A molecular marker for resistance to corn ear rot and application thereof

By developing molecular markers for resistance to maize ear rot and using PCR amplification to detect the ZmMAPK3 gene, the problem of identifying resistance to maize ear rot was solved, enabling efficient screening and breeding, and improving the efficiency of screening and breeding disease-resistant maize varieties.

CN122303475APending Publication Date: 2026-06-30INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-05-12
Publication Date
2026-06-30

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to the field of biotechnology, specifically disclosing a molecular marker for maize ear rot resistance and its application. The sequence of the maize ear rot resistance molecular marker of this invention is shown in SEQ ID NO.1, exhibiting polymorphism with insertion or deletion of the sequence shown in SEQ ID NO.2 at positions 90bp-123bp. This invention has found that after PCR amplification of the above-mentioned InDel molecular marker in maize, the ear rot resistance of the maize can be determined based on the length of the amplification product. If the product size is 163bp, the maize has high ear rot resistance; if the product size is 200bp, the maize has low ear rot resistance. This molecular marker provides a new method for screening and creating germplasm for maize varieties highly resistant to ear rot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a molecular marker for resistance to corn ear rot and its application. Background Technology

[0002] corn( Zea mays Corn (L.) is a major grain crop with a large planting area and high yield, playing a vital role in grain production and feed processing. With changes in field cultivation practices, the widespread use of straw return to the field, and increased planting density, the occurrence and prevalence of corn diseases have intensified. Corn ear rot (also known as corn kernel rot) is caused by single or combined infections of various plant pathogens. The pathogens are complex and diverse, with major pathogens including *Aspergillus*, *Trichoderma*, *Penicillium*, and *Rhizoctonia*. More than 70 types of fungi causing ear rot have been reported, with over 20 common *Fusarium* species causing corn ear rot. Among these, *Fusarium graminearum* and *Fusarium verticillatum* are the dominant pathogens, causing the most widespread and severe ear rot. The incidence rate of corn ear rot is usually 5%-10%, reaching 30%-40% in severe years. In susceptible varieties, the incidence rate can be as high as 50% or more, resulting in yield losses of 30%-40%. Fusarium graminearum complex not only infects maize, causing ear rot, stem rot, sheath rot, and seedling blight, but also infects wheat, soybeans, and rice, causing important diseases such as wheat scab, soybean root rot, and rice scab. The toxins that may be produced by maize ear rot caused by Fusarium fungi include fumonisin, vomitoxin (DON), fusaric acid, and zearalenone. The occurrence and spread of maize ear rot leads to reduced maize yield and quality, and the toxins produced by the pathogen can also affect human and animal health. Among the control measures for maize ear rot, breeding and planting disease-resistant varieties is the most economical and effective method. However, most varieties currently promoted in production are moderately resistant or susceptible, with relatively few highly resistant varieties. Currently, maize ear rot has been included as one of the main diseases for assessing maize variety resistance. Numerous reports on related resistance assessments show that different inoculation techniques, such as inoculation time and methods, result in certain differences.

[0003] Genetic analysis and molecular mechanism exploration of maize ear rot resistance are the core foundation for advancing molecular breeding for disease resistance. Researchers have discovered that QTL loci for maize ear rot resistance are widely distributed on chromosomes 1-10, and further studies have located multiple resistance QTLs and related genes. However, these resistance QTLs generally suffer from low contribution rates, are highly susceptible to environmental influences, and lack practical molecular markers that are closely linked to or co-segregate with resistance QTLs, making it difficult to directly apply most resistance QTLs to breeding practices.

[0004] Therefore, it is necessary to conduct further research on how to identify resistance to corn ear rot. Summary of the Invention

[0005] One of the objectives of this invention is to provide a new method for determining resistance to corn ear rot.

[0006] This invention provides a molecular marker for resistance to maize ear rot, the sequence of which is shown in SEQ ID NO.1, and has polymorphism with insertion or deletion of the sequence shown in SEQ ID NO.2 at positions 90bp-123bp.

[0007] This invention has discovered a novel InDel molecular marker that can determine maize ear rot resistance. After PCR amplification of the tested maize using this molecular marker, the length of the amplification product can be used to determine the ear rot resistance of the tested maize, providing a new method for screening and creating maize varieties with high ear rot resistance.

[0008] The molecular markers of the present invention can be amplified using primer pairs as shown in SEQ ID NO.3-4.

[0009] The present invention also provides primer pairs for amplifying the above-mentioned molecular markers.

[0010] The sequences of the primer pairs of the present invention are shown in SEQ ID NO.3-4.

[0011] The present invention also provides products containing the above primer pairs, wherein the products are reagents, kits or DNA chips.

[0012] This invention also provides any of the following applications of the above-mentioned molecular markers or primer pairs or products: (1) Application in identifying resistance to maize ear rot; (2) Application in screening or creating maize varieties with high resistance to ear rot; (3) Application in the identification, improvement or molecular marker-assisted breeding of maize germplasm resources.

[0013] In the application of this invention, the method for germplasm resource identification is as follows: PCR amplification of the DNA of the maize to be tested is performed using the primers shown in SEQ ID NO.3-4. If the product size is 163bp, it is determined that the maize to be identified has high resistance to ear rot; if the product size is 200bp, it is determined that the maize to be identified has low resistance to ear rot.

[0014] Those skilled in the art can further utilize the above-mentioned germplasm resource identification methods to screen out maize varieties with high resistance to ear rot from known or unknown maize varieties, and apply them to subsequent breeding.

[0015] In the application of this invention, the specific method for improving maize germplasm (creating maize varieties with high resistance to ear rot) can be as follows: when it is found that maize has low resistance to ear rot, then through means known in the art (such as hybridization, backcrossing, genetic modification, etc.), the maize is made to carry all 319 genes. ZmMAPK3 Genes (i.e., those that make this corn) ZmMAPK3 After PCR amplification of the gene using the primer pair shown in SEQ ID NO.3-4, the product size was 163 bp.

[0016] Specifically, the method for germplasm resource identification described in this invention can be used to determine maize ear rot resistance. If it is found that the product size after PCR amplification of maize DNA using the primers shown in SEQ ID NO.3-4 is 200bp (i.e., low ear rot resistance), then known methods in the art (e.g., hybridization, backcrossing, genetic modification, etc.) can be used to make the maize carry 319. ZmMAPK3 Genes (i.e., those that make this corn) ZmMAPK3 After the gene was amplified by PCR using the primer pair shown in SEQ ID NO.3-4, the product size became 163bp.

[0017] This invention also provides a method for identifying resistance to maize ear rot, comprising: (1) Extract DNA from the corn to be identified; (2) Using the DNA as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.3-4; (3) Determine the level of resistance to ear rot of maize to be identified based on the PCR amplification results.

[0018] In step (3) of the method of the present invention, the method for determining the level of resistance to ear rot of maize based on PCR amplification results is as follows: When PCR amplification is performed using the primer pair shown in SEQ ID NO.3-4, and the product size is 163bp, it is determined that the maize to be identified has high resistance to ear rot. When PCR amplification is performed using the primer pair shown in SEQ ID NO.3-4, and the product size is 200bp, it is determined that the maize to be identified has low resistance to ear rot.

[0019] In the method of the present invention, each 20 μL PCR amplification reaction system comprises: 6.4 μL ddH2O; 10 μL 2×3GTaq Master Mix for PAGE; 0.8 μL each of 1.0 μM forward and reverse primers; and 2.0 μL 50 ng / μL DNA template.

[0020] In the method of the present invention, the PCR amplification program is as follows: 94℃ for 5 min; 94℃ for 30 s, 65℃ for 30 s, decreasing by 1℃ for each cycle, 72℃ for 30 s, for a total of 10 cycles; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min.

[0021] In this invention, corn ear rot is caused by Fusarium fungi, for example, by Fusarium verticillatum.

[0022] The beneficial effects of this invention are at least as follows: This invention provides a novel molecular marker for identifying maize ear rot resistance. The resistance to ear rot in maize can be effectively determined through a simple PCR amplification reaction, providing a new method for screening and creating highly resistant maize varieties. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 The plant performance and disease index of maize inbred lines Qi319 (a disease-resistant parent) and Ye478 (a disease-susceptible parent) after artificial inoculation with ear rot were compared. In this study, a represents plant performance and b represents disease index.

[0025] Figure 2 This is the segment substitution lineage type of chromosome 1 in Embodiment 2 of the present invention.

[0026] Figure 3 The phenotypic results are for Qi 319, Ye 478 and the representative substitution line in Example 2 of the present invention.

[0027] Figure 4 This invention provides a method for finely mapping resistance to maize ear rot using chromosome segment substitution lines (CSSL) populations, as described in Example 3 of this invention. qFER1.03 Results of the locus.

[0028] Figure 5 Before and after inoculation with CL171 and Ye 478 in Example 3 of this invention qFER1.03 Results of candidate gene expression analysis within the interval.

[0029] Figure 6 The InDel-U genotype and inoculation in Example 5 of this invention F. verticillioides Afterwards, each material ZmMAPK3Results of correlation analysis of gene expression levels.

[0030] Figure 7 The results are PCR electrophoresis results of representative materials in Example 5 of this invention. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.

[0033] Example 1: Major locus of maize resistance to ear rot qFER1.03 Positioning 1.1 Materials and Methods 1.1.1 Test Materials Using Qi 319 and Ye 478 as parents, a population of 314 recombinant inbred lines (RILs) was constructed through single-seed transmission, and disease resistance QTLs were detected by combining genotype and phenotype.

[0034] 1.1.2 Disease resistance identification Preparation of spore suspension: A highly pathogenic *Fusarium verticillatum* strain (described in Xia Yusheng. Discovery of genes and exploration of resistance mechanisms against *Fusarium solani* ear rot in maize [D]. Chinese Academy of Agricultural Sciences, 2022. DOI:10.27630 / d.cnki.gznky.2022.000318.) was selected. The strain was first inoculated onto PDA plates and cultured in the dark for approximately 14 days. Then, inoculated PDA blocks were transferred to pea soup liquid medium (described in Xia Yusheng. Discovery of genes and exploration of resistance mechanisms against *Fusarium solani* ear rot in maize [D]. Chinese Academy of Agricultural Sciences, 2022. DOI:10.27630 / d.cnki.gznky.2022.000318.) for sporulation culture. After 7 days, the culture medium was collected and diluted with sterile water to a spore concentration of 1×10⁻⁶. 6The inoculum was prepared at a concentration of spores per mL. Artificial inoculation method: The silk channel injection method was used (see Wang Y, Zhou Z, Gao J, Wu Y, Xia Z, Zhang H, Wu J. 2016. Integrated transcriptome and metabolome analysis reveals defense mechanisms against Fusarium verticillioides in maize kernels. Journal of Proteomics, 145: 113-125.). During the vigorous silking stage of maize, a connected syringe was used to pierce the ear along the silk channel, avoiding puncturing the kernel epidermis. 2 mL of spore suspension was precisely injected into each ear; ears injected with sterile water served as a blank control. Disease severity assessment: Disease incidence was investigated at maize maturity, and the percentage of affected ear area was used as the disease severity assessment indicator. Data statistics and resistance analysis were conducted based on the grading results.

[0035] The severity grading standards and resistance evaluation for maize ear rot are implemented according to industry standards. The grading standard for maize ear rot uses the proportion of diseased area in the female ear to the total area of ​​the female ear as the core indicator, classifying the disease severity into six levels: 0, 1, 3, 5, 7, and 9. The specific grading standards are as follows: Grade 0: The female ears are free from disease, with no lesions or mold symptoms; Level 1: The affected area accounts for less than 1% of the total area of ​​female ears; Level 3: The affected area accounts for 2%-10% of the total female ear area; Level 5: The affected area accounts for 11%-25% of the total female ear area; Level 7: The affected area accounts for 26%-50% of the total female ear area; Level 9: The affected area accounts for 51%-100% of the total female ear area.

[0036] Evaluation criteria for maize varieties' resistance to ear rot. Based on the average disease severity obtained from the survey, the ear rot resistance of maize varieties is divided into five levels: highly resistant (HR), resistant (R), moderately resistant (MR), susceptible (S), and highly susceptible (HS). The specific evaluation criteria are as follows: High resistance (HR): Average disease severity ≤ 1.5; Disease resistance (R): Average disease severity 1.6-3.5; Mid-range anti-metastatic (MR): Average disease grade 3.6-5.5; Severity (S): Average severity level 5.6-7.5; High susceptibility (HS): average severity level 7.6-9.0.

[0037] 1.1.3 Genotype Analysis and QTL Mapping Resequencing of the RIL population constructed from the resistant parent Qi 319 and the susceptible parent Ye 478 and both parents. For relevant data and genotypes, see Ye JR, Zhong T, Zhang DF, Ma CY, Wang LN, Yao LS, Zhang QQ, Zhu M, XuML. 2018. The auxin-regulated protein ZmAuxRP1 coordinates the balance between root growth and stalk rot disease resistance in maize. MolecularPlant, 12(3): 360-373.

[0038] Molecular marker linkage maps were constructed using QTL Ici-Mapping Version 4.1 software. Genotype data were organized according to the software requirements, grouped under the condition of LOD greater than 3.0, sorted using nntwoOpt, and organized using SaRF (see Doerge RW, Churchill GA. Permutation tests for multiple loci affecting a quantitative character[J]. Genetics. 1996, 142(1): 285-294.). After the molecular marker linkage maps were constructed, QTL localization was performed using the IcIM additive mapping method. Missing phenotypes were removed during localization. The mapping step size was 0.20 cM. ​​The linkage was determined by 1000 permutation tests. P =QTL at the 0.05 level.

[0039] 1.2 Results 1.2.1 Linkage Graph Construction Genotyping was performed on the RILs population and the parents (Qi 319 and Ye 478). A total of 137,699,000 reads were screened, with an average of 357,376 reads per individual. A total of 88,268 SNPs were developed, and 4,183 parent-specific SNPs were finally screened and anchored on the genetic linkage map. A high-density map covering all 10 maize chromosomes was constructed, with a total chromosome length of 1545.65 cM. The average genetic distance between molecular markers was 0.37 cM, and the physical distance was 0.51 Mb (B73_v3, Mb).

[0040] 1.2.2 Location of the major QTL for maize ear rot resistance Combining field phenotypic and genotypic data of RILs populations, a mixed linear model using QTL IciMapping V4.1 software was employed to analyze the phenotypic and corresponding genotypic data of RILs populations from seven locations: Shunyi (2019), Changping (2019), Xinxiang (2019), Changping (2020), Zhengzhou (2020), Shunyi (2021), and Zhengzhou (2021). After 1000 iterations, in P At the 0.05 level, the QTL localization results are shown in Table 1. A major-effect qTL was detected on chromosome 1. QTL_qFER1.03 This can explain 4.98-15.40% of the phenotypic contribution.

[0041] Table 1. QTL detection of recombinant inbred lines against mid-ear rot Example 2: CSSL-based group pair qFER1.03 Validation analysis 2.1 Materials and Methods 2.1.1 Test Materials To effectively validate the mapping results of the RIL population and subsequent fine mapping, the superior maize inbred line Qi 319 was selected as the non-recurrent parent, and Ye 478 as the recurrent parent to construct a BC5F3 CSSLs population covering the entire chromosome. From this population, 12 chromosome segment replacement lines covering chromosome 1 with the introduction of a Qi 319 gene fragment and using the Ye 478 genotype as the genetic background were selected for validation of disease resistance QTLs. Among them, the introduction line CL171 contained a QTL introduction fragment for ear rot resistance in the bin1.03 region of chromosome 1.

[0042] 2.1.2 Phenotypic Identification Refer to 1.1.2.

[0043] 2.2 Results The plant behavior of maize inbred lines Qi319 (a disease-resistant parent) and Ye478 (a disease-susceptible parent) against ear rot after artificial inoculation with Fusarium oxysporum (Not invaded refers to maize not inoculated with Fusarium oxysporum, Invaded-Fv refers to maize inoculated with Fusarium oxysporum) and the disease index are shown in [reference needed]. Figure 1 .

[0044] Based on the QTL mapping results of recombinant inbred families, the gene for resistance to ear rot was initially located on chromosome 1. Therefore, replacement lines carrying the gene for resistance to ear rot were selected from 12 replacement lines covering chromosome 1 to eliminate genetic background interference and perform fine mapping. The types of chromosome 1 segment replacement lines are shown below. Figure 2(In the figure, all marker fragments such as umc2225 and Ylq102 are publicly available in MaizeGDB and can be retrieved by searching the recorded marker names.) Genotyping analysis identified 12 chromosome segment replacement lines that essentially cover chromosome 1 (see [link to relevant documentation]). Figure 2 (One series of Chinese varieties). Phenotypic identification was performed on 12 chromosome segment substitution lines, and the phenotypic results of representative substitution lines are shown in […]. Figure 3 Field phenotypic identification showed that CL171 (carrying the Ylq102 marker fragment) was resistant to ear rot, with clean ears, low mycelial abundance, and full grains. Other replacement lines were susceptible to ear rot, with a large amount of yellowish-white mycelium covering the ear surface.

[0045] Utilizing the CSSLs groups derived from Qi 319 and Ye 478 to carry out qFER1.03 Further localization of the Ylq102 marker fragment. Genotypic and phenotypic data indicate that CL171 carries a resistance gene against ear rot, located between marker fragments Y1q25 and bumc1144 (disclosed in MaizeGDB), with a disease incidence rate of 0.35%. In the RIL population, the QTL on chromosome 1 is located within 8 Mb (B73_RefGen_v3), cross-validating with the CL171 introduced fragment.

[0046] Example 3: qFER1.03 Fine mapping and functional validation of candidate genes 3.1 Materials and Methods 3.1.1 Test Materials Based on the results of Example 2, the F2 segregating population of CL171 × Ye478 was further refined for localization. Specifically, CL171 (with the Ylq102 marker fragment from chromosome 1 of Qi319 introduced into Ye478) was crossed with Ye478 to form the F1 generation. The F1 generation was then self-crossed to obtain the F2 population. The localization intervals were verified using SSR markers at both ends and primers that showed polymorphism between the parents. Different types of homozygous and heterozygous exchange plants were selected. Homozygous lines were self-crossed and used for field phenotypic identification. After self-crossing of heterozygous plants, the progeny family method was used to narrow down the localization intervals.

[0047] Furthermore, all the selected recombinant progeny were planted with Ye 478 at a 1:1 ratio and artificially inoculated with Fusarium oxysporum (Verticillium oxysporum). F. verticillioides After that, field identification was carried out. Using 13 pairs of primers (Table 2) that are polymorphic among the parents, the homozygous lines of the F8 generation of the secondary segregating population were finely mapped.

[0048] Table 2. Primer information for 13 pairs (SEQ ID No. 5-30)

[0049] Note: The physical locations in the table refer to B73_RefGen_v3, and all marker physical locations are located on chromosome 1.

[0050] 3.1.2 Development of Polymorphic Markers Indel markers were developed and designed by combining resequencing data from parental lines Qi319 and Ye478.

[0051] 3.1.3 Genotyping When the maize plants reached the 5-leaf stage, a small number of fresh leaves were taken from each plant, and genomic DNA was extracted using the CTAB method. Indel markers were developed based on resequencing data from Qi 319 and Ye 478, and primer sequences were synthesized by BGI Genomics Co., Ltd. PCR reactions employed a descending amplification program, and the amplification products were separated by 8% polyacrylamide gel electrophoresis and silver staining.

[0052] The PCR amplification reaction was performed in a 20 μL system with the following components: ddH2O 6.4 μL; 2×3G Taq MasterMix for PAGE (Red Dye) 10 μL; forward and reverse primers (1.0 μM) 0.8 μL each; DNA template (50 ng / μL) 2.0 μL.

[0053] After mixing all reaction components, add 20 μL of mineral oil to cover the mixture, and perform amplification on a PCR instrument. The amplification program is as follows: 94℃ for 5 min; 94℃ for 30 s, 65℃ for 30 s (decreasing by 1 ℃ per cycle), 72℃ for 30 s, for a total of 10 cycles; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min.

[0054] 3.1.4 RNA Extraction and Detection Total RNA was extracted from maize and Fusarium using the RNA extraction kit from Zhuangmeng Biotechnology Co., Ltd. The extraction method is described in the manufacturer's instructions. The integrity of the total RNA was assessed by 0.8% agarose gel electrophoresis.

[0055] 3.1.5 Transcriptome Sequencing and Analysis Purified RNA was used to construct cDNA libraries using the NEBNext Ultra RNA library Prep kit. Twenty-one libraries were then sequenced using an Illumina HiSeq 2500 sequencer. After removing low-quality reads, adapter contaminants, and reads with excessive unknown base N content, high-quality paired-end reads were mapped to the Nipponbare reference genome (MSU Rice genomeAnnotation Project Release 7) using the splitting read mapper TopHat version 2.0.12. Principal component analysis (PCA) was performed using the prcomp function in the default R software to interpret the correlations between each genotype. Cuffdiff, a module of Cufflinks, was used to identify differentially expressed genes (DEGs) based on a double expression change threshold and a false detection rate (FDR) <0.05.

[0056] 3.1.6 Screening and Functional Validation of Candidate Genes Genes within this region were annotated based on the third-generation genome assembly information of Qi 319 and the annotation information of the B73 reference genome database (https: / / www.ncbi.).

[0057] Inoculation with CL171 and Ye 478 F. verticillioides Sampling was performed at 0, 48, 72, and 96 hpi, and candidate genes were analyzed using RT-qRRCR. F. verticillioides Expression level after induction.

[0058] The internal control detection primers are ZmUbi-2q-F: 5'-TGGTTGTGGCTTCGTTGGTT-3' (SEQ ID No. 31) and ZmUbi-2q-R: 5'-GCTGCAGAAGAGTTTTGGGTACA-3' (SEQ ID No. 32).

[0059] 3.1.7 Phenotypic Identification Refer to 1.1.2.

[0060] 3.2 Results 3.2.1 qFER1.03 Precise positioning All selected recombinant progeny were seeded with Ye 478 at a 1:1 ratio and artificially inoculated. F. verticillioidesSubsequently, field identification was conducted. The results showed that, compared to the susceptible parent Ye 478, the recombinant exchange plants Type 1, Type 2, Type 11, and Type 12 exhibited significant differences in disease severity compared to Ye 478. P <0.05), while there was no significant difference in disease severity among Type 3, Type 4, Type 5, Type 6, Type 7, Type 8, Type 9, and Type 10. In summary, based on the genotypic and phenotypic identification results of the recombinant exchange single-plant progeny, the final... qFER1.03 The location was traced to the molecular markers InDel75 and InDel9 on chromosome 1, with a physical distance of 1.18 Mb (B73_RefGen_v3). Figure 4 Based on the third-generation genome assembly information of Qi 319 and annotation information from the B73 reference genome database (https: / / www.ncbi.), this localization interval contains 111 candidate genes. Combined with transcriptome data analysis, 12 genes were upregulated in the disease-resistant material, and further analysis revealed that only one gene is related to immunity. Zm00001eb013100 ( ZmMAPK3 NCBI login ID: LOC100272353 Therefore, it was designated as a candidate gene.

[0061] 3.2.2 Functional validation of candidate genes To evaluate candidate gene responses F. verticillioides To assess post-infection resistance levels, samples were taken at 0, 48, 72, and 96 hpi after inoculation of CL171 and Ye478. RT-qPCR analysis was used to analyze candidate genes at these levels. F. verticillioides Expression level after induction ( Figure 5 ).

[0062] Zm00001eb013100 The PCR quantitative detection primers are SEQ ID No. 33 and 34.

[0063] SEQ ID No.33:CTGTCGGAGGAGCACTGC; SEQ ID No. 34: TTGCTGGGCTTGAGGTCG.

[0064] The results show that Zm00001eb013100 by F. verticillioides After induction, the expression level in CL171 first increased and then decreased, reaching its highest level at 48 hours. In contrast, the overall expression level in CL478 was lower than that in CL171, and the expression level at 48 hours post-induction was significantly lower than that in CL171. P <0.05).

[0065] Example 4: ZmMAPK3Sequence analysis and development of functional markers 4.1 Materials and Methods 4.1.1 Test Materials The disease-resistant parent Qi 319 and the disease-susceptible parent Ye 478.

[0066] 4.1.2 Functional Tag Development based on ZmMAPK3 Develop the molecular marker InDel-U.

[0067] 4.1.3 Genotyping When maize reaches the 5-leaf stage, a small number of fresh leaves are taken from each plant, and genomic DNA is extracted using the CTAB method. The molecular marker InDel-U was developed based on the disease-resistant parent Qi319 and the susceptible parent Ye478. ZmMAPK3 Sequencing data alignment for 3'UTR region amplification was performed, with primer sequences synthesized by BGI Genomics Co., Ltd. PCR reactions employed a descending amplification program, and amplification products were separated and detected by 1% agarose gel electrophoresis.

[0068] The PCR amplification reaction was performed in a 20 μL system. The system components and amplification procedure are described in section 3.1.3.

[0069] 4.2 Results RT-qPCR results showed that ZmMAPK3 Given the significant induction of expression by pathogens and considering that the 3'UTR regulates mRNA stability, it is speculated that... ZmMAPK3 The 3' UTR sequence differs between the resistant parent Qi319 and the susceptible parent Ye478. Therefore, for ZmMAPK3 Amplification analysis of the 3'UTR sequence revealed that, compared to Qi319, the Ye478 promoter region contained a longer 34 bp insertion. To address this, the molecular marker InDel-U was developed.

[0070] The molecular marker InDel-U has a sequence as shown in SEQ ID NO.1, exhibiting polymorphism with insertions or deletions of the sequence shown in SEQ ID NO.2 at positions 90bp-123bp.

[0071] SEQ ID NO.1: GTGAGGCCGTGTAATCTGTCGCTGCAGGTTTCAGGCGTCCCTGTAATGACTAATGAGTTGTACCAAACATAAAAGGTTCGGATCAAAAGGCGATGAGTTGTACCAACTACCAAGATAAAAAAAGGTGATGTGATGGTTAATGGTATCATTTTCAAGTTATATATGAGAATTTAGTGATAATTTGTATTCGTGGGCCCTCT.

[0072] SEQ ID NO. 2: GCGATGAGTTGTACCAACTACCAAGATAAAAAAA.

[0073] Among them, the band size amplified by the primers labeled with InDel-U (SEQ ID NO.3-4) in maize inbred line Qi 319, which is highly resistant to ear rot, is 163bp, which is significantly smaller than the band size amplified in inbred line Ye 478, which is highly susceptible to ear rot (200bp).

[0074] F:GTGAGGCCGTGTAATCTGTC (SEQ ID NO.3); R: AGAGGGCCCACGAATACAAA (SEQ ID NO. 4).

[0075] The PCR amplification reaction was performed in a 20 μL system. The system components and amplification procedure are described in section 3.1.3.

[0076] Example 5: Validation analysis of molecular markers in maize ear rot resistant / susceptible inbred lines 5.1 Materials and Methods 5.1.1 Test Materials Ten maize ear rot resistant inbred lines and ten susceptible inbred lines were selected, and phenotypic identification of these 20 maize inbred lines has been completed.

[0077] 5.1.2 Genotyping Refer to 4.1.3.

[0078] 5.2 Results The phenotypic identification results of 20 maize inbred lines under three environments (E1: Changping, 2023; E2: Jining, 2023; E3: Sanya, 2024) (Table 4) were combined with the InDel-U marker to perform correlation analysis on the genotyping results of the 20 inbred lines.

[0079] The disease resistance of 20 maize inbred lines was identified according to the method described in Example 1. PCR amplification of the 20 maize inbred lines was performed using the InDel-U labeled primer pair described in Example 4. The PCR amplification reaction used a 20 μL system, and the system components and amplification procedure are as described in 3.1.3.

[0080] The results showed that the PCR amplification product size of materials with high resistance to ear rot was 163 bp, while the PCR amplification product size of materials with low resistance to ear rot was 200 bp. PCR electrophoresis results of representative materials are shown below. Figure 7 .

[0081] This embodiment further examines the inoculation of 20 maize inbred lines. F. verticillioides During the last 48 hpi, ZmMAPK3 Gene expression levels.

[0082] Specifically, as described in Example 3. Zm00001eb013100 ( ZmMAPK3 PCR quantitative detection primers were used for PCR amplification of the inoculated materials. The PCR amplification reaction was performed in a 20 μL system, and the system components and amplification procedure were as described in 3.1.3. The detection results are shown below. Figure 6 This indicates that materials with high resistance to ear rot (InDel-U) - (genotype) ZmMAPK3 The overall expression level was higher than that of low resistance to ear rot (InDel-U). + ) materials ( P The value <0.01 can corroborate the effectiveness of the disease resistance identification method of the present invention.

[0083] Table 4. Phenotypic identification of 20 inbred lines under three environments.

[0084] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for resistance to maize ear rot, characterized in that, The sequence of the molecular marker is shown in SEQ ID NO.1, and it exhibits polymorphism with insertion or deletion of the sequence shown in SEQ ID NO.2 at positions 90bp-123bp.

2. The molecular marker according to claim 1, characterized in that, It can be amplified using primer pairs as shown in SEQ ID NO.3-4.

3. Primer pairs for amplifying the molecular marker of claim 1.

4. The primer pair according to claim 3, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.3-4.

5. A product containing the primer pair of claim 3 or 4, wherein the product is a reagent, kit, or DNA chip.

6. Any of the following applications of the molecular marker of claim 1, the primer pair of claim 3 or 4, or the product of claim 5: (1) Application in identifying resistance to maize ear rot; (2) Application in screening or creating maize varieties with high resistance to ear rot; (3) Application in the identification, improvement or molecular marker-assisted breeding of maize germplasm resources.

7. A method for identifying resistance to ear rot in maize, characterized in that, include: (1) Extract DNA from the corn to be identified; (2) Using the DNA as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.3-4; (3) Determine the level of resistance to ear rot of maize to be identified based on the PCR amplification results.

8. The method according to claim 7, characterized in that, In step (3), the method for determining the level of resistance to ear rot of maize based on the PCR amplification results is as follows: When PCR amplification is performed using the primer pair shown in SEQ ID NO.3-4, and the product size is 163bp, it is determined that the maize to be identified has high resistance to ear rot. When PCR amplification is performed using the primer pair shown in SEQ ID NO.3-4, and the product size is 200bp, it is determined that the maize to be identified has low resistance to ear rot.

9. The method according to claim 8, characterized in that, The PCR amplification reaction system per 20 μL includes: 6.4 μL ddH2O; 10 μL 2×3G Taq Master Mix for PAGE; 0.8 μL each of 1.0 μM forward and reverse primers; and 2.0 μL 50 ng / μL DNA template.

10. The method according to claim 8, characterized in that, The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 s, 65℃ for 30 s, decreasing by 1℃ for each cycle, 72℃ for 30 s, for a total of 10 cycles; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min.