A KASP molecular marker, primer set, kit, and application related to pepper fruit width
By using a molecular marker developed at position 8126781 on chromosome 1 of the pepper genome, KASP technology was used to rapidly screen for pepper fruit width, solving the problem of limited applicability of molecular markers in existing technologies and achieving efficient shortening of the breeding cycle and improvement of selection accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUNAN AGRI UNIV
- Filing Date
- 2026-05-27
- Publication Date
- 2026-06-30
AI Technical Summary
Existing molecular markers are mostly derived from artificially induced mutants, with a single genetic background, making them difficult to apply widely in natural pepper germplasm with rich genetic diversity and conventional breeding populations. Traditional breeding cycles are long and inefficient.
We developed a rapid screening method for pepper fruit width by using molecular markers at position 8126781 on chromosome 1 of the pepper genome, based on natural pepper germplasm resources that have not been artificially induced to mutation, and by designing specific primer sets for PCR amplification and detection of fluorescence signals using KASP technology.
It significantly improves the applicability of molecular markers in the improvement of chili germplasm resources, shortens the breeding cycle, improves selection efficiency and accuracy, and reduces costs.
Smart Images

Figure CN122303477A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chili molecular breeding and biotechnology, specifically relating to a KASP molecular marker, primer set, reagent kit, and application related to the width of chili fruit. Background Technology
[0002] In the fields of plant breeding and genetics, the shape of chili pepper fruit is a key phenotypic characteristic. The fruit is the economic organ of the chili pepper, and its shape is a crucial factor influencing market and consumer choices. Fruit width, as a core element of fruit shape, directly affects single fruit weight, appearance uniformity, and processing suitability, thus becoming an important target for breeding high-yield, high-quality chili pepper varieties.
[0003] Traditional breeding methods are inherently limited by their long time cycles, low efficiency, susceptibility to environmental influences, and the large amount of land resources required. With the development of molecular biotechnology, competitive allele-specific PCR (KASP) technology has become an important tool for genotyping in molecular breeding.
[0004] Fruit shape is a quantitative trait controlled by one or more genes, and the localization of related genes and the elucidation of their molecular regulatory mechanisms have always been a research hotspot. Several molecular markers have been developed, such as the KASP molecular marker developed on chromosome 3 of pepper using the wide-fruit mutant LY49; and the InDel marker developed by locating a deletion segment related to fruit width on chromosome 10 in a narrow-fruit mutant obtained through EMS mutagenesis. These works provide valuable tools for subsequent pepper fruit morphology breeding.
[0005] However, most of the reported molecular markers originate from mutants induced by artificial mutagenesis, resulting in relatively homogeneous genetic backgrounds. Their applicability in genetically diverse natural germplasm and conventional breeding populations may be limited. Therefore, identifying key molecular markers from phenotypic, unmutated natural pepper germplasm is of great significance for developing molecular breeding tools with broader applicability. Summary of the Invention
[0006] This invention aims to solve the above-mentioned problems in the prior art and provides a KASP molecular marker, primer set, kit, and application related to the width of pepper fruits.
[0007] To achieve the above objectives, the first aspect of this application provides a KASP molecular marker associated with the width of chili pepper fruits. Using the Zhangshugang ST-8 genome sequence as a reference, the molecular marker is located at position 8126781 on chromosome 1 of the chili pepper genome, where a single G base is deleted. The molecular marker is as follows:
[0008] GAGAATGACACGCACAAACGGAGAAGGAAATCAACGAACTCGGAGTTCGTTAATGCAGCAAATGTTTCACAATTTGCTCCGGCGACAACAGCA[G / -]ATACTGCCATCAATGGTCCTCCACACGGGCACGGACTAGTGCCCGTGTGGGCCATGAGCAATGGGGGTATAATGGTACCATCCAATGCCATTTGGATGGTACCAGCTATTAGTCATACCAACAATAATAACAGTA (as in SEQ ID NO:1 shown).
[0009] A second aspect of this application provides a KASP typing primer set for amplifying the aforementioned molecular markers, comprising: The primer sequences used to identify or screen the molecular markers are: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTCCGGCGACAACAGCAG-3' (as shown in SEQ ID NO:2); Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTCCGGCGACAACAGCA-3' (as shown in SEQ ID NO:3); Universal reverse primer R: 5'-CAAATGGCATTGGATGGTACCATT-3' (as shown in SEQ ID NO:4).
[0010] Preferably, in the above primer set, the 5' end of the forward primer 1 is connected to a FAM fluorescent adapter sequence, and the 5' end of the forward primer 2 is connected to a HEX fluorescent adapter sequence. The FAM fluorescent adapter sequence is: GAAGGTGACCAAGTTCATGCT; the HEX fluorescent adapter sequence is: GAAGGTCGGAGTCAACGGATT.
[0011] A third aspect of this application provides a kit for identifying KASP molecular markers related to the width of pepper fruits, comprising the primer set described above.
[0012] The fourth aspect of this application provides the use of the primer set as described above or the kit as described above in identifying the width type of pepper fruit or in molecular-assisted breeding for pepper fruit width.
[0013] The above-mentioned application, preferably, of the method for identifying the width type of chili pepper fruits, includes the following steps: (1) Extract genomic DNA from the pepper plants to be tested; (2) Using the DNA as a template, perform PCR amplification using the primer set or the kit described above; (3) Detect the fluorescence signal of the PCR product, determine the genotype of the SNP site and the width phenotype of the pepper fruit based on the fluorescence signal.
[0014] For the above applications, the preferred criteria for genotype determination are as follows: If FAM fluorescence signal is detected, the genotype is G:G, indicating a wide-fruited phenotype; if HEX fluorescence signal is detected, the genotype is -:-, indicating a narrow-fruited phenotype; if both fluorescence signals are detected simultaneously, the genotype is G:- heterozygous, indicating an intermediate phenotype.
[0015] In the above application, preferably, the PCR amplification is performed using Touchdown PCR. The amplification system consists of 50-100 ng of template DNA, 0.15 μL of forward primer, 0.4 μL of reverse primer, 5 μL of 2X PARMS master mix, and ddH2O to a final volume of 10 μL. The amplification program is as follows: 94℃ for 15 min; 94℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 36-38 cycles.
[0016] Compared with the prior art, the beneficial effects of this application are as follows: (1) The molecular markers of this invention are derived from natural chili germplasm resource populations that have not undergone artificial mutagenesis. They are developed based on genetic populations constructed from two representative natural varieties in production: KGS (wide-fruited) and ZGS (narrow-fruited). Compared with molecular markers in the prior art that are mostly developed based on artificially induced mutants (such as EMS mutagenesis), the molecular markers of this invention are derived from genetic variations generated during natural evolution. They have higher polymorphism and wider applicability in conventional breeding populations, local varieties, and commercial varieties with rich genetic diversity. They can effectively avoid the problem of marker failure caused by differences in genetic background and significantly improve the practical value of molecular marker-assisted breeding technology in the improvement of chili germplasm resources.
[0017] (2) This invention uses high-throughput sequencing combined with BSA analysis to locate the major candidate gene controlling fruit width to a relatively fine interval and screen out SNP sites that are highly linked (almost co-segregated) to it. Through genotype-phenotype association analysis, non-destructive testing can be performed during the seedling stage of peppers to quickly screen out individual plants with the genotype of the target fruit width, significantly shortening the breeding cycle (by 1-2 growing seasons), improving selection efficiency and accuracy, reducing the manpower and land costs of field phenotypic identification, and strongly supporting the molecular design breeding of peppers. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is a comparison of the fruit width phenotypes of two natural parent plants used for molecular marker development in Example 1 of the present invention: KGS represents the wide-fruited parent fruit, and ZGS represents the narrow-fruited parent fruit.
[0020] Figure 2 The peak diagram obtained by genome-wide association analysis using the Euclidean distance (ED) algorithm based on extreme pool resequencing data shows arrows indicating significant associated regions on chromosome 1.
[0021] Figure 3 For fine mapping of the F2 population after genotyping using KASP markers: A. Differences in SNP-index at different locations on chromosome 1; B. Genetic maps drawn in the 901kb region based on F2 individuals exhibiting extreme phenotypes. Detailed Implementation
[0022] To facilitate understanding of this application, the following description will be more comprehensive and detailed in conjunction with the accompanying drawings and preferred embodiments, but the scope of protection of this application is not limited to the following specific embodiments.
[0023] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of this application.
[0024] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0025] In the examples below, the average width of the chili pepper fruit is >1.01cm, corresponding to the phenotype of wide fruit; the average width of the chili pepper fruit is ≤0.86cm, corresponding to the phenotype of narrow fruit; and 0.86cm < chili pepper fruit width ≤1.01cm, corresponding to the phenotype of intermediate fruit.
[0026] Example 1: Molecular Marker Discovery and Fine Localization 1. Experimental Materials and Population Construction In the preliminary screening, two chili pepper varieties with significant differences in fruit width were selected from multiple germplasm resources for hybridization: KGS (average fruit width 2.356±0.08 cm, wide fruit) and ZGS (average fruit width 0.560±0.04 cm, narrow fruit). Fruit phenotypes are shown below. Figure 1 As shown, KGS and ZGS are preserved in the germplasm resource bank of the pepper team at the College of Horticulture, Hunan Agricultural University, and can be sold for at least 20 years. The original number of KGS is PI_238053, and the original number of ZGS is PI_439521, which are publicly available at https: / / ted.bti.cornell.edu / cgi-bin / pepper / fruit_picture. KGS was used as the female parent and ZGS as the male parent for hybridization to obtain F1 generation seeds. The F1 plants were self-pollinated, and F2 segregating populations were constructed for two consecutive years, with 883 and 536 plants respectively. All materials were planted at experimental bases in Changsha, Hunan and Sanya, Hainan, using a completely randomized block design with three replicates at each location, and were managed under standard field conditions.
[0027] 2. Phenotypic identification and data analysis During the fruit ripening stage, 5-6 fruits were randomly selected from each F2 plant, and the transverse diameter at its widest point was measured using a digital caliper. The average value was taken as the fruit width phenotypic value for that plant. Statistical analysis of the fruit width of the F2 population over two years showed that the fruit width phenotypic followed a normal distribution, ranging from 0.475 cm to 1.52 cm. Based on the phenotypic data of the F2 population under two environments, a restricted maximum likelihood (REML) method was used to fit a linear mixed model to estimate the variance components. The generalized heritability (H²) was 0.9665, indicating that this trait is strongly controlled by genetic factors and is suitable for genetic mapping.
[0028] 3. Construction and sequencing of extreme mixed pools Based on the phenotypic data of F2 fruit width, the 24 plants with the widest fruit width and the 24 plants with the narrowest fruit width were selected. Equal amounts of leaves from each plant were mixed, and DNA was extracted from the soil using the CTAB method to construct a "wide-fruit pool" (W-pool) and a "narrow-fruit pool" (N-pool). Whole-genome resequencing was performed on both pools using the Illumina NovaSeq 6000 platform, with a sequencing strategy of 150 bp paired ends and a sequencing depth of at least 30× for each pool.
[0029] 4. Preliminary localization of candidate genes for pepper fruit width The obtained pooled sequencing results were compared with the pepper reference genome Zhangshugang ST-8 using BWA-MEM software. SNP / Indel analysis was performed using tools such as Samtools, and QTL-seq analysis was used to calculate the allele frequency difference (ΔSNP-index) of each SNP locus across the entire genome in the two pools. The results showed a significant peak on chromosome 1, with the peak obtained from QTL-seq identification of fruit shape based on Euclidean distance (ED) around 8M. Figure 2 Therefore, this interval is initially identified as a candidate interval for controlling the width of chili pepper fruits.
[0030] 5. Fine mapping of candidate genes for pepper fruit width Within the initially mapped candidate region, SNP loci exhibiting polymorphism between parents (KGS and ZGS) and showing significant frequency differences between extreme pools were screened. Initial mapping was performed at 2M intervals, followed by further fine mapping to narrow the candidate region to 7.2M-8.1M. Figure 3 Gene annotation analysis of the candidate regions revealed six candidate genes. By comparing the whole-genome resequencing data of the parents (KGS, ZGS), one gene was identified as a TCP transcription factor family gene (named...). CaTCP The transcription factor of the protein was found to have a single base deletion and frameshift mutation in the coding region of the narrow-fruit parent (ZGS), which caused the protein to terminate prematurely.
[0031] Further validation using PCR amplification and sequencing on individual plants exhibiting extreme phenotypes from both parents and the F2 population confirmed that the deletion site co-segregated with the fruit width phenotype height. Comparison revealed... CaTCP The CDS region showed five SNP mutations between the two parents, including three synonymous mutations, one base deletion, and one non-synonymous mutation. Based on previous studies and expression level analysis in different tissues and at different time points, it is preliminarily concluded that… CaTCP It was considered as a candidate gene for determining the width of chili pepper fruits.
[0032] Among the aforementioned variant sites, this single-base deletion (located at position 8126781 on chromosome 1 of the pepper genome) showed significant differences between parents and exhibited strict co-segregation with the fruit width phenotype in the F2 segregating population. Therefore, this site was identified as a target molecular marker site for the subsequent development of KASP typing primers.
[0033] Example 2: Development and Validation of KASP Tags 1. KASP primer design and synthesis Based on the SNP sites highly associated with fruit width phenotype identified in Example 1, a single G base deletion occurred at position 8126781 on chromosome 1 of the pepper genome. Specific primers for KASP genotyping were designed and synthesized. The specific primer sequences are as follows: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTCCGGCGACAACAGCAG-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTCCGGCGACAACAGCA-3'; Universal reverse primer R: 5'-CAAATGGCATTGGATGGTACCATT-3'.
[0034] The molecular marker sequence containing this SNP site is: GAGAATGACACGCACAAACGGAGAAGGAAATCAACGAACTCGGAGTTCGTTAATGCAGCAAATGTTTCACAATTTGCTCCGGCGACAACAGCA[G / -]ATACTGCCATCAATGGTCCTCCACACGGGCACGGACTAGTGCCCGTGTGGGCCATGAGCAATGGGGGTATAATGGTACCATCCAATGCCATTTGGATGGTACCAGCTATTAGTCATACCAACAATAATAACAGTA.
[0035] 2. KASP genotyping response system and procedure Using the genomic DNA of 536 individual plants from the F2 segregating population in Example 1 as templates, PCR amplification was performed using the aforementioned KASP primers. The KASP reaction system is shown in Table 1 below.
[0036] Table 1: KASP-PCR reaction system
[0037] The PCR program was as follows: 94℃, 15 min; 95℃, 20 s; 65℃-56℃, 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃, 20 s; 57℃, 60 s, 38 cycles.
[0038] 3. Subtyping Result Detection Leaves from 379 randomly selected individuals from the KGS, ZGS, and F2 populations constructed by hybridization were used for genotyping verification. Fluorescence detection of the amplified products revealed the following: FAM fluorescence signal was detected in 77 individuals with the G:G genotype, exhibiting a wide fruit phenotype; HEX fluorescence signal was detected in 62 individuals with the -:- genotype, exhibiting a narrow fruit phenotype; and both fluorescence signals with comparable intensities were detected in 240 heterozygous individuals with the G:- genotype, exhibiting an intermediate phenotype. One-way ANOVA showed a highly significant difference in fruit width among the three genotypes (P < 0.0001), with this marker explaining a significant percentage (R0.0001) of phenotypic variation. 2 The value was as high as 0.860, confirming it as a major-effect molecular marker. The fruit width and fluorescence detection results of some individual plants in the F2 population are shown in Table 2 below.
[0039] Table 2: Fruit width types and fluorescence signals of some individual plants in the F2 population
[0040] The above are merely preferred embodiments of this application. It should be noted that this application is not limited to the above embodiments. For those skilled in the art, several improvements and modifications can be made without departing from the principles of this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should also be considered within the scope of protection of this application.
Claims
1. A KASP molecular marker associated with the width of chili pepper fruit, characterized in that, Using the Zhangshugang ST-8 genome sequence as a reference, the molecular marker is located at position 8126781 on chromosome 1 of the pepper genome, where a single G base deletion occurs. The KASP molecular marker is: GAGAATGACACGCACAAACGGAGAAGGAAATCAACGAACTCGGAGTTCGTTAATGCAGCAAATGTTTCACAATTTGCTCCGGCGACAACAGCA[G / -]ATACTGCCATCAATGGTCCTCCACACGGGCACGGACTAGTGCCCGTGTGGGCCATGAGCAATGGGGGTATAATGGTACCATCCAATGCCATTTGGATGGTACCAGCTATTAGTCATACCAACAATAATAACAGTA.
2. A primer set for amplifying KASP molecular markers related to the width of pepper fruits, characterized in that, include: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTCCGGCGACAACAGCAG-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTCCGGCGACAACAGCA-3'; Universal reverse primer R: 5'-CAAATGGCATTGGATGGTACCATT-3'.
3. A kit for identifying KASP molecular markers related to the width of pepper fruits, characterized in that, It includes the primer set as described in claim 2.
4. The application of a primer set as described in claim 2 or a kit as described in claim 3 in identifying pepper fruit width type or in molecular-assisted breeding for pepper fruit width.
5. The application as described in claim 4, characterized in that, A method for identifying the width type of chili pepper fruits includes the following steps: (1) Extract genomic DNA from the pepper plants to be tested; (2) Using the DNA as a template, perform PCR amplification using the primer set of claim 2 or the kit of claim 3; (3) Detect the fluorescence signal of the PCR product, determine the genotype of the SNP site and the width phenotype of the pepper fruit based on the fluorescence signal.
6. The application as described in claim 5, characterized in that, The criteria for determining genotype are as follows: If FAM fluorescence signal is detected, the genotype is G:G, indicating a wide-fruited phenotype; if HEX fluorescence signal is detected, the genotype is -:-, indicating a narrow-fruited phenotype; if both fluorescence signals are detected simultaneously, the genotype is G:- heterozygous, indicating an intermediate phenotype.
7. The application as described in claim 5, characterized in that, The PCR amplification was performed using Touchdown PCR with the following amplification program: 94℃, 15 min; 94℃, 20 s; 65℃-56℃, 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃, 20 s; 57℃, 60 s, 36-38 cycles.