A primer set, kit, and application for identifying the macadamia nut variety Nanya 2.
By providing primer sets and reagent kits, combined with next-generation high-throughput sequencing technology, the problem of inaccurate identification of the macadamia nut variety Nanya 2 was solved, achieving efficient and accurate variety differentiation and improving the management and development of the macadamia nut industry.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF TROPICAL & SUBTROPICAL CASH CROP YUNNAN ACAD OF AGRI SCI
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-30
AI Technical Summary
The current technology for identifying the macadamia nut variety Nanya 2 is inaccurate, which restricts the development of the industry and leads to the existence of "different species with the same name" and "different names for the same species", which affects the healthy development of the industry.
This invention provides a primer set and a kit that amplifies the DNA of the sample to be tested, and uses next-generation high-throughput sequencing and software alignment technology to accurately identify the macadamia nut variety Nanya 2. The primer set is used to distinguish Nanya 2 from 54 other varieties.
It has achieved efficient and accurate identification of Nanya No. 2, effectively distinguishing different varieties, improving the accuracy and consistency of identification results, and reducing the impact of environmental and human factors.
Smart Images

Figure CN122303472A_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to the fields of molecular biology and genetic breeding, and particularly to a primer set, a kit and an application for identifying the Macadamia integrifolia variety Nanya 2 Background Art
[0002] Macadamia integrifolia is native to Australia and is also known as the macadamia nut. It is a globally recognized high-end edible dry fruit and woody oilseed, enjoying the reputation of the "king of nuts". Its kernels are rich in nutrition, with a high fat content mainly composed of unsaturated fatty acids, which is very beneficial to cardiovascular and cerebrovascular health. At present, the global market demand for Macadamia integrifolia is strong, but the annual output is far lower than the demand, with a huge supply-demand gap, and the industrial development prospect is broad.
[0003] In recent years, China has become the main production area and an important consumer market for Macadamia integrifolia globally. However, the main cultivated varieties mostly rely on foreign introductions, and some varieties have poor climate adaptability, resulting in a unit area yield that is only 1 / 3 to 1 / 2 of that in the origin country, severely restricting the industrial benefits. At the same time, changes in the international trade environment and the strengthening of variety right protection by the origin country have increasingly restricted China's introduction of foreign varieties. Therefore, there is an urgent need to cultivate new varieties with independent intellectual property rights and adapted to the local environment.
[0004] 'Nanya 2' is a publicly released approved variety, with the approval number: Qian S-ETS-MI-004-2023, which can be seen in the announcement of the Forestry Bureau of Guizhou Province on December 26, 2023. Accurately identifying this variety is crucial for its promotion and application.
[0005] Plant variety identification can be based on methods such as morphological characteristics, physiological and ecological characteristics, biochemical markers, and molecular markers. Morphological identification is intuitive and simple, but it is easily affected by environmental and human factors, with a long cycle and seasonality; molecular marker technology has significant advantages: it is not affected by seasons and developmental stages, has rich polymorphism, strong specificity, is fast, efficient, and highly accurate, and has been widely used in plant DUS testing and the identification of essentially derived varieties.
[0006] Currently, there are common phenomena of "different plants with the same name" and "the same plant with different names" in the Macadamia integrifolia industry, which not only hinder variety breeding, intellectual property protection, and industrial promotion, but also damage the economic interests of practitioners due to impure or incorrect seedling varieties, seriously affecting the healthy development of the industry. Therefore, establishing a standardized identification system centered on molecular markers for accurate identification and traceability management of the 'Nanya 2' independent variety is a key measure to break through the industrial bottleneck, ensure seed industry safety, and promote the high-quality development of the Macadamia integrifolia industry. Disclosure Content
[0007] To address the issue of inaccurate identification of the macadamia nut variety Nanya 2, this disclosure provides a primer set, reagent kit, and application for identifying Nanya 2. The technical solution is as follows: On one hand, this disclosure provides a primer set for identifying the macadamia nut *Nanya 2*. The primer set consists of three pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing. The upstream primer of the third pair is shown in SEQ ID NO:5 of the sequence listing, and the downstream primer of the third pair is shown in SEQ ID NO:6 of the sequence listing.
[0008] On the other hand, this disclosure provides a kit for identifying the macadamia nut variety South Asia 2, the kit comprising the aforementioned primer set.
[0009] In another aspect, this disclosure provides an application of a primer set for identifying the macadamia nut variety Nanya 2, the application comprising: amplifying the sample to be tested using the primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types as shown in SEQ ID NO: 7 to SEQ ID NO: 41 in the sequence listing; When the obtained sequence type is as shown in SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 37 and SEQ ID NO: 40 in the sequence list, the sample to be tested is identified as the macadamia nut variety Nanya 2.
[0010] The application also includes: the primer set distinguishing between South Asia 2 and 54 other macadamia nut varieties.
[0011] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides a primer set, kit, and application for identifying the macadamia nut variety Nanya 2. The primer set is used to amplify the sample, and the amplified products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Nanya 2. Furthermore, these differences can be used to effectively distinguish Nanya 2 from 54 other macadamia nut varieties. Attached Figure Description
[0012] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0013] Figure 1 This is a sequence alignment diagram of the first pair of primers provided in Embodiment 3 of this disclosure.
[0014] Figure 2 This is a sequence alignment diagram of the second pair of primers provided in Embodiment 3 of this disclosure.
[0015] Figure 3 This is a sequence alignment diagram of the third pair of primers provided in Embodiment 3 of this disclosure. Detailed Implementation
[0016] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below. Example 1
[0017] This embodiment provides a primer set for identifying the macadamia nut variety Nanya 2. The primer set consists of three pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, specifically: CCTTTATTGGGGAGGTTTCTATGT; the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing, specifically: ACTACTTTAATGGGGAGAAATGCAC; the upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, specifically: TTTGTTCAGCCATTAGTTTAGGCTG; the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing, specifically: TCTGATACCAAATAATGCAGGGCTA; the upstream primer of the third pair is shown in SEQ ID NO:5 of the sequence listing, specifically: TGAAGGAGTCTTGAGCTTACTCTTC; and the downstream primer of the third pair is shown in SEQ ID NO:6 of the sequence listing, specifically: TACAAGGATGCGGGATTCTTACA. The relevant information for the three primer pairs is shown in Table 1.
[0018] Table 1 shows the relevant information for the three pairs of primers. Example 2
[0019] This disclosure provides a kit for identifying the macadamia nut variety South Asia 2, which includes the primer set provided in Example 1. Example 3
[0020] This disclosure provides an application of a primer set for identifying the macadamia nut variety Nanya 2, the application of which includes: using the primer set provided in Example 1 to identify the macadamia nut variety Nanya 2.
[0021] Furthermore, the application also includes: effectively distinguishing South Asia 2 and 54 other macadamia nut varieties using the primer set provided in Example 1.
[0022] Specifically, 55 macadamia nut varieties were used as test samples, and the variety names are shown in Table 2. All 55 test samples were obtained from the Jinghong Macadamia Nursery of the Ministry of Agriculture and Rural Affairs. This nursery has complete germplasm preservation conditions and standardized management measures, and all macadamia nut varieties involved in this embodiment were planted and preserved there.
[0023] Table 2 lists the variety names of the 55 samples to be tested.
[0024] DNA was extracted from the 55 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were performed according to the instructions for this novel plant genomic DNA extraction kit.
[0025] DNA from 55 test samples was amplified using the primer set provided in Example 1 of this invention. Specifically, the amplification system included: 50 ng of DNA from the test sample, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min.
[0026] After amplification, the amplification products are obtained. The amplification products are then subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data are then aligned to the macadamia nut reference genome (version number GWHBAUK00000000.1) using Bowtie2 software to obtain the sequencing results for each sample to be tested.
[0027] Based on the upstream and downstream primer sequences of the primer set, e-PCR was performed using TBtools software to verify that all three primer pairs were for specific amplification.
[0028] Based on the upstream and downstream primer sequences and relevant information in Table 1, the target sequences of the three primer pairs on the reference genome were extracted using the software TBtools, and were represented by the numbers 01, 02 and 03, respectively.
[0029] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained 12 different sequence types, as shown in Table 3. These 12 different sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, i1, j1, k1, and l1, as shown in SEQ ID NO:7 to SEQ ID NO:18 in the sequence listing.
[0030] Table 3 lists the 12 sequences detected by the first pair of primers.
[0031] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 1 As shown, in Figure 1In the sequence, the number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: CCTCTTATTGGGGAGGTTTCTATGTTGAATTGATGATGTTGTTGTGTGTGTGTCTCTGATGGATTTGTTCACCGATTTATGCATTTAGTTGCTTTCTTAGGAGTTTGATTATTACACGCATTGTGTTTGATAAATTGTTCCATCAAACTCTACTTGATTGCTTCCTCTTAGGTTCACCCAAGAGGGGAAGAGTTTGTTCCGTGTTTTTGTTAACGGAGTACATCTCTCGGTTAGTGCATTTCTCCCCATTAAAGTAGT (as shown in SEQ ID NO:42 in the sequence listing). All 12 sequences are different from the target sequence 01 on the reference genome.
[0032] The second primer pair contains 12 different sequence types, as shown in Table 4. These 12 different sequence types are named a2, b2, c2, d2, e2, f2, g2, h2, i2, j2, k2, and l2, as shown in SEQ ID NO:19 to SEQ ID NO:30 in the sequence listing.
[0033] Table 4 lists the 12 sequences detected by the second pair of primers.
[0034] The number 02 indicates the target sequence of the second primer pair on the reference genome, specifically: TTTGTTCAGCCATTAGTTTAGGCTGATTTTTTCAGAAGTTAATCCCCTCAACAGGGTCTACCTTCATCGCTTCAACACGAAGACTGGTCCATCAGAATGGTCAGTTGCTAAATCTGGAACATTTTCTAATTCTGAGACTTAGTTCTCTTTAGTGCTGCTGGAACTAATGTATGCTGTGACCTGCTGTTAGACAGTATATTGATCCTTCTGTAGAATAAGAATTCATTGAGCTAGCCCTGCATTATTTGGTATCAGA (as shown in SEQ ID NO:43 in the sequence listing). All 12 sequences are different from the target sequence 02 on the reference genome.
[0035] The third primer pair contains 11 different sequence types, as shown in Table 5. These 11 different sequence types are named a3, b3, c3, d3, e3, f3, g3, h3, i3, j3, and k3, as shown in SEQ ID NO:31 to SEQ ID NO:41 in the sequence listing.
[0036] Table 5 shows the 11 sequences detected by the third pair of primers.
[0037] The number 03 represents the target sequence of the third primer pair on the reference genome, specifically: TGAAGGAGTCTTGAGCTTACTCTTCCAATAAATGGAATTCTCCTCAGCTGTCTTGGCATAAGCCGCTGCCACATCAATAGACCTGAAATTAGTGTTAGCCAACTCAAGTCGAATCTCAGTACTTAGCCCACTGATATAACGCATCACCCATTGCTGGTCTGTTTCTTGAAGTCGACACCTTGAAGACAGCTTGTGGATCTCAAGGGTGTAAGAATCCCGCATCCTTGTTA (as shown in SEQ ID NO:44 in the sequence listing). Sequence g1 is identical to the target sequence 03 on the reference genome, while the remaining sequences are different from 03.
[0038] The genotypes of the three primer pairs for the 55 samples to be tested are shown in Table 6.
[0039] Table 6 shows the genotypes of the 55 samples to be tested.
[0040] As shown in Table 6, the genotype combination of the sample to be tested, Nanya 2, is i1l1+k2l2+g3j3, as shown in the sequence listings SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 37 and SEQ ID NO: 40, which enables accurate identification of Nanya 2.
[0041] The genotype combinations of the above 55 test samples were checked using the Excel spreadsheet's conditional formatting - highlight cell rules - duplicate values - red text check and no duplicates were found. This indicates that the primer set provided in Embodiment 1 of the present invention can distinguish between South Asia 2 and the 54 test samples, demonstrating that the primer set has high specificity.
[0042] Accuracy analysis of primer set identification Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of macadamia nuts. The high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.
[0043] A reproducibility experiment was conducted using 55 test samples. The results of each experiment were analyzed, and the genotypes and combinations were recorded. See Table 7 for details.
[0044] Table 7 shows the results of the two repeated experiments.
[0045] As shown in Table 7, the specific genotypes and combinations were identical in both replicate experiments. Therefore, the primer set provided by this invention has a 100% accuracy rate for identification.
[0046] The third embodiment of the present invention shows that the variety identification conclusions between different laboratories or different batches of the same laboratory have a high degree of consistency, thus eliminating the need to use parallel experiments to reduce experimental errors, which greatly facilitates the identification of macadamia varieties.
[0047] This invention provides a primer set, kit, and application for identifying the macadamia nut variety Nanya 2. The primer set is used to amplify the sample, and the amplified products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the macadamia nut variety Nanya 2. Furthermore, these differences can effectively distinguish Nanya 2 from 54 other macadamia nut varieties, and the identification results are unaffected by environmental or other human factors.
[0048] This invention amplifies the target sequence using a highly polymorphic primer set and compares the base differences between different varieties, thereby achieving efficient identification of macadamia nut varieties. Reproducibility experiments further verify the accuracy and reliability of this technology.
[0049] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. A primer set for identifying the macadamia nut variety Nanya 2, characterized in that, The primer set consists of three pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 in the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 in the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 in the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 in the sequence listing. The upstream primer of the third pair is shown in SEQ ID NO:5 in the sequence listing, and the downstream primer of the third pair is shown in SEQ ID NO:6 in the sequence listing.
2. A kit for identifying the macadamia nut variety South Asia 2, characterized in that, The kit includes the primer set as described in claim 1.
3. The application of a primer set for identifying the macadamia nut variety Nanya 2, characterized in that, The application includes: amplifying a sample to be tested using the primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the macadamia nut reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types; When the obtained sequence type is as shown in SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 37 and SEQ ID NO: 40 in the sequence list, the sample to be tested is identified as the macadamia nut variety Nanya 2.