1 CCTACACCTACGCCGATGTC 1941.27-R1 AGTGTAGAACGGGTTGGCTG 1273.2-F1 CTCGGTGCTGACTCGTTCTT 1273.2-R1 TCCCGTAAGCAACGGGAAAA 1874.40-F1 ATGAGTACGTGCGCATAGGG 1874.40-R1 TCGAGCCACTCCAACAACTC 818.12-F1TCGGCAAGCTCACCAATCTT 818.12-R1 AATCCGTGCTTGTTTGGCAC 286.57-F1 CAATGCCCACAACACAGCTC 286.57-R1CCCTTAGCAAGGTTCTCCCC.

4. Use of the kit for screening and identifying Camellia oleifera germplasm resistant to anthracnose according to any one of claims 1-3, characterized in that, Used for screening and identification of Camellia oleifera germplasm resistant to anthrax.

5. Use according to claim 4, characterized in that, Specifically, the steps include the following: (1) Extract total RNA from Camellia oleifera and reverse transcribe it to synthesize cDNA as a reaction template; (2) Use primers to amplify the cDNA of the camellia oil sample to be tested by qPCR; (3) The higher the expression level, the stronger its anthrax resistance.

6. Use according to claim 5, characterized in that, The expression levels of eight anthracnose resistance genes in the tested Camellia oleifera samples were compared with those in the anthracnose-sensitive control varieties. Higher expression levels indicate stronger anthracnose resistance.

7. Use according to claim 6, characterized in that, The CT value of the anthracnose resistance gene in the tested Camellia oleifera sample was compared with the CT value of the corresponding gene in the anthracnose-sensitive Camellia oleifera control variety. The lower the CT value, the higher the expression level of the tested gene and the stronger the anthracnose resistance of the tested Camellia oleifera variety.

8. Use according to claim 6, characterized in that, The more genes with high anthracnose resistance gene expression levels in the tested Camellia oleifera sample, the stronger the resistance of the tested Camellia oleifera variety to anthracnose.

9. Use according to claim 7, characterized in that, The anthrax-susceptible Camellia oleifera control variety, Camellia oleifera, has the following corresponding anthrax resistance genes and CT values: Gene mean Ct value ± SD maker-HiC_scaffold_13-snap-gene-1046.11 28.075±0.56 maker-HiC_scaffold_8-snap-gene-364.30 23.331±0.75 maker-HiC_scaffold_11-snap-gene-4.23 28.979±0.48 maker-HiC_scaffold_7-snap-gene-1941.27 28.284±0.78 maker-HiC_scaffold_10-snap-gene-1273.2 32.588±0.38 augustus_masked-HiC_scaffold_10-processed-gene-1874.40 32.625±0.71 maker-HiC_scaffold_6-snap-gene-818.12 33.269±0.35 snap_maske-HiC_scaffold_1-processed-gene-286.57 31.914±0.56.

Images