A dual-targeting DNA vaccine delivery system based on calcium phosphate lipid nanoparticles

Abstract

This invention discloses a dual-targeting DNA vaccine delivery system based on calcium phosphate lipid nanoparticles, belonging to the field of biomedicine. The delivery system comprises calcium phosphate containing histone H1 and an HPV E6 / E7 fusion gene plasmid, and a lipid bilayer membrane of DSPE-PEG-2000-Mannose. This system achieves targeted uptake by dendritic cells through mannose modification and relies on histone H1-mediated DNA nuclear transport. The dual targeting significantly enhances antigen expression efficiency. In vitro and in vivo experiments have demonstrated that this delivery system exhibits good biocompatibility and high stability, effectively activating antigen-specific T-cell immune responses, and possesses both HPV infection prevention and cervical cancer treatment effects, providing a new strategy for cervical cancer prevention and treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a dual-target DNA vaccine delivery system based on calcium phosphate lipid nanoparticles (LCPs): DNA is coated with a nuclear-targeting protein and combined with a mannose-modified LCP carrier to promote dendritic cell (DC) uptake and enhance antigen presentation. Its delivery efficiency, immune activation capacity, and antitumor effect were evaluated through formulation characterization, in vitro cell experiments, and animal models. This invention solves the problems of poor stability and low immunogenicity of traditional DNA vaccines, constructing a highly efficient and safe therapeutic DNA vaccine delivery system for HPV, providing a new strategy for the prevention and treatment of cervical cancer. Background Technology

[0002] Cervical cancer prophylactic vaccines have limited and singular effects. Currently available cervical cancer vaccines are all prophylactic HPV vaccines. Their core principle is to recombinantly express the L1 / L2 capsid proteins of HPV, forming virus-like particles that induce the body to produce specific neutralizing antibodies, thereby blocking initial HPV infection. However, they have clear functional limitations: ① Their target is only the viral capsid protein. After HPV infection, genomic integration occurs, and the L1 / L2 genes in host cells gradually disappear, causing the prophylactic vaccine to be unable to recognize infected cells or precancerous cells, thus having no therapeutic effect on persistent HPV infection; ② These vaccines only activate humoral immunity and cannot initiate cellular immune responses, limiting their applicability to healthy individuals who are not infected with HPV, and failing to meet the protection and treatment needs of infected or high-risk groups.

[0003] DNA exhibits low cellular uptake efficiency and poor stability. The in vivo delivery of cell-free DNA faces multiple physiological barriers, limiting its practical application: ① Enzymatic degradation: Cell-free DNA is easily recognized and degraded by nucleases in body fluids; ② Cellular uptake barriers: DNA molecules are negatively charged, creating electrostatic repulsion with the equally negatively charged cell membrane, preventing autonomous penetration and resulting in extremely low cellular uptake efficiency. Even if a small amount is phagocytosed by the cell, it is easily phagocytosed and degraded by the endosome-lysosome system, making endosome escape difficult; ③ Transport barriers: DNA struggles to cross the nuclear membrane to enter the nucleus for transcription and expression, further reducing the effectiveness of vaccines.

[0004] Vaccines suffer from insufficient immune activation efficiency and limited anti-tumor effects. Existing DNA vaccines and delivery systems generally suffer from low immunogenicity, low antigen presentation efficiency, and insufficient immune response initiation: ① Targeting defects: Existing delivery vectors lack specific targeting ability for antigen-presenting cells, making precise enrichment difficult; ② Low antigen expression levels: Due to low DNA uptake efficiency and difficulty in nuclear transport, the expression level of antigen proteins in target cells is insufficient, failing to effectively activate T cell responses and inducing a sufficient number of antigen-specific T cells.

[0005] Purpose of the invention :

[0006] 1. Early proteins E6 / E7 are considered a major cause of malignant transformation in tumors, and the E6 and E7 genes are continuously expressed during persistent HPV infection. Using DNA expressing E6 and E7 proteins as antigens, a cervical cancer DNA therapeutic vaccine can be designed to achieve the dual effects of preventing and treating cervical cancer infection.

[0007] 2. Design an efficient and safe DNA vaccine delivery system with: 1) good targeting ability; 2) intracellular escape ability; 3) safe and stable DNA encapsulation ability.

[0008] 3. Modify the delivery system to target antigen-presenting cells, promote DC uptake, and thus enhance the body's immune response. Summary of the Invention

[0009] The purpose of this invention is to construct a dual-target DNA vaccine delivery system based on calcium phosphate lipid nanoparticles (LCP) LCP@H1 / DNA-Man.

[0010] The delivery system encapsulates histone H1 and a DNA plasmid, and the encapsulation uses mannose-modified calcium phosphate lipids. The DNA plasmid is selected from: pVAX1, pCMV6, pCMV-Script, and HPV E6 / E7 fusion DNA plasmids. Preferably, it is an HPV E6 / E7 fusion DNA plasmid or a plasmid containing a fusion gene of HPV-16 or HPV-18 E6 and E7 proteins.

[0011] The vaccine delivery system LCP@H1 / DNA-Man of the present invention, wherein the mass ratio of histone H1 to DNA plasmid is 1:1 to 4:1; the mannose modification is achieved by attaching DSPE-PEG-Mannose to the surface of the nanoparticles.

[0012] The present invention further provides a method for preparing the vaccine delivery system LCP@H1 / DNA-Man described herein, the method comprising the following steps:

[0013] Step 1: Preparation of the H1 / DNA complex

[0014] The histone H1 solution and the DNA plasmid (DNA plasmid fused with HPV E6 / E7) solution were mixed in a buffer solution and incubated at room temperature for 30 minutes to form a stable H1 / DNA complex.

[0015] Step 2: Preparation of the calcium phosphate core encapsulating the H1 / DNA complex (CaP@H1 / DNA)

[0016] a. Prepare two water-in-oil microemulsions:

[0017] Microemulsion A: contains surfactants (such as Igepal CO-520), oil phase solvents (such as cyclohexane), and aqueous phase Na2HPO4 solution;

[0018] Microemulsion B: contains surfactant, oil phase solvent, aqueous CaCl2 solution, and all H1 / DNA complex solutions obtained in step (1); b. Stir microemulsions A and B separately to form a homogeneous system; c. Add auxiliary lipids (such as DOPA) to microemulsion A and continue stirring; d. Mix microemulsion B with microemulsion A and continue stirring. At this time, CaCl2 dispersed in the aqueous core of the microemulsion... 2+ With PO4 3- The reaction generates calcium phosphate precipitate, which encapsulates the H1 / DNA complex, forming CaP@H1 / DNA primary nanoparticles; e. Ethanol is added to break the emulsion, the precipitate is collected by centrifugation and washed to obtain purified calcium phosphate cores encapsulating the H1 / DNA complex;

[0019] Step 3: Preparation of LCP@H1 / DNA-Man a. Disperse the calcium phosphate core encapsulating the H1 / DNA complex obtained in Step 2 in an organic solvent; b. Add to a mixture of DOPC, cholesterol, DOTAP, DSPE-PEG-2000 and DSPE-PEG-2000-Mannose;

[0020] c. Rotary evaporation removes the organic solvent, forming a uniform lipid film; d. Water is added for hydration, causing the lipid film to rearrange and encapsulate the core, yielding nanoparticles LCP@H1 / DNA-Man.

[0021] In step one, the buffer solution is CaCl2 buffer; in step two, the surfactant is selected from Igepal CO-520, the oil phase solvent is selected from cyclohexane, and the auxiliary lipid is selected from DOPA; in step three, the organic solvent is selected from chloroform.

[0022] Preferably, the preparation method of the present invention includes the following steps:

[0023] Step 1: Take 15 μg HPV-pDNA (DNA plasmid fused with HPV E6 / E7), add 30 μg histone H1, incubate at room temperature for 30 min, and add to 40 μL CaCl2 to obtain histone H1 and DNA co-incubation solution.

[0024] Step 2: Divide the histone H1 and DNA co-incubation solution obtained in Step 1 into two equal portions. Add the first portion to solution ① (0.9 mL Igepal CO-520, 2.1 mL cyclohexane, and 74 μL Na2HPO); add the second portion to solution ② (0.9 mL Igepal CO-520, 2.1 mL cyclohexane, and 40 μL CaCl2). Stir solutions ① and ② separately for 15 min. Add 74 μL DOPA to solution ① and stir for another 15 min. Then mix it with solution ② and stir for 30 min. Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash the precipitate twice with anhydrous ethanol. The resulting precipitate is the calcium phosphate core encapsulating the H1 / DNA complex.

[0025] Step 3: Add chloroform to the calcium phosphate core containing the H1 / DNA complex obtained in Step 2, and add a cationic lipid mixture: 28 μL DOPC, 111 μL cholesterol, 11 μL DOTAP, 110 μL PEG-2000, and 165 μL PEG-2000-man. After mixing thoroughly, remove the chloroform by rotary evaporation, add 2 mL of pure water, and rotate to hydrate until the lipid film is completely homogeneous. This yields the vaccine delivery system LCP@H1 / DNA-Man.

[0026] In the above method of the present invention, the preparation methods of each solution are as follows:

[0027] Na2HPO4 (100mM): Weigh 70.98mg Na2HPO4 and dissolve it in 5mL DEPC water.

[0028] CaCl2 (500mM): Weigh 277mg CaCl2 and dissolve it in 5mL of DEPC water.

[0029] DOPA (35mM, 722.95g / mol): Weigh 75mg DOPA and dissolve it in 3mL of chloroform.

[0030] Cholesterol (20mM, 386.65g / mol): 19mg cholesterol was dissolved in 2.5mL of chloroform.

[0031] DOPC (20mM, 786.13g / mol): Weigh 15mg DOPC and dissolve it in 1mL of chloroform.

[0032] DOTAP (10mM, 698.54g / mol): Weigh 3.5mg DOTAP and dissolve it in 0.5mL of chloroform.

[0033] PEG-2K (40mM, 2000g / mol): Weigh 32mg DSPE-PEG-2000 and dissolve it in 4mL of chloroform.

[0034] PEG-2K-mannose (40mM, 2000g / mol): 32mg DSPE-PEG-2000-man was dissolved in 4mL of chloroform.

[0035] This invention further provides a pharmaceutical composition comprising a therapeutically effective dose of the dual-targeting DNA vaccine delivery system LCP@H1 / DNA-Man described herein, and a pharmaceutically acceptable carrier or excipient. The vaccine delivery system LCP@H1 / DNA-Man can be formulated into an oral pharmaceutical preparation according to pharmaceutical principles, such as a parenteral or oral form, including an injectable form. This is intended for the prevention and treatment of diseases caused by corresponding viral infections, such as malignant tumors caused by related viruses, such as cervical cancer caused by HPV.

[0036] The present invention further provides the use of the vaccine delivery system LCP@H1 / DNA-Man in cell evaluation of vaccine safety.

[0037] The present invention further provides the use of the vaccine delivery system LCP@H1 / DNA-Man in the evaluation of cell nuclear uptake efficiency.

[0038] This invention relates to the use of the dual-target DNA vaccine delivery system LCP@H1 / DNA-Man in the preparation of medicaments for the prevention and / or treatment of HPV infection-related diseases, preferably cervical cancer.

[0039] The present invention claims protection for the preparation method, which includes the following key steps: (1) Histone H1 and HPV E6 / E7 DNA plasmid are incubated at room temperature to form a complex; (2) A calcium phosphate core encapsulating the complex is prepared by water-in-oil microemulsion method; (3) The calcium phosphate core and a mixture of cationic lipids (containing DOPC, cholesterol, DOTAP, DSPE-PEG-2000 and DSPE-PEG-2000-Mannose) are hydrated in a thin film to form an outer lipid layer, and finally LCP@H1 / DNA-Man nanoparticles are obtained.

[0040] This invention claims functional protection for: the application of histone H1 in nuclear-targeted delivery of DNA vaccines, which mediates DNA crossing the nuclear membrane and improves the transcriptional expression efficiency of antigen genes in the cell nucleus; the application of mannose-modified LCP vectors in DC cell-targeted delivery, which enhances the uptake and antigen presentation capacity of DC cells by specifically binding to mannose receptors; and the application of the above dual-targeted delivery system in the preparation of therapeutic and preventive DNA vaccines for cervical cancer.

[0041] Compared with the prior art, the present invention has the following advantages:

[0042] 1. Dual active targeting for significantly improved efficiency: DC cell-specific recognition and uptake are achieved through surface mannose modification; efficient nuclear transport is mediated by histone H1 in the nucleus. This dual-targeting synergistic effect fundamentally solves the core problem of DNA vaccines being unable to enter specific cells or the cell nucleus, greatly improving the delivery and expression efficiency of antigen genes.

[0043] 2. Safe and reliable with excellent biocompatibility: The main components of the system (calcium phosphate, phospholipids, cholesterol, PEG) are all biocompatible materials. In vitro cytotoxicity experiments have confirmed that it has no significant toxicity to immune cells and has high safety.

[0044] 3. Well-designed and highly effective in activating the immune system: The DNA vaccine targets the key pathogenic targets E6 / E7 proteins of HPV-related cervical cancer and is delivered via this highly efficient delivery system to stimulate strong antigen-specific CD8+. + T-cell immune responses have the potential to treat existing infections and prevent new infections.

[0045] 4. Mature process and easy quality control: The preparation method is based on the mature microemulsion method and thin film hydration method. The process parameters are easy to control, which is conducive to the preparation of nano-formulations with uniform particle size and stable encapsulation rate, and has the prospect of large-scale production.

[0046] The following is a further explanation of the terms and material sources that appear in this specification:

[0047] HPV-pDNA: The HPV16 E6 / E7 fusion plasmid used in the experiment of this invention is from Gemma Gene. Its nucleotide sequence is as follows: (see sequence 1 in the sequence listing). The active part of this sequence belongs to the prior art and targets the HPV16E6 / E7 part.

[0048] DC2.4: Immortalized dendritic cells derived from mouse bone marrow

[0049] NCTC-929: Mouse fibroblasts

[0050] H1: Histone H1

[0051] CaP core: calcium phosphate nanoparticles

[0052] blank LCP: Empty calcium phosphate lipid nanoparticles

[0053] DLS: Dynamic light scattering

[0054] TEM: Transmission electron microscope

[0055] Cy5: Fluorescent labeling with anthocyanin dye

[0056] DNase A: DNA nuclease

[0057] FBS: Fetal bovine serum

[0058] PBS: phosphate buffer saline solution

[0059] MTT: 3-(4,5-dimethylthiazol-2)-2,5-diphenyltetrazolium bromide

[0060] DOPA: Sodium salt of 1,2-dioleoyl-sn-glycerol-3-phosphate

[0061] DOPC: 1,2-Dioleoyllecithin

[0062] DOTAP: 1,2-Dioleoyl-3-trimethylaminopropyl chloride

[0063] Igepal CO-520: Polyoxyethylene (5) Nonylphenyl Ether

[0064] DSPE-PEG-2000: Distearylphosphatidylethanolamine-polyethylene glycol 2000

[0065] DSPE-PEG-2000-man: Distearate phosphatidylethanolamine-polyethylene glycol-mannose. Attached Figure Description

[0066] Figure 1 LCP@H1 / DNA-Man vaccine in vivo mechanism of action diagram

[0067] Figure 2 (A) Particle size distribution of LCP@H1 / DNA; (B) LCP@H1 / DNA-Man and LCP@H1 / DNA

[0068] (C) DNA encapsulation efficiency with Histone; (D) Particle size distribution of CaP core, blank LCP, and LCP@H1 / DNA-Man; (Electrochemical potential of LCP@H1 / DNA-Man.

[0069] Figure 3 TEM images of LCP@H1 / DNA and CaP core

[0070] Figure 4 Particle size variation of LCP@H1 / DNA at different pH levels

[0071] Figure 5 Detection results of LCP@H1 / DNA after co-incubation with DNase A and FBS at 37 ℃ for different times

[0072] Figure 6 Laser confocal microscopy characterizes the nuclear targeting ability of LCP@H1 / DNA-man.

[0073] Figure 7 MTT assay for the safety of LCP@H1 / DNA-man in DC2.4 cells

[0074] Figure 8 Flow cytometry analysis of LCP@H1 / DNA-man cellular expression levels Detailed Implementation

[0075] The product and its preparation method according to the present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the methods described are conventional methods. Unless otherwise specified, the raw materials can be obtained from publicly available commercial sources.

[0076] Example 1: Preparation of blank calcium phosphate lipid nanoparticles (LCP)

[0077] Experimental methods:

[0078] Step 1: Prepare the solution

[0079] Na2HPO4 (100mM): Weigh 70.98mg Na2HPO4 and dissolve it in 5mL DEPC water.

[0080] CaCl2 (500mM): Weigh 277mg CaCl2 and dissolve it in 5mL of DEPC water.

[0081] DOPA (35mM, 722.95g / mol): Weigh 75mg DOPA and dissolve it in 3mL of chloroform.

[0082] Cholesterol (20mM, 386.65g / mol): 19mg cholesterol was dissolved in 2.5mL of chloroform.

[0083] DOPC (20mM, 786.13g / mol): Weigh 15mg DOPC and dissolve it in 1mL of chloroform.

[0084] DOTAP (10mM, 698.54g / mol): Weigh 3.5mg DOTAP and dissolve it in 0.5mL of chloroform.

[0085] PEG-2K (40mM, 2000g / mol): Weigh 32mg DSPE-PEG-2000 and dissolve it in 4mL of chloroform.

[0086] Step 2: Preparation of blank calcium phosphate lipid nanoparticles (LCP)

[0087] (1) Solution ① 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane, 74 μL of Na2HPO and solution ② 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane, 40 μL of CaCl2 were stirred in two bottles for 15 min.

[0088] (2) Add 74 μL of DOPA to solution ① and stir for 15 min. Then mix solution ① and solution ② and stir for 30 min.

[0089] (3) Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash twice with anhydrous ethanol.

[0090] (4) Take the precipitate and resuspend it in a flask with chloroform.

[0091] (5) Add the cationic lipid mixture: DOPC 28 μL, cholesterol 111 μL, DOTAP 11 μL + PEG-2000 275 μL.

[0092] (6) Remove chloroform by rotary evaporation, add 2 mL of pure water and rotate to hydrate until the lipid film is completely uniform.

[0093] Example 2: Preparation of LCP@DNA-man

[0094] Step 1: Prepare the solution

[0095] Na2HPO4 (100mM): Weigh 70.98mg Na2HPO4 and dissolve it in 5mL DEPC water.

[0096] CaCl2 (500mM): Weigh 277mg CaCl2 and dissolve it in 5mL of DEPC water.

[0097] DOPA (35mM, 722.95g / mol): Weigh 75mg DOPA and dissolve it in 3mL of chloroform.

[0098] Cholesterol (20mM, 386.65g / mol): 19mg cholesterol was dissolved in 2.5mL of chloroform.

[0099] DOPC (20mM, 786.13g / mol): Weigh 15mg DOPC and dissolve it in 1mL of chloroform.

[0100] DOTAP (10mM, 698.54g / mol): Weigh 3.5mg DOTAP and dissolve it in 0.5mL of chloroform.

[0101] PEG-2K (40mM, 2000g / mol): Weigh 32mg DSPE-PEG-2000 and dissolve it in 4mL of chloroform.

[0102] PEG-2K-mannose (40mM, 2000g / mol): 32mg DSPE-PEG-2000-man was dissolved in 4mL of chloroform.

[0103] Step 2: Preparation of LCP@DNA-man

[0104] (1) Take 15 μg HPV-pDNA and mix it with 40 μL CaCl2 (500 mM) solution to form CaCl2-DNA complex.

[0105] (2) Mix 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane, 74 μL of Na2HPO and 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane and 40 μL of CaCl2-DNA complex from step (1) in two bottles and stir for 15 min.

[0106] (3) Add 74 μL of DOPA to solution ① and stir for 15 min. Then mix solution ① and solution ② and stir for 30 min.

[0107] (4) Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash twice with anhydrous ethanol.

[0108] (5) Take the precipitate and resuspend it in a flask with chloroform.

[0109] (6) Add the cationic lipid mixture: DOPC 28 μL, cholesterol 111 μL, DOTAP 11 μL + PEG-2000 110 μL, PEG-2000-man 165 μL

[0110] (7) Remove chloroform by rotary evaporation, add 2 mL of pure water and rotate to hydrate until the lipid film is completely uniform.

[0111] Example 3 Preparation of LCP@H1 / DNA

[0112] Step 1: Prepare the solution

[0113] Na2HPO4 (100mM): Weigh 70.98mg Na2HPO4 and dissolve it in 5mL DEPC water.

[0114] CaCl2 (500mM): Weigh 277mg CaCl2 and dissolve it in 5mL of DEPC water.

[0115] DOPA (35mM, 722.95g / mol): Weigh 75mg DOPA and dissolve it in 3mL of chloroform.

[0116] Cholesterol (20mM, 386.65g / mol): 19mg cholesterol was dissolved in 2.5mL of chloroform.

[0117] DOPC (20mM, 786.13g / mol): Weigh 15mg DOPC and dissolve it in 1mL of chloroform.

[0118] DOTAP (10mM, 698.54g / mol): Weigh 3.5mg DOTAP and dissolve it in 0.5mL of chloroform.

[0119] PEG-2K (40mM, 2000g / mol): Weigh 32mg DSPE-PEG-2000 and dissolve it in 4mL of chloroform.

[0120] Step 2: Preparation of LCP@H1 / DNA

[0121] (1) Take 15 μg HPV-pDNA and mix it with 40 μL CaCl2 (500 mM) solution to form CaCl2-DNA complex.

[0122] (2) Mix 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane, 74 μL of Na2HPO and 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane and 40 μL of CaCl2-DNA complex from step (1) in two bottles and stir for 15 min.

[0123] (3) Stir solutions ① and ② separately for 15 min. Add 74 μL of DOPA to solution ① and stir for another 15 min. Then mix solutions ① and ② and stir for 30 min.

[0124] (4) Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash twice with anhydrous ethanol.

[0125] (5) Take the precipitate and resuspend it in a flask with chloroform.

[0126] (6) Add the cationic lipid mixture: DOPC 28 μL, cholesterol 111 μL, DOTAP 11 μL + PEG-2000 275 μL.

[0127] (7) Remove chloroform by rotary evaporation, add 2 mL of pure water and rotate to hydrate until the lipid film is completely uniform.

[0128] Example 4: Preparation of LCP@H1 / DNA-man

[0129] Step 1: Prepare the solution

[0130] Na2HPO4 (100mM): Weigh 70.98mg Na2HPO4 and dissolve it in 5mL DEPC water.

[0131] CaCl2 (500mM): Weigh 277mg CaCl2 and dissolve it in 5mL of DEPC water.

[0132] DOPA (35mM, 722.95g / mol): Weigh 75mg DOPA and dissolve it in 3mL of chloroform.

[0133] Cholesterol (20mM, 386.65g / mol): 19mg cholesterol was dissolved in 2.5mL of chloroform.

[0134] DOPC (20mM, 786.13g / mol): Weigh 15mg DOPC and dissolve it in 1mL of chloroform.

[0135] DOTAP (10mM, 698.54g / mol): Weigh 3.5mg DOTAP and dissolve it in 0.5mL of chloroform.

[0136] PEG-2K (40mM, 2000g / mol): Weigh 32mg DSPE-PEG-2000 and dissolve it in 4mL of chloroform.

[0137] PEG-2K-mannose (40mM, 2000g / mol): 32mg DSPE-PEG-2000-man was dissolved in 4mL of chloroform.

[0138] Step 2: Preparation of LCP@H1 / DNA-man

[0139] (1) Take 15 μg HPV-pDNA and mix it with 40 μL CaCl2 (500 mM) solution to form CaCl2-DNA complex.

[0140] (2) Mix 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane, 74 μL of Na2HPO and 0.9 mL of Igepal CO-520, 2.1 mL of cyclohexane and 40 μL of CaCl2-DNA complex from step (1) in two bottles and stir for 15 min.

[0141] (3) Stir solutions ① and ② separately for 15 min. Add 74 μL of DOPA to solution ① and stir for another 15 min. Then mix solutions ① and ② and stir for 30 min.

[0142] (4) Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash twice with anhydrous ethanol.

[0143] (5) Take the precipitate and resuspend it in a flask with chloroform.

[0144] (6) Add the cationic lipid mixture: DOPC 28 μL, cholesterol 111 μL, DOTAP 11 μL + PEG-2000 110 μL, PEG-2000-man 165 μL

[0145] (7) Remove chloroform by rotary evaporation, add 2 mL of pure water and rotate to hydrate until the lipid film is completely uniform.

[0146] Example 5 Particle size and potential characterization

[0147] Experimental methods:

[0148] (1) Dynamic light scattering (DLS) characterization of particle size: all nanoparticles (CaP NPs, LCP NPs, LCP@H1 / DNA) were characterized.

[0149] Dispersed in 1 mL of ultrapure water, 300 μL of sample solution was taken, the program parameters were adjusted and placed into the particle size measuring cup, and particle size analysis was performed using a dynamic light scattering particle size analyzer.

[0150] (2) Characterization of Zeta potential: 1 mL of LCP@H1 / DNA was placed in a potential measuring cup and the potential was measured using a Zetasizer-Nano-ZS90.

[0151] Experimental results: Figure 2The results showed that the LCP@H1 / DNA particle size was 104.7 ± 4.0 nm, and the potential was -13.6 ± 0.9 mV at pH 7.4. The particle size of the CaP core, blank LCP, and LCP@H1 / DNA increased with the addition of the lipid exfoliation layer and histones.

[0152] Example 6: Determination of pDNA Encapsulation Efficiency

[0153] Experimental methods

[0154] (1) Cy5-labeled plasmid DNA

[0155] 1. Dissolve the reagent particles at room temperature and centrifuge briefly (3000 rpm, 2 min). For first use, add 50 μL of the reconstitution solution to the particles and stir well. Configure the tracker.

[0156] 2. Prepare the labeling reaction according to the following formula, and finally add Label IT reagent (tracker: DNA = 0.75 μL: 1 μg).

[0157] Water: 27.5 μL

[0158] 10X Buffer: 5μL

[0159] DNA: 10 μL

[0160] Tracker: 7.5μL

[0161] Total: 50μL

[0162] 3. Sonicate for 5 minutes, then incubate at 37°C for 1 hour.

[0163] 4. Purification - Ethanol Precipitation Method: Dilute the system to 100 μL with 30 μL of sterile water, then add 0.1 volume (10 μL) of 5M sodium chloride solution (weigh 0.2922 g of sodium chloride and add 1 mL of water). Add 2.5 times the volume (250 μL) of ice-cold ethanol, mix well, and incubate overnight at -20°C.

[0164] Centrifuge at 14000g for 30 minutes at 4°C, and carefully aspirate the supernatant.

[0165] Wash again with 6.500 μL of 70% ethanol, remove the supernatant, and dry in an oven for 3-5 minutes (not exceeding 5 minutes).

[0166] 7. Resuspend in 20 μL of sterile water and store at -20°C protected from light.

[0167] (2) Determination of encapsulation efficiency

[0168] 1. Preparation of lysis buffer: Dissolve 2 mM EDTA and 0.05% Triton X-100 in pH 7.8 Tris.

[0169] 2. Dissolve LCP in an equal volume of lysis buffer, dissolve at 65°C for 10 minutes to release DNA, and dilute with water to the required volume.

[0170] 3. Dilute the cell-free DNA to the same volume using the same proportion of lysis buffer and measure fluorescence. Measure the encapsulation efficiency using a single-point method.

[0171] Experimental results:

[0172] The encapsulation efficiency of LCP@H1 / DNA was 75.5% as measured by the single-point method, while the encapsulation efficiency of LCP@DNA without histone coating was 68.69%. The addition of histones can increase the encapsulation efficiency of DNA.

[0173] Example 7 Transmission Electron Microscopy Characterization

[0174] Take 10 μL of CaP NPs, LCP@H1 / DNA stock solution diluted 40 times and drop it onto an electron microscope lens. Place the lens in a 37°C oven for 24 h to allow the sample to fully deposit, concentrate, and dry. Observe the transmission electron microscope (TEM) images and record photographs.

[0175] Experimental results:

[0176] Figure 3 The CaP core is round with a particle size of about 60 nm, while the LCP@H1 / DNA particle size is about 100 nm and appears as a "dark round shape".

[0177] Example 8: Characterization of LCP@H1 / DNA stability

[0178] LCP@H1 / DNA was dissolved in PBS buffer at different pH values ​​(7.4, 5, 4), and samples were taken out at different times, diluted to 1 mL, and particle size was analyzed using a dynamic light scattering particle size analyzer.

[0179] Experimental results:

[0180] Figure 4 The results indicate that LCP@H1 / DNA can maintain a stable nanoparticle morphology in an environment of pH 7.4, and gradually degrades in an acidic environment, releasing the H1 / DNA complex.

[0181] Example 9: Characterization of enzyme stability by agarose gel electrophoresis

[0182] Experimental methods

[0183] Preparation of solution

[0184] (1) EDTA (30mM): Weigh 20mg of solid EDTA and dissolve it in 2mL of ultrapure water.

[0185] (2) Preparation of lysis buffer: 2 mM EDTA and 0.05% Triton X-100 are dissolved in Tris at pH 7.8.

[0186] Sample preparation

[0187] (1) Take out the prepared LCP@H1 / DNA and put the samples into centrifuge tubes respectively.

[0188] (2) Add Dnase I solution and 50% FBS solution and incubate on a shaker. Add 3 μl of EDTA solution at 8, 4, 2, 1 and 0 h respectively, and incubate at 65°C for 10 min to terminate the degradation of Dnase I. Then, add lysis buffer and lyse for 10 min (1:1). Take 20 μL of the mixed solution, add 4 μL of loading buffer (5×) and mix well before loading.

[0189] Agarose gel electrophoresis:

[0190] Preparation of 0.8% agarose gel electrophoresis

[0191] (1) Weigh 0.4 g of agarose into a beaker, pour 50 mL of TAE working solution into the beaker, stir to disperse the agarose evenly, put the above mixed solution into a microwave oven, heat on high for 2 min to completely dissolve the agarose in the beaker.

[0192] (2) After cooling for a while, add 4 μL of GelRed nucleic acid gel dye (10000×) to it with a pipette and stir evenly with a glass rod;

[0193] (3) After cleaning the mold, soak it in anhydrous ethanol and let it dry. Pour the above solution into the mold, insert the comb, wait 10 minutes for it to solidify completely, and then remove the comb.

[0194] (4) Place the prepared gel in the electrophoresis tank, with the sample loading well side close to the cathode (black electrode), and pour 300 mL of TAE working solution into the electrophoresis tank to prepare for sample loading.

[0195] Sample loading and imaging:

[0196] (1) Use a pipette to draw 10 μL of sample solution and add it to the sample well (try to place the sample in the center).

[0197] (2) Turn on the electrophoresis apparatus, set the voltage to 100 V and the time to 40 min, and start electrophoresis. After the electrophoresis is completed, take out the agarose gel, place it in the electrophoresis imaging instrument for observation and take pictures.

[0198] Experimental results:

[0199] like Figure 5 As shown, LCP@H1 / DNA protects DNA from degradation by nucleases and serum, indicating that the above method can encapsulate DNA and ensure that DNA is not decomposed during in vivo and in vitro circulation.

[0200] Example 10: Laser confocal microscopy to investigate nuclear targeting

[0201] (1) Take DC2.4 cells, add 1 mL of trypsin to digest for 1.5 min, add 3 mL of complete culture medium to stop digestion, pipette and count the cells using a cell counting chamber.

[0202] (2) DC2.4 cells were seeded at a density of 1.5 × 10^5 cells / ml (1 ml) in confocal dishes and cultured for 24 h.

[0203] (3) Keep the indoor environment dark. Using cell-free DNA as the control group, add 1 mL of the drug solution (LCP@H1 / DNA-Man, LCP@DNA-Man) and incubate for 4 h.

[0204] (4) Staining: Discard the drug-containing culture medium, wash once with PBS, and prepare 2.5 mL of dye (500 μL / piece): Hoechst 5.6 μL added to PBS 2494.4 μL and diluted to 2.5 mL.

[0205] Experimental results:

[0206] like Figure 6 As shown, almost no red fluorescence was observed in the free genome 4 hours after drug administration, while obvious red fluorescence was observed in LCP@H1 / DNA-Man and LCP@DNA-Man. Furthermore, comparing the LCP@DNA-Man group and the LCP@H1 / DNA-Man group, it was observed that more genes entered the cell nucleus in the LCP@H1 / DNA-Man group, indicating that after complexing with histones, more genes entered the cell nucleus to exert their therapeutic effect.

[0207] Example 11: MTT assay to investigate the safety of LCP@H1 / DNA-Man in DC2.4 cells.

[0208] (1) Seed board:

[0209] Logarithmic growth phase DC cells were harvested and digested with 1 ml trypsin for 1 min, followed by 3 ml of complete culture medium to terminate the digestion. After centrifugation at 1000 rpm for 4 min, the culture medium containing trypsin was removed, and the cells were resuspended in appropriate culture medium. Cells were counted using a cell counter, and seeded into 96-well plates at a density of 1*10⁴ cells per well, and cultured for 24 h. A ring of PBS was used to seal the outer edge of the plate before seeding. Eight concentration gradients were set up, with six replicates for each concentration, and the seeding volume per well was 100 μl.

[0210] When seeding the plate, be sure to set up a negative control group (the drug is replaced with PBS, and there are cells and MTT working solution) and a blank control group (no cells and drug, but with the corresponding culture medium and MTT working solution).

[0211] Administer the drug when the cell confluence is approximately 70%.

[0212] (2) Administration:

[0213] Discard the supernatant and serially dilute the formulation to different concentrations. Administer 50 μl per well and administer for 24 hours.

[0214] (3) MTT:

[0215] ① Preparation of MTT working solution: Weigh 10mg of thiazolyl blue (MTT) yellow powder using a balance, add it to 2000uL of sterile PBS to prepare 5mg / ml MTT working solution, and filter it through a 0.22μm nylon filter membrane. Note that the entire process should be carried out in the dark.

[0216] ② Remove the drug-containing culture medium beforehand and add an equal volume of blank culture medium. Add 25 μl of MTT working solution to each well and incubate in a cell culture incubator for 4 hours. Carefully discard the supernatant (do not touch the bottom of the 96-well plate), add 150 μl of DMSO, and reconstitute the precipitate on a shaker for 5 minutes. Measure the absorbance of each well at 570 nm using a microplate reader and calculate the cell viability.

[0217] Experimental results:

[0218] like Figure 7 As shown, LCP@H1 / DNA-Man, LCP@DNA-Man, and LCP@H1 / DNA have good safety and no toxicity to DC2.4 cells.

[0219] Example 12 Flow cytometry detection of DNA expression levels in LCP@H1 / DNA-Man

[0220] (1) Seeding: DC2.4 cells were seeded in 6-well plates at 1.5 x 10^5 cells / mL and cultured for 1 day until the cells adhered.

[0221] (2) The drug administration solution (LCP@H1 / DNA-Man, LCP@DNA-Man) was diluted to different concentrations using blank culture medium as experimental groups, and blank culture medium without GFP was used as a blank control.

[0222] (3) Discard the original culture medium and add drug solutions of different concentrations (2 mL), including the control group, and transfect for 6 h.

[0223] (4) Discard the drug administration medium and add complete culture medium to continue incubation for 42h.

[0224] (5) Flow cytometry pretreatment: Remove the culture medium, wash twice with PBS, add 500 uL of 0.25% trypsin (containing EDTA) to digest the cells, and incubate at 37°C for 1 minute. Add 500 uL of complete culture medium to stop digestion, and pipette to form a single-cell suspension.

[0225] Centrifuge at 2000 rpm for 5 minutes, discard the supernatant, and resuspend in pre-cooled PBS.

[0226] (6) On-machine testing

[0227] Experimental results:

[0228] like Figure 8 As shown, both LCP@H1 / DNA-Man and LCP@DNA-Man can be expressed in DC2.4 and NCTC-929 cells, with higher expression levels in DC2.4 cells, and the expression level of LCP@H1 / DNA-Man is higher than that of LCP@DNA-Man.

[0229] Key technical points of this invention:

[0230] Synergistic design of dual-target delivery system: Construct a dual-function delivery system that targets both nuclear and DC cells. Nuclear-targeted transport is achieved by histone H1 coating DNA, while mannose-modified LCP vectors specifically bind to mannose receptors on the surface of DC cells. This dual-target synergistic approach addresses multiple physiological barriers of cellular uptake, endosome escape, and nuclear transport, solving the core problem of low delivery efficiency in traditional DNA vaccines.

[0231] Optimized combination of biocompatible carriers: Calcium phosphate lipid nanoparticles (LCP) are selected as the core carrier, and the proton sponge effect of calcium phosphate is used to achieve efficient endosome escape and avoid DNA degradation by lysosomes.

[0232] Precise selection of HPV antigen targets: Using the HPV E6 / E7 fusion gene as the DNA vaccine antigen, it specifically targets the key pathogenic proteins in the development and progression of cervical cancer, while activating humoral and cellular immunity, breaking through the functional limitations of traditional preventive vaccines.

[0233] The above description is merely a preferred embodiment of the present invention. It should be noted that the embodiments of the present invention are not limited to the described embodiments. Various changes, modifications, substitutions, combinations, and simplifications can be made without departing from the principle of the present invention, and all such substitutions should be considered equivalent replacements and should also be considered within the scope of protection of the present invention.

[0234] sequence list

[0235] <110> capital medical university

[0236] <120> A Dual-Target DNA Vaccine Delivery System Based on Calcium Phosphate Lipid Nanoparticles (LCP)

[0237] <160 >1

[0238] <210> 1

[0239] <211> 768

[0240] <212> DNA

[0241] <213> Artificial Sequence

[0242] <400> 1

[0243] ATGCACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCAAGCAACAGTTACTGCGACGTGAGGTATATGACTTTGCTTTTCGGGATTTATGCATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTAAAATTAGTGAGTATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTGTGATTTGTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATATAAGGGGTCGGTGGACCGGTCGATGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAGCTGCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTTGGAAGACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAACCATAA

Claims

1. A dual-target DNA vaccine delivery system LCP@H1 / DNA-Man based on calcium phosphate lipid nanoparticles, characterized in that, The delivery system encapsulates histone H1 and DNA plasmids, and the encapsulation uses calcium phosphate lipids with a surface modified with mannose.

2. The dual-target DNA vaccine delivery system LCP@H1 / DNA-Man according to claim 1, characterized in that, The DNA plasmids were selected from: pVAX1, pCMV6, pCMV-Script, and HPV E6 / E7 fusion DNA plasmids.

3. The dual-target DNA vaccine delivery system LCP@H1 / DNA-Man according to claim 2, characterized in that, The DNA plasmid is an HPV E6 / E7 fusion DNA plasmid.

4. The dual-target DNA vaccine delivery system LCP@H1 / DNA-Man according to claim 2, characterized in that, The DNA plasmid is a plasmid of the fusion gene of HPV-16 or HPV-18 E6 and E7 proteins.

5. The dual-target DNA vaccine delivery system LCP@H1 / DNA-Man according to claim 1, characterized in that, The mass ratio of histone H1 to DNA plasmid is 1:1 to 4:1; the mannose modification is achieved by attaching DSPE-PEG-Mannose to the surface of the nanoparticles.

6. The method for preparing the vaccine delivery system LCP@H1 / DNA-Man according to claim 1, characterized in that, Includes the following steps: Step 1: Preparation of the H1 / DNA complex The histone H1 solution and DNA plasmid solution were mixed in buffer and incubated at room temperature for 30 minutes to form a stable H1 / DNA complex. Step 2: Preparation of the calcium phosphate core encapsulating the H1 / DNA complex (CaP@H1 / DNA) a. Prepare two water-in-oil microemulsions: Microemulsion A: contains surfactants (such as Igepal CO-520), oil phase solvents (such as cyclohexane), and aqueous phase Na2HPO4 solution; Microemulsion B: contains surfactant, oil phase solvent, aqueous phase CaCl2 solution and all H1 / DNA complex solutions obtained in step (1); b. Stir microemulsions A and B separately to form a homogeneous system; c. Add an auxiliary lipid (such as DOPA) to microemulsion A and continue stirring; d. Mix microemulsion B with microemulsion A and continue stirring. At this time, the Ca dispersed in the water core of the microemulsion... 2+ With PO4 3- The reaction generates calcium phosphate precipitate, which encapsulates the H1 / DNA complex, forming CaP@H1 / DNA primary nanoparticles. e. Add ethanol to break the emulsion, centrifuge to collect the precipitate and wash it to obtain a purified calcium phosphate core encapsulating the H1 / DNA complex; Step 3: Preparation of LCP@H1 / DNA-Man a. Disperse the calcium phosphate core encapsulating the H1 / DNA complex obtained in Step 2 in an organic solvent; b. Add to a mixture of DOPC, cholesterol, DOTAP, DSPE-PEG-2000 and DSPE-PEG-2000-Mannose; c. Rotary evaporation removes the organic solvent, forming a uniform lipid film; d. Water is added for hydration, causing the lipid film to rearrange and encapsulate the core, yielding nanoparticles LCP@H1 / DNA-Man.

7. The method for preparing the vaccine delivery system LCP@H1 / DNA-Man according to claim 6, characterized in that, In step one, the buffer solution is CaCl2 buffer; in step two, the surfactant is selected from Igepal CO-520, the oil phase solvent is selected from cyclohexane, and the auxiliary lipid is selected from DOPA; in step three, the organic solvent is selected from chloroform.

8. The preparation method according to claim 6, characterized in that, Includes the following steps: Step 1: Take 15 μg HPV-pDNA, add 30 μg histone H1, incubate at room temperature for 30 min, and add to 40 μL CaCl2 to obtain histone H1 and DNA co-incubation solution; Step 2: Divide the histone H1 and DNA co-incubation solution obtained in Step 1 into two equal portions. Add the first portion to solution ① (0.9 mL Igepal CO-520, 2.1 mL cyclohexane, and 74 μL Na2HPO); add the second portion to solution ② (0.9 mL Igepal CO-520, 2.1 mL cyclohexane, and 40 μL CaCl2). Stir solutions ① and ② separately for 15 min. Add 74 μL DOPA to solution ① and stir for another 15 min. Then mix it with solution ② and stir for 30 min. Add 6 mL of anhydrous ethanol, centrifuge at 10000×g for 20 min, and wash the precipitate twice with anhydrous ethanol. The resulting precipitate is the calcium phosphate core encapsulating the H1 / DNA complex. Step 3: Add chloroform to the calcium phosphate core containing the H1 / DNA complex obtained in Step 2, and add a cationic lipid mixture: 28 μL DOPC, 111 μL cholesterol, 11 μL DOTAP, 110 μL PEG-2000, and 165 μL PEG-2000-man. After mixing thoroughly, remove the chloroform by rotary evaporation, add 2 mL of pure water, and rotate to hydrate until the lipid film is completely homogeneous. This yields the vaccine delivery system LCP@H1 / DNA-Man.

9. A pharmaceutical composition comprising the vaccine delivery system LCP@H1 / DNA-Man of claim 1.

10. The use of the vaccine delivery system LCP@H1 / DNA-Man of claim 1 in the preparation of vaccines; and in the preparation of medicaments for the prevention and / or treatment of HPV infection-related diseases; and for the evaluation of nuclear uptake efficiency.

Images