A molecular marker primer set, kit, and application for identifying macadamia nut variety Nanya 116
By using molecular marker primer amplification and sequencing analysis, the problem of inaccurate identification of the macadamia nut variety Nanya 116 was solved, achieving efficient and accurate variety differentiation. Reproducibility experiments verified its accuracy and reliability.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF TROPICAL & SUBTROPICAL CASH CROP YUNNAN ACAD OF AGRI SCI
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-30
AI Technical Summary
The current technology for identifying the macadamia nut variety Nanya 116 is inaccurate and easily affected by environmental and human factors, making it difficult to achieve rapid and efficient accurate differentiation.
A molecular marker primer set is provided, including two pairs of specific primers, for amplifying the DNA of the sample to be tested. The sequencing results are analyzed by second-generation high-throughput sequencing and alignment to a reference genome to identify the macadamia nut variety Nanya 116. Accurate identification is achieved by utilizing the polymorphic differences of the primer set.
It has achieved efficient and accurate identification of the macadamia nut variety Nanya 116, and can distinguish Nanya 116 from 52 other varieties. The results are not affected by environmental and human factors, have high reproducibility, and have an identification accuracy rate of 100%.
Smart Images

Figure CN122303471A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer set, kit, and application for identifying the macadamia nut variety Nanya 116. Background Technology
[0005] Plant variety identification can be based on morphological characteristics, physiological and ecological characteristics, biochemical markers, and molecular markers. Morphological identification is intuitive and simple, but it is easily affected by environmental and human factors, has a long cycle, and exhibits a certain degree of seasonality. Molecular marker identification has significant advantages, is not affected by season or developmental stage, has rich polymorphism and high specificity, is rapid, efficient, and highly accurate, and has been applied to DUS testing of various plants and identification of substantial derivative varieties. Public content
[0007] To address the issue of inaccurate identification of the macadamia nut variety Nanya 116, this disclosure provides a molecular marker primer set, kit, and application for identifying Nanya 116. The technical solution is as follows: On one hand, this disclosure provides a molecular marker primer set for identifying macadamia nut variety Nanya 116. The molecular marker primer set consists of two pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing.
[0008] On the other hand, this disclosure provides a kit for identifying the macadamia nut variety South Asia 116, the kit comprising the aforementioned molecular marker primer set.
[0009] On another aspect, this disclosure provides an application of a molecular marker primer set for identifying the macadamia nut variety Nanya 116, the application including: amplifying the sample to be tested using the molecular marker primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types as shown in SEQ ID NO: 5 to SEQ ID NO: 28 in the sequence listing; When the obtained sequence type is as shown in SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 22 and SEQ ID NO: 25 in the sequence list, the sample to be tested is identified as the macadamia nut variety Nanya 116.
[0010] The application also includes: the molecular marker primer set distinguishing between South Asia 116 and 52 other macadamia nut varieties.
[0011] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides a molecular marker primer set, kit, and application for identifying the macadamia nut variety Nanya 116. The molecular marker primer set is used to amplify the test sample, and the obtained amplification products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Nanya 116. Simultaneously, these differences can be used to effectively distinguish Nanya 116 from 52 other macadamia nut varieties. Attached Figure Description
[0012] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0013] Figure 1 This is a sequence alignment diagram of the first pair of primers provided in Embodiment 3 of this disclosure.
[0014] Figure 2 This is a sequence alignment diagram of the second pair of primers provided in Embodiment 3 of this disclosure. Detailed Implementation
[0015] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below. Example 1
[0016] This embodiment provides a molecular marker primer set for identifying the macadamia nut variety Nanya 116. The primer set consists of two pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, specifically: CAATGCAACAAGGGTGAAAATGTG. The downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing, specifically: TAGGTCTTTGTCACTTACCATAGCC. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, specifically: TGAATCGCTATATGAGACAATGGGT. The downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing, specifically: ATTCTGCGAGGAGAAAGAATTCCAA. Relevant information for the two primer pairs is shown in Table 1.
[0017] Table 1 shows the relevant information for the two pairs of primers. Example 2
[0018] This disclosure provides a kit for identifying the macadamia nut variety Nanya 116, which includes the molecular marker primer set provided in Example 1. Example 3
[0019] This disclosure provides an application of a molecular marker primer set for identifying the macadamia nut variety Nanya 116. The application includes using the molecular marker primer set provided in Example 1 to identify the macadamia nut variety Nanya 116.
[0020] Furthermore, the application also includes: using the molecular marker primer set provided in Example 1 to effectively distinguish between South Asia 116 and 52 other macadamia nut varieties.
[0021] Specifically, 53 macadamia nut varieties were used as test samples, and the variety names are shown in Table 2. All 53 test samples were obtained from the Jinghong Macadamia Nursery of the Ministry of Agriculture and Rural Affairs. This nursery has complete germplasm preservation conditions and standardized management measures, and all macadamia nut varieties involved in this embodiment were planted and preserved there.
[0022] Table 2 lists the variety names of the 53 samples to be tested.
[0023] DNA was extracted from the 53 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were performed according to the instructions for this novel plant genomic DNA extraction kit.
[0024] DNA from 53 test samples was amplified using the molecular marker primer set provided in Example 1 of this invention. Specifically, the amplification system included: 50 ng of DNA from the test sample, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min.
[0025] After amplification, the amplification products are obtained. The amplification products are then subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data are then aligned to the macadamia nut reference genome (version number GWHBAUK00000000.1) using Bowtie2 software to obtain the sequencing results for each sample to be tested.
[0026] Based on the upstream and downstream primer sequences of the molecular marker primer set, e-PCR was performed using TBtools software to verify that both primer pairs were for specific amplification.
[0027] Based on the upstream and downstream primer sequences of the molecular marker primer set and the relevant information in Table 1, the target sequences of the two primer pairs on the reference genome were extracted using the software TBtools, and are represented by the numbers 01 and 02, respectively.
[0028] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained 13 different sequence types, as shown in Table 3. These 13 different sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, i1, j1, k1, l1, and m1, as shown in SEQ ID NO:5 to SEQ ID NO:17 in the sequence listing.
[0029] Table 3 lists the 13 sequences detected by the first pair of primers.
[0030] The number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: CAATGCAACAAGGGTGAAAATGTGCCAATGTGGGGACTGCTGCAGCCACTATCCACTAGAGCATGTTTGGACGGAAATTTCCATGGATGGCTTGCTGAATTCATATGGGAAGACAGTGATACTTGTGGTAGTTGATAGCCTCTGTAAAGAAGCCCATTCTATACCTCTTTCACAACCTTACAGAGCTATATCTGTTACTCAGGGCTTCCTTGATGAAGTTCCAAGCTTCATGGCATGCCAAAGGCTATGGTAAGTGACAAAGACCTA (as shown in SEQ ID NO:29 in the sequence listing). Sequence alignment using DNAMAN software shows that all 13 sequences are different from the target sequence 01 on the reference genome.
[0031] Due to the large number of sequence types and the large size of the sequence alignment diagram, it is not clear when compressed and placed on one page. It was observed that the 30 bases at the 5' end and the 30 bases at the 3' end of each sequence in the diagram are the same.
[0032] Variety identification involves comparing the differences between different varieties. To ensure that the sequence alignment diagrams can be clearly presented on one page, data processing is performed. First, 30 identical base sequences at the 5' end of the 13 sequences and the 03 sequence are removed, specifically: CAATGCAACAAGGGTGAAAATGTGCCAATG (as shown in SEQ ID NO:30 in the sequence listing). Then, 30 identical base sequences at the 3' end are removed, specifically: CCAAAGGCTATGGTAAGTGACAAAGACCTA (as shown in SEQ ID NO:31 in the sequence listing). These two sequences belong to the homogeneous portion of all tested samples, and the processing does not affect the variety identification results.
[0033] The sequence alignment results after removing the two ends are as follows: Figure 1 As shown, the 13 processed sequences are all different from the processed target sequence 01.
[0034] The processed sequence e1 is the same as the processed sequence 01, while the other sequences are different.
[0035] The second primer pair contains 11 different sequence types, as shown in Table 4. These 11 different sequence types are named a2, b2, c2, d2, e2, f2, g2, h2, i2, j2, and k2, as shown in SEQ ID NO:18 to SEQ ID NO:28 in the sequence listing.
[0036] Table 4 lists the 11 sequences detected by the second pair of primers.
[0037] The number 02 represents the target sequence of the second primer pair on the reference genome, specifically: TGAATCGCTATATGAGACAATGGGTAGCCTTGGCTTATTAAGCAAATACATAGCTTCTCGTCTCTCTGACGTTGCCAAACTCTGTGAAGAAGCTCCTGTAGCTCTAAAGCGTGCCCCCAACCCAGCCAAGCTCGTCTTGGACTGCATTGGCCAGTTTTATCTCCAAGGTAGCAAGGCGTACACCAAGGATTCTCCAATGGTTCCCGCCCGGGAAGCCTTGGTGCTCATGTTGGAATTCTTTCTCCTCGCAGAAT (as shown in SEQ ID NO:32 in the sequence listing). When sequence alignment was performed using DNAMAN software, sequence e2 was identical to the target sequence 02 on the reference genome, while the other 10 sequences were different from the target sequence 02.
[0038] The genotypes of the two primer pairs for the 53 samples to be tested are shown in Table 5.
[0039] Table 5 shows the genotypes of the 53 samples to be tested.
[0040] In Table 5, / indicates that no product was amplified. As shown in Table 5, the genotype combination of the sample to be tested, South Asia 116, is g1k1+e2h2, as shown in the sequence listings SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 22 and SEQ ID NO: 25, which enables accurate identification of South Asia 116.
[0041] The genotype combinations of the above 53 test samples were checked using the Excel spreadsheet's conditional formatting - highlight cell rules - duplicate values - red text check and no duplicates were found. This indicates that the molecular marker primer set provided in Embodiment 1 of the present invention can distinguish between South Asia 116 and the 52 test samples, demonstrating that the molecular marker primer set has high specificity.
[0042] Accuracy analysis of molecular marker primer set identification Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of macadamia nuts. The high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.
[0043] A reproducibility experiment was conducted using 53 samples to be tested. The results of each experiment were analyzed, and the genotypes and combinations were recorded. See Table 6 for details.
[0044] Table 6 shows the results of the two repeated experiments.
[0045] As shown in Table 6, the specific genotypes and combinations were identical in both replicate experiments. Therefore, the accuracy of the molecular marker primer set provided by this invention is 100%.
[0046] The third embodiment of the present invention shows that the variety identification conclusions between different laboratories or different batches of the same laboratory have a high degree of consistency, thus eliminating the need to use parallel experiments to reduce experimental errors, which greatly facilitates the identification of macadamia varieties.
[0047] This invention provides a molecular marker primer set, kit, and application for identifying the macadamia nut variety Nanya 116. The molecular marker primer set is used to amplify the test sample, and the amplified products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Nanya 116. Furthermore, these differences can effectively distinguish Nanya 116 from 52 other macadamia nut varieties, and the identification results are unaffected by environmental or other human factors.
[0048] This invention uses a set of highly polymorphic molecular marker primers to amplify the target sequence and compares the base differences between different varieties, thereby achieving efficient identification of macadamia nut varieties. Reproducibility experiments further verify the accuracy and reliability of this technology.
[0049] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. A molecular marker primer set for identifying the macadamia nut variety Nanya 116, characterized in that, The molecular marker primer set consists of two pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 in the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 in the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 in the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 in the sequence listing.
2. A kit for identifying the macadamia nut variety South Asia 116, characterized in that, The kit includes the molecular marker primer set as described in claim 1.
3. The application of a molecular marker primer set for identifying the macadamia nut variety Nanya 116, characterized in that, The application includes: amplifying a sample to be tested using the molecular marker primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types; When the obtained sequence type is as shown in SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 22 and SEQ ID NO: 25 in the sequence list, the sample to be tested is identified as the macadamia nut variety Nanya 116.