Chrysanthemum polysaccharide, a preparation method thereof and application thereof in preparation of a medicine for treating non-alcoholic fatty liver

Abstract

This invention belongs to the field of biomedical technology, and relates to a chrysanthemum polysaccharide, its preparation method, and its application in the preparation of drugs for treating non-alcoholic fatty liver disease. The preparation method of the chrysanthemum polysaccharide is as follows: The flower heads of chrysanthemums are dried; the dried chrysanthemum flower heads are decolorized using an ethanol solution with a volume concentration of not less than 90%; the decolorized flower heads are dried again and then boiled with water for extraction to obtain an extract; ethanol is added to the extract to adjust the ethanol volume concentration to 78-82%, and alcohol precipitation is performed to obtain an alcohol precipitate; the protein in the alcohol precipitate is removed to obtain the final product. The chrysanthemum polysaccharide prepared by this invention has the effects of reducing lipid accumulation, alleviating liver damage, anti-oxidation, and regulating intestinal flora, and can be used to treat non-alcoholic fatty liver disease.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to a chrysanthemum polysaccharide, its preparation method, and its application in the preparation of drugs for treating non-alcoholic fatty liver disease. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Non-alcoholic fatty liver disease (NAFLD) is a clinicopathological syndrome characterized by excessive fat deposition (more than 5% of liver weight) in hepatocytes, excluding alcohol and other known liver-damaging factors. It is an acquired metabolic stress-induced liver injury closely related to insulin resistance and genetic susceptibility. It is a very common but largely underestimated liver disease, with its causes closely related to diet and metabolic disorders. Early symptoms of NAFLD are usually benign and reversible, but if left untreated, it can progress to cirrhosis and hepatocellular carcinoma.

[0004] Currently, the main methods for preventing and treating NAFLD include: weight loss, diet control, and increased exercise; drug treatment; and surgery. While the first method is widely advocated, most patients cannot adhere to it. Surgery is generally only chosen as a last resort. Most patients choose drug treatment. Currently, there is no specific drug for preventing or treating NAFLD. Clinically, metformin, ursodeoxycholic acid, statins, and phenoxyacetic acid are mainly used to prevent and treat NAFLD, but long-term use of these drugs can increase the burden on the liver, and some drugs also have toxic side effects. Therefore, developing natural active substances with no toxic side effects that can prevent and treat NAFLD has become extremely urgent. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a chrysanthemum polysaccharide, its preparation method, and its application in the preparation of drugs for treating non-alcoholic fatty liver disease. The chrysanthemum polysaccharide prepared by the present invention has the effects of reducing lipid accumulation, alleviating liver damage, anti-oxidation, and regulating intestinal flora, and can be used to treat non-alcoholic fatty liver disease.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In the first aspect, a method for preparing chrysanthemum polysaccharide includes the following steps: Dry the chrysanthemum flower heads; The dried chrysanthemum flower heads were decolorized using an ethanol solution with a volume concentration of not less than 90%. After the decolorized flower heads are dried, they are boiled in water to extract the extract. Ethanol was added to the extract to adjust the volume concentration of ethanol in the solution to 78-82%, and alcohol precipitation was performed to obtain alcohol precipitate. Remove the protein from the alcohol precipitate to obtain the final product.

[0008] Chrysanthemum (Chrysanthemum) is a perennial herbaceous plant belonging to the genus Chrysanthemum in the family Asteraceae. It has a fragrant aroma, a bitter and pungent taste, and is slightly cold in nature. It possesses the effects of clearing heat and detoxifying, purging fire and calming the liver, and is used to treat boils, carbuncles, red and swollen eyes, headaches, and dizziness. Chrysanthemum polysaccharides are important active ingredients in chrysanthemum. Modern pharmacological studies have found that chrysanthemum polysaccharides have antioxidant, lipid-lowering, immune-regulating, anti-tumor, blood sugar-lowering, and antibacterial effects. As a prebiotic, chrysanthemum polysaccharides can promote the proliferation of beneficial bacteria such as Bifidobacteria and Lactobacillus, inhibit the growth of pathogenic bacteria such as Escherichia coli, and improve the intestinal microecological balance. However, there is currently no research on the mechanism of action of chrysanthemum polysaccharides in non-alcoholic fatty liver disease. This invention has found that the chrysanthemum polysaccharides obtained by the above preparation method can not only reduce fat deposition but also protect the liver and have certain antioxidant capacity in vivo and in vitro. Therefore, the chrysanthemum polysaccharides prepared in this invention have a therapeutic effect on non-alcoholic fatty liver disease.

[0009] Reducing fat deposition primarily aims to alleviate lipid metabolism disorders caused by high-fat feeding, including but not limited to: It can effectively reduce weight gain in mice caused by a high-fat diet; It can effectively reduce the increase of epididymal fat in mice caused by a high-fat diet; It can effectively reduce serum TC and TG levels and reduce lipid accumulation in the blood; It can effectively reduce serum LDL-C and reduce the risk of cardiovascular disease caused by cholesterol transported from the liver to the whole body; It can significantly reduce the expression levels of fatty acid synthesis-related genes in the liver, thereby reducing liver fat synthesis; It can significantly reduce the expression of genes related to fatty acid uptake in the liver and reduce fat deposition in the liver.

[0010] The liver-protective effect mainly refers to the significant improvement of liver damage indicators in mice and the reduction of liver specific gravity, including but not limited to: It can effectively reduce ALT levels in the liver and reduce liver damage caused by fatty liver.

[0011] It can effectively reduce liver density and decrease the increase in liver weight caused by fat accumulation.

[0012] The in vitro antioxidant effect is specifically manifested in that glycyrrhiza polysaccharides can significantly improve antioxidant indicators in mice, and also exhibit antioxidant activity both in vivo and in vitro; including but not limited to: It can effectively reduce the level of MDA in the liver and reduce the degree of lipid peroxidation of cell membranes; It can effectively scavenge DPPH free radicals in vitro; It can effectively scavenge ABTS free radicals in vitro; It has a total antioxidant level consisting of antioxidants and antioxidant enzymes in vitro.

[0013] The specific manifestation of its gut microbiota regulation effect is as follows: In the non-alcoholic fatty liver model, chrysanthemum polysaccharides can improve the abundance of gut microbiota, significantly increase the abundance of beneficial bacteria, and at the same time reduce the proportion of harmful bacteria.

[0014] Secondly, a chrysanthemum polysaccharide is obtained by the preparation method described in the first aspect of this invention.

[0015] Thirdly, the application of the chrysanthemum polysaccharide described in the second aspect of the present invention in the preparation of a drug for treating non-alcoholic fatty liver disease.

[0016] Fourthly, the application of the chrysanthemum polysaccharide described in the second aspect of the present invention in the preparation of dietary supplements.

[0017] The beneficial effects of this invention are as follows: (1) The present invention provides a method for preparing chrysanthemum polysaccharide. Experiments show that the method can successfully extract bioactive polysaccharide from chrysanthemum flower heads.

[0018] (2) The protective effect of chrysanthemum polysaccharide provided by the present invention in non-alcoholic fatty liver disease in mice. Specifically, the effectiveness of chrysanthemum polysaccharide was verified in vivo using a mouse non-alcoholic fatty liver disease model. The results showed that chrysanthemum polysaccharide could significantly reduce fatty liver, improve liver function, and reduce weight.

[0019] (3) The chrysanthemum polysaccharide provided by the present invention has antioxidant effects, which are manifested by reducing oxidative stress indicators in vivo and having antioxidant enzyme activity in vitro.

[0020] (4) The chrysanthemum polysaccharide provided by the present invention has a regulatory effect on intestinal flora, specifically by improving the abundance and diversity of intestinal flora, which helps to restore the balance of intestinal microecology.

[0021] (5) The chrysanthemum polysaccharide provided by the present invention has wide application, is easy to obtain, is safe, has universality, and is easy to scale up production. Attached Figure Description

[0022] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0023] Figure 1 The figures show the results of the non-alcoholic fatty liver model in mice treated with chrysanthemum polysaccharides in Example 2 of this invention; where (A) mouse body weight change, (B) mouse epididymal fat weight, (C) liver specific gravity, (D) serum triglyceride (TG) level, (E) serum triglyceride (TG) level, (F) serum low-density lipoprotein (LDL-C) level, (G) liver alanine aminotransferase (ALT) level, (H) liver HE-stained sections (top), Oil Red OA staining (middle), PAS glycogen staining (bottom), (I) quantification of Oil Red OA-stained sections, (J) (NAS) score, (K) expression level of fatty acid uptake-related gene Cd36, (L) expression level of fatty acid uptake-related gene Fapp1, (M) expression level of fatty acid synthesis-related gene Fasn in the liver, (N) expression level of fatty acid synthesis-related gene Acaca in the liver, (O) expression level of fatty acid synthesis-related gene Scd1 in the liver, and (P) expression level of fatty acid synthesis-related gene Ppary in the liver.

[0024] Figure 2 The following is a diagram showing the results of the in vivo and in vitro antioxidant effects of chrysanthemum polysaccharide in Example 3 of the present invention: (A) Malondialdehyde (MDA) level in the liver, (B) DPPH free radical scavenging rate of chrysanthemum polysaccharide in vitro, (C) ABST free radical scavenging rate of chrysanthemum polysaccharide in vitro, and (D) total antioxidant capacity of chrysanthemum polysaccharide in vitro.

[0025] Figure 3 The following figures illustrate the effects of chrysanthemum polysaccharides on gut microbial abundance and diversity in Example 4 of this invention: (A) Venn diagram analysis, (B) NMDS analysis, (C) PCoA analysis, (D) Phylum level community composition distribution, (E) Family level community composition distribution, (F) Genus level community composition distribution, (G) Species taxonomy cladistics, and (H) LDA analysis bar chart. Detailed Implementation

[0026] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0028] The treatment described in this invention refers to any treatment suitable for improving or reversing the occurrence of symptoms associated with non-alcoholic fatty liver disease, or for preventing the aggravation of the disease, such as preventing the occurrence of non-alcoholic fatty liver disease or preventing its recurrence after treatment.

[0029] In order to develop a natural active substance that can prevent and treat NAFLD without toxic side effects, this invention proposes a chrysanthemum polysaccharide, its preparation method, and its application in the preparation of drugs for treating non-alcoholic fatty liver disease.

[0030] A typical embodiment of the present invention provides a method for preparing chrysanthemum polysaccharides, comprising the following steps: Dry the chrysanthemum flower heads; The dried chrysanthemum flower heads were decolorized using an ethanol solution with a volume concentration of not less than 90%. After the decolorized flower heads are dried, they are boiled in water to extract the extract. Ethanol was added to the extract to adjust the volume concentration of ethanol in the solution to 78-82%, and alcohol precipitation was performed to obtain alcohol precipitate. Remove the protein from the alcohol precipitate to obtain the final product.

[0031] In some embodiments, the volume concentration of the ethanol solution used in the decolorization process is 90-100%. When the volume concentration of the ethanol solution is 100%, the ethanol solution is anhydrous ethanol.

[0032] In some embodiments, the decolorization process involves reflux under reduced pressure at a temperature of 70-90°C. Specifically, the reflux is repeated 2-4 times, each time for 1-3 hours (preferably 2 hours).

[0033] In some embodiments, the decolorized flower heads are dried naturally in the shade.

[0034] In some embodiments, the extraction process involves reflux extraction at a temperature of 90-100°C. Specifically, the reflux extraction time is 1-3 hours (preferably 2 hours), and the number of reflux extractions is 1-3 times (preferably 2 times).

[0035] In some embodiments, the material-to-liquid ratio during extraction is 1:5~10, kg / L.

[0036] In some embodiments, the alcohol precipitation treatment time is 10 to 40 hours (preferably 24 hours).

[0037] In the following examples, the method for removing proteins from alcohol precipitation is the Sevage method.

[0038] In another embodiment of the present invention, a chrysanthemum polysaccharide is provided, which is obtained by the above preparation method.

[0039] A third embodiment of the present invention provides the application of the above-mentioned chrysanthemum polysaccharide in the preparation of a drug for treating non-alcoholic fatty liver disease.

[0040] Specifically, the drug has any of the following modes of action: Reduce body weight and epididymal fat weight; It improves lipid accumulation in the liver and serum; Relieve liver damage; Reduce the expression of genes related to fat synthesis and uptake in the liver.

[0041] Specifically, the drug also has the effect of regulating the intestinal flora.

[0042] The drug described in this invention can be administered in unit doses, and the dosage form can be a liquid or a solid dosage form. Liquid dosage forms can be true solutions, colloids, microparticles, emulsions, or suspensions. Other dosage forms include tablets, capsules, pellets, aerosols, pills, powders, solutions, emulsions, granules, suppositories, lyophilized powder injections, inclusion complexes, implants, patches, and liniments.

[0043] The drug of this invention is administered to humans or non-human animals. The non-human animals may be mice, rabbits, birds, and other mammals.

[0044] A fourth embodiment of the present invention provides an application of the above-mentioned chrysanthemum polysaccharide in the preparation of dietary supplements.

[0045] A fifth embodiment of the present invention provides a method for preventing and treating non-alcoholic fatty liver disease, comprising administering the above-mentioned chrysanthemum polysaccharide to a subject.

[0046] Specifically, the subjects can be humans or non-human animals.

[0047] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments and comparative examples.

[0048] Example 1: Preparation of Chrysanthemum Polysaccharides (1) The dried chrysanthemum flower heads were extracted with 95% ethanol at a ratio of 1:5 (m:v, kg / L) to remove fat-soluble small molecules and pigments, resulting in chrysanthemum residue. The extraction process involved reflux treatment twice at 80℃ and normal pressure, each time for 2 hours.

[0049] (2) After the chrysanthemum residue obtained in step (1) is naturally air-dried, water is added and heated to 95°C for extraction twice. The material-to-liquid ratio for the first extraction is 1:8 (kg / L), and the material-to-liquid ratio for the second extraction is 1:6 (kg / L). Each extraction lasts for 2 hours. After filtration, the filtrate is collected.

[0050] (3) Add 90% ethanol to the filtrate obtained in step (2) to make the final ethanol concentration 80%, perform alcohol precipitation treatment, and collect the precipitate after standing for 24 hours.

[0051] (4) The protein precipitated in step (3) is removed by the Sevage method, and the chrysanthemum polysaccharide is obtained by freeze drying. Specifically, the process of removing protein by the Sevage method is as follows: water is added to the precipitate at a mass-to-volume ratio of 1:10 (g / mL) to obtain an aqueous solution, and then mixed with the Sevage solution (the mass ratio of chloroform to n-butanol is 4:1) at a volume ratio of 4:1. After shaking, the mixture is allowed to stand and centrifuged to obtain the upper polysaccharide solution. This step is repeated 7 times until the protein is completely removed.

[0052] The chrysanthemum polysaccharide prepared in this example was used in Examples 2-4.

[0053] Example 2: The fat-reducing and liver-protecting effects of chrysanthemum polysaccharides Animal experiments: Mice were randomly divided into a control group and a high-fat diet group. The high-fat diet group was further divided into a saline group, a low-dose chrysanthemum polysaccharide group (100 mg / kg), a medium-dose chrysanthemum polysaccharide group (200 mg / kg), and a high-dose chrysanthemum polysaccharide group (400 mg / kg), with 8 mice in each group. Weight was recorded every four weeks. After 12 weeks of high-fat feeding, a non-alcoholic fatty liver model was established, followed by 8 weeks of gavage treatment with chrysanthemum polysaccharide. After 8 weeks of chrysanthemum polysaccharide treatment, the mice were fasted for 12 hours before dissection, then anesthetized with ether. Blood, colonic feces, epididymal fat, and liver tissue were collected for further analysis. The samples were suitable for Examples 2-4. Liver weight was recorded, and liver specific gravity and epididymal fat weight were calculated.

[0054] Liver function tests: Blood was centrifuged at 3000 rpm for 10 minutes to obtain serum. The levels of TC, TG, AST, ALT and LDL-C in the serum were detected using a fully automated biochemical analyzer.

[0055] Histological analysis: Freshly isolated liver and epididymal white fat were immediately soaked in 4% paraformaldehyde, followed by hematoxylin and eosin (H&E) staining. Fixed liver tissue was also stained with Oil Red O. All sections were observed under an optical microscope. Quantitative Oil Red O analysis and NAS evaluation were performed.

[0056] Real-time quantitative PCR (qRT-PCR) analysis: qPCR was used to detect the expression levels of fatty acid uptake-related genes (Cd36 and Fap1) and the mRNA levels of fatty acid synthesis-related genes (Fasn, Acaca, Scd1, and Ppary) in the liver. The specific method included: taking an appropriate amount of liver tissue, extracting total RNA using Ttizol reagent according to the manufacturer's instructions, and adjusting the RNA concentration to be consistent. cDNA was synthesized according to the kit instructions. Quantitative PCR (qPCR) was performed using a Hieff qPCR SYBR GreenMaster Mix (Yeasen, 11201ES08) and run on a BIO-RAD real-time PCR system. GAPDH was used as a control gene for normalization. The relative expression levels of the target genes were normalized to the relative expression levels of GAPDH using the ΔCt method.

[0057] Experimental results: Chrysanthemum polysaccharides inhibit obesity and lipid accumulation: such as Figure 1 As shown, after 8 weeks of FCP intervention in NAFLD mice, the mice experienced a significant decrease in body weight, and FCP significantly reduced epididymal fat weight in a dose-dependent manner. Figure 1 B), and the liver weight ratio in the FCPH group decreased significantly ( Figure 1 C). After FCP intervention, serum levels of TC, TG, LDL-C, and ALT were significantly reduced ( Figure 1 D, E, F, G).

[0058] Chrysanthemum polysaccharides reduce liver damage and lipid accumulation: such as Figure 1 As shown in Figure H, the livers of mice in the blank control group (NC) appeared reddish-brown with a smooth surface. The livers of the model group were enlarged and brownish-yellow. However, hawthorn polysaccharide effectively inhibited the development of fatty liver induced by a high-fat diet, showing a reddish-brown color. Liver sections of the model group (HFD) showed increased hepatocyte volume and swelling, indistinct lobular structure, prominent hepatocyte nuclei, and numerous vacuoles (fat droplets) of varying sizes in the cytoplasm. After administration of chrysanthemum polysaccharide, the lobular structure became clearer, and a small number of vacuoles of varying sizes appeared in the cytoplasm, indicating that chrysanthemum polysaccharide can alleviate liver damage and lipid accumulation in a dose-dependent manner. Oil Red OA staining of the liver showed more fat deposition in the model group (HFD), while chrysanthemum polysaccharide effectively improved lipid accumulation in the intestine.

[0059] Example 3: In vitro and in vivo antioxidant effects of chrysanthemum polysaccharides The animal model used was the same as in Example 2. Liver stored at -80℃ was ground, centrifuged, and the supernatant was collected. MDA levels were determined using ELISA. Antioxidant activity was assessed using the DPPH method, ABST method, and T-AOC method. The in vitro antioxidant capacity of chrysanthemum polysaccharides was demonstrated by detecting their DPPH free radical scavenging ability, ABST free radical scavenging ability, and total antioxidant capacity.

[0060] Experimental results: High-dose chrysanthemum polysaccharide intervention significantly reduced MDA levels in the liver. Figure 2 A). It also demonstrated in vitro scavenging abilities against DPPH free radicals, ABST free radicals, and total antioxidant capacity. Figure 2 B, C, D).

[0061] Example 4: Chrysanthemum polysaccharides can improve gut microbiota dysbiosis in mice fed a high-fat diet. 16S Microbes: DNA was extracted using the FastDNA™ Spin Kit for Feces (MPBiomedicals, Santa Ana, CA) according to its manual. The purity and quality of the genomic DNA were checked on a 0.8% agarose gel. The V3-V4 hypervariable region of the 16S rRNA gene was amplified using primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), and then sequenced using an Illumina NovaSeq 6000 system. The raw data were screened, excluding sequences shorter than 200 bp, sequences with low quality scores (≤20), sequences containing ambiguous bases, or sequences that did not perfectly match the primer sequences and barcode labels. Qualifying sequences were separated using sample-specific barcode sequences and pruned using the Illumina Sequencing Analysis Pipeline version 2.6. The dataset was then analyzed using QIIME. These sequences clustered into Operational Taxonomic Units (OTUs) with 97% similarity. The classification assignment of the operational taxonomic unit (OTU) representing the sequence is performed by Naïve Bayes in the GreenGenes database (version 13.8) with a confidence threshold of 0.8.

[0062] Experimental results: Venn diagrams showed that the treatment and control groups shared the core microbiota, but differed only in their specific microbiota, suggesting that chrysanthemum polysaccharides exert their effects through specific microbiota rather than by comprehensively remodeling the microbiota. Figure 3 A). PCoA and NMDs analysis showed that high doses of chrysanthemum polysaccharide significantly altered the gut microbiota structure in high-fat diet-induced mice, indicating that its regulatory effect was statistically significant. Figure 3B, C). At the phylum level, Firmicutes and Bacteroides are the most common bacterial phyla in mice, and changes in their abundance and the Firmicutes / Bacteroidota (F / B) ratio are commonly used indicators for measuring gut microbiota dysbiosis in mice. Figure 3 (D) Compared to the NC group, the HFD modeling group showed a decrease in the abundance of Bacteroides and an increase in the abundance of Firmicutes, as well as an increase in the F / B ratio, indicating that HFD modeling disrupts the gut microbiota in mice. The F / B ratio in the intervention groups showed a significant decrease, with the FCPH and FCPM groups showing the best recovery, closest to the NC group. Figure 3 D). At the family level, compared to the NC group, the abundance levels of *Desulfovibrionaceae*, *Sutterellaceae*, and *Lachnospiraceae* were significantly increased in the HFD model group. The abundance of *Prevotellaceae*, *Muribaculaceae*, and *Helicobacteraceae* was significantly decreased. Under FCP intervention, the abundance levels of *Prevotellaceae* and *Muribaculaceae* recovered somewhat, with the FCPH group showing the best recovery effect. Compared to the HFD group, the abundance of the harmful bacteria families *Desulfovibrionaceae* and *Sutterellaceae* was reduced. Therefore, in terms of species differences at the family level, FCP intervention mitigated the impact of HFD modeling on enterobacteria. Figure 3E). At the genus level, compared to the NC group, the HFD group significantly increased the abundance levels of unidentified Clostridia, Parasutterella, and Mucispirillum. It significantly decreased the abundance levels of Alloprevotella, Helicobacter, and Muribaculum. FCP intervention restored the abundance levels of key beneficial bacteria Alloprevotella and Muribaculum, and reduced the abundance levels of potentially harmful bacteria unidentified Clostridia and Parasutterella. It also upregulated the abundance of Helicobacter. The high-dose intervention in the FCPH group showed the most significant restorative effect. Figure 3 F). To screen for bacterial genera characteristically regulated by FCP and clarify the microbial regulatory role of FCP, this experiment used LEfSe analysis. LEfSe analysis can screen for biomarkers with abundance at different levels across multiple groups. Bacteroides, Erysipelatoclostridium, Prevotella, unidentified Clostridia, and Helicobacter were identified as key bacteria. FCP intervention improved the relative abundance increase of Erysipelatoclostridium and unidentified Clostridia induced by HFD modeling and increased the relative abundance of beneficial bacteria Bacteroides, Prevotella, and Helicobacter. Figure 3 G). These findings suggest that FCP can improve HFD-induced gut microbiota dysbiosis in mice.

[0063] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for preparing chrysanthemum polysaccharide, characterized in that, Includes the following steps: Dry the chrysanthemum flower heads; The dried chrysanthemum flower heads were decolorized using an ethanol solution with a volume concentration of not less than 90%. After the decolorized flower heads are dried, they are boiled in water to extract the extract. Ethanol was added to the extract to adjust the volume concentration of ethanol in the solution to 78-82%, and alcohol precipitation was performed to obtain alcohol precipitate. Remove the protein from the alcohol precipitate to obtain the final product.

2. The preparation method according to claim 1, characterized in that, The volume concentration of the ethanol solution used in the decolorization treatment is 90-100%.

3. The preparation method according to claim 1, characterized in that, The decolorization process involves reflux under reduced pressure at a temperature of 70-90℃.

4. The preparation method according to claim 1, characterized in that, The flower heads are dried naturally in the shade after bleaching.

5. The preparation method according to claim 1, characterized in that, The extraction process involves reflux extraction at a temperature of 90~100℃. Alternatively, during the extraction process, the material-to-liquid ratio is 1:5~10, kg / L.

6. The preparation method according to claim 1, characterized in that, The alcohol precipitation treatment time is 10-40 hours.

7. The preparation method according to claim 1, characterized in that, The method for removing proteins from alcohol precipitation is the Sevage method.

8. A chrysanthemum polysaccharide, obtained by the preparation method according to any one of claims 1 to 7.

9. The use of the chrysanthemum polysaccharide according to claim 8 in the preparation of a drug for treating non-alcoholic fatty liver disease.

10. The use of the chrysanthemum polysaccharide according to claim 8 in the preparation of dietary supplements.

Images