Pichia kudriavzevii and uses thereof

By screening and optimizing the application of Pichia pastoris LJ-5, the problem of unstable ethyl acetate formation in baijiu was solved, achieving efficient and stable ethyl acetate formation and flavor enhancement, thus improving the quality of baijiu.

CN122326409APending Publication Date: 2026-07-03LUZHOU LAOJIAO CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610752510.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-28
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

In existing technologies, the formation of ethyl acetate in baijiu depends on complex microbial communities, which are easily affected by environmental fluctuations, resulting in unstable yields. Furthermore, traditional solid-state fermentation has a long cycle, making it difficult to achieve efficient and stable ethyl acetate formation. At the same time, it may produce undesirable byproducts, affecting the purity of the baijiu's flavor.

Method used

A strain of Pichia kudriavzevii LJ-5 was used in the brewing of baijiu (Chinese liquor) through screening, molecular biological identification, and optimization of its culture conditions. This process increased the ethyl acetate content and promoted harmonious coexistence with other microorganisms, thus avoiding the generation of negative flavor substances.

Benefits of technology

It significantly increases the ethyl acetate content in baijiu, improves flavor quality, increases the concentration of ester compounds, reduces undesirable flavor substances, and enhances the overall flavor and stability of baijiu.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122326409A_ABST
    Figure CN122326409A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial fermentation technology, specifically relating to a new strain of Pichia pastoris (Kudelazwiel). Pichia Kudryavzevii ) and its applications. To stabilize and target the production of ethyl acetate in baijiu (Chinese liquor), this invention screens, isolates, and identifies a strain of *Pichia pastoris* capable of high ethyl acetate production from soy sauce-flavored baijiu mash. Pichia kudriavzevii LJ-5, with accession number CCTCC NO:M20252599, is a strain that enhances the fermentation of lees. In baijiu brewing, it can be used to produce ethyl acetate, ethyl lactate, and other flavor compounds, especially significantly increasing the content of ethyl acetate produced during fermentation. Therefore, this strain can be applied to baijiu production as a functional microbial strain to improve baijiu quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a new strain of Pichia pastoris (Kudelazwiel). Pichia kudriavzevii Application of microbial agents and fermentation broth in enhancing ethyl acetate in Baijiu. Background Technology

[0002] Baijiu, a traditional Chinese distilled spirit, owes its core value to its unique flavor and aroma. Among the many flavor components of baijiu, esters, especially ethyl acetate, play a crucial role. Ethyl acetate possesses a pleasant fruity aroma (such as apple and banana) and is a key component in the main aroma (cellar aroma) of baijiu, especially soy sauce-flavored baijiu. Its content and its harmony with other flavor substances directly determine the intensity, purity, and style characteristics of the baijiu's aroma, significantly impacting its quality grade and market acceptance. *Pichia pastoris* (Kudela's yeast) Pichia kudriavzevii Former name Issatchenkia orientalis *Bacillus subtilis* is a common non-brewing yeast in baijiu (Chinese liquor) brewing environments, and has recently attracted attention due to its potential in producing organic acids and esters. However, this species exhibits rich strain specificity, with significant differences in the metabolite profiles among different strains. Existing known strains often have limited functions, limited ester production capabilities, or are associated with the main fermenting yeast in baijiu brewing (such as...). Saccharomyces cerevisiae Problems such as poor synergy make it difficult to stably and efficiently increase the content of the target product, ethyl acetate, in actual production.

[0003] Currently, the formation of ethyl acetate in baijiu (Chinese liquor) mainly relies on microbial fermentation during the brewing process. Traditional processes primarily depend on the synergistic action of the natural microbial community (including molds, yeasts, and bacteria) in the mash. However, in existing processes, the composition of the natural microbial community is complex and easily affected by fluctuations in the environment (temperature, humidity, acidity, raw material batches, etc.) and process parameters (fermentation conditions, fermentation cycle, etc.), resulting in significant variations in ethyl acetate production across different batches, different fermentation pits, and even different locations within the same fermentation pit, making it difficult to achieve stable and controllable high yields. While producing ethyl acetate, the complex microbial community may also generate other undesirable esters (such as imbalanced proportions of ethyl lactate and ethyl hexanoate) or byproducts such as fusel oils, aldehydes, and acids, affecting the purity and typicality of the liquor's flavor. Furthermore, the long traditional solid-state fermentation cycle and slow microbial growth and metabolism limit the efficient formation of ethyl acetate. To overcome the shortcomings of traditional methods, the modern baijiu industry has begun to explore the application of pure-culture microbial enhanced fermentation technology. By adding selected pure-culture microorganisms (functional bacteria) with specific desirable traits to the fermentation mash, the aim is to directionally regulate the fermentation process and improve the yield and stability of target flavor compounds. In the area of ​​ester-producing yeasts, research has largely focused on ester-producing yeasts, and some positive results have been achieved.

[0004] Therefore, there is an urgent need in this field to screen and obtain a specific Pichia pastoris strain with unique and efficient ester production capabilities. This strain can not only significantly increase the ethyl acetate content in Maotai-flavor liquor, but also adapt to the liquor brewing environment, coexist harmoniously with other microorganisms in the system, and not produce negative flavor substances, thus providing strong microbial resources and technical support for the development of high-quality, high-value-added liquor products. Summary of the Invention

[0005] To stabilize and target the production of ethyl acetate in baijiu (Chinese liquor), this invention provides a strain of Pichia pastoris (Kudela spp.). Pichia kudriavzevii LJ-5 can effectively increase the ethyl acetate content in baijiu and enhance its overall flavor.

[0006] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: In a first aspect, this invention provides a strain of *Pichia pastoris* LJ-5, with accession number CCTCC NO: M20252599. It was deposited on November 20, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China, and classified as follows: Pichia kudriavzevii LJ-5 .

[0007] In some embodiments, the colony characteristics and biochemical properties of the Pichia pastoris LJ-5 are as follows: on solid YPD medium, the colonies are milky white, round, smooth, opaque, moist inside and easy to pick up.

[0008] In some embodiments, the ITS sequence of the Pichia pastoris LJ-5 is shown in SEQ ID NO:1.

[0009] SEQ ID NO:1 AGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGG CATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAG In some embodiments, the cultivation method of Pichia kudriezwiye LJ-5 includes: inoculating Pichia kudriezwiye LJ-5 into YPD liquid medium, shaking well, and culturing at 25-30°C and 100-200 r / min for 3-5 days.

[0010] Secondly, the present invention provides a microbial inoculant containing the aforementioned Pichia pastoris LJ-5.

[0011] In some embodiments, the concentration of Pichia pastoris LJ-5 in the microbial inoculum is 10. 8 ~10 9 CFU / mL.

[0012] In some implementations, the microbial agent can be a liquid microbial agent, a solid microbial agent, or a compound microbial agent. The form of the agent includes, but is not limited to, powder, solution, suspension, or emulsion.

[0013] The aforementioned microbial agents may also contain carriers or excipients, and those skilled in the art can select conventional carriers or excipients according to actual needs.

[0014] Thirdly, the present invention provides a microbial fermentation broth containing the aforementioned Pichia pastoris LJ-5.

[0015] Fourthly, the present invention provides the application of the above-mentioned Pichia pastoris LJ-5, microbial inoculants or fermentation broth in the brewing of baijiu or the preparation of mash.

[0016] In some embodiments, the liquor is selected from at least one of the following: soy sauce aroma type, light aroma type, or strong aroma type.

[0017] Fifthly, the present invention provides the application of the above-mentioned Pichia pastoris LJ-5, microbial inoculants or fermentation broth in increasing the content of ethyl acetate, ethyl butyrate, ethyl hexanoate and / or ethyl lactate in baijiu.

[0018] In a sixth aspect, the present invention provides a method for brewing baijiu (Chinese white liquor) using the above-mentioned Pichia kudriezwiye LJ-5 or microbial inoculant, comprising the following steps: mixing baijiu mash with the above-mentioned Pichia kudriezwiye LJ-5 or microbial inoculant, and then carrying out sealed anaerobic fermentation.

[0019] In some implementation schemes, the concentration of Pichia pastoris LJ-5 in the fermentation system is 10. 6 ~10 7 CFU / g.

[0020] In some embodiments, the microbial agent is added to the fermentation system at a mass of 1–5 v / w.

[0021] In some implementation schemes, the anaerobic fermentation temperature is 25–35°C.

[0022] In some implementation schemes, the anaerobic fermentation time is 20–35 days.

[0023] Beneficial effects: This invention screened, isolated, and identified a strain of Pichia kudriezwiye capable of producing high levels of ethyl acetate from soy sauce-flavored liquor mash. Pichia kudriavzevii LJ-5, with accession number CCTCC NO:M20252599, is a strain that enhances the fermentation of baijiu (Chinese liquor). In baijiu brewing, it can be used to produce ethyl acetate, ethyl lactate, and other flavor compounds, with the ethyl acetate content reaching up to 206.27 mg / L. When used for enhanced fermentation in baijiu, the ethyl acetate content in the fermented baijiu inoculated with 3% bacterial solution reached 14.65 μg / g. Therefore, this strain can be applied as a functional microbial strain to improve the quality of baijiu in its production. Attached Figure Description

[0024] Figure 1 The images show the colony morphology of Pichia pastoris LJ-5 on YPD solid medium, cell morphology under an optical microscope, and cell morphology under a scanning electron microscope (SEM) in Example 1 of this invention. Figure 2 This is a phylogenetic tree analysis result of Pichia pastoris LJ-5 in Example 1 of the present invention; Figure 3 The graph shows the results of determining the content of the four major esters in the fermented mash of Pichia pastoris LJ-5, which was screened in Example 3 of this invention.

[0025] The present invention is based on Pichia pastoris (Kudelazwield's Pichia pastoris). Pichia kudriavzevii LJ-5 Preservation Information: Pichia pastoris LJ-5, with accession number CCTCC NO: M20252599, was deposited on November 20, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. Its classification and naming are as follows: Pichia kudriavzevii . Detailed Implementation

[0026] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.

[0027] In this document, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”).

[0028] In this document, “and / or” means and includes any and all possible combinations of one or more of the associated listed items. For example, “the composition contains A and / or B” can be interpreted as the composition contains A, the composition contains B, or the composition contains both A and B.

[0029] Pichia kudriozwij ( Pichia kudriavzevii LJ-5 This paper describes the screening of an ester-producing yeast with yeast morphological characteristics from a soy sauce-flavored fermented mash using an ester-producing screening medium. Molecular biological identification was performed, and a phylogenetic tree was constructed based on the ITS sequence and the Neighbor-Joining method. The strain was ultimately identified as a novel *Pichia pastoris* strain. Its colony characteristics and biochemical properties are as follows: on solid YPD medium, the colonies are milky white, round, smooth, opaque, moist inside, and easily picked up. The ITS sequence is shown in SEQ ID NO:1.

[0030] In some examples, the esterification screening medium used was esterase screening medium (v / v) containing 0.3% yeast extract, 0.5% peptone, 2% agar, 0.1% tribocyl glycerol, pH 6.0, and sterilized by moist heat at 121 °C for 20 min.

[0031] Microbial agents This article also provides a microbial inoculant, which mainly contains the Pichia pastoris LJ-5 disclosed herein.

[0032] In some examples, to maximize the functional effects of Pichia kudriezweig while avoiding excessively high concentrations that could pose safety risks, the concentration of Pichia kudriezweig LJ-5 in the microbial inoculant was 10. 8 ~10 9 CFU / mL.

[0033] In some examples, the microbial agent can be a liquid microbial agent, a solid microbial agent, or a compound microbial agent. The form of the agent includes, but is not limited to, powder, solution, suspension, or emulsion. It may also contain a carrier or excipients, which can be selected by those skilled in the art according to actual needs.

[0034] Microbial fermentation broth The Pichia pastoris LJ-5 described in this article can also be prepared into a microbial fermentation broth for use in the fermentation of baijiu, wine mash, or other foods.

[0035] The Pichia pastoris LJ-5 and its microbial agents and fermentation broth disclosed in this article can also be used in the brewing of baijiu or the preparation of mash to increase the content of ethyl acetate, ethyl butyrate, ethyl hexanoate and / or ethyl lactate in baijiu.

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. The advantages and features of this invention will become clearer with this description. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions were performed under conventional conditions in the art or as recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following embodiments are commercially available.

[0037] The culture medium components used in the following examples are as follows: Esterase screening medium (v / v): 0.3% yeast extract, 0.5% peptone, 2% agar, 0.1% tribocyl glycerol, pH 6.0, sterilized by moist heat at 121 ℃ for 20 min.

[0038] YPD (Yeast extract, Peptone, Dextrose) solid medium (v / v): 2% peptone, 1% glucose, 2% yeast extract, 2% agar, sterilized by moist heat at 121°C for 20 min.

[0039] YPD liquid medium (v / v): The difference between YPD liquid medium and YPD solid medium is that it does not contain agar.

[0040] Example 1: Screening, isolation and identification of Pichia pastoris LJ-5 (1) Crush the fermented mash for making soy sauce-flavored liquor, weigh 5 g of the mash sample, add it to an Erlenmeyer flask containing glass beads and 95 mL of sterile water, shake at 150 r / min for 30 min, and mix thoroughly. Take a dilution of 10... -3 10 -4 10 -5 10 -6 100 μL of each bacterial suspension was spread onto esterase selection medium; colonies producing large clear zones in the esterase selection medium were streaked onto YPD solid medium. All media were incubated upside down in a 30℃ incubator, with three replicates and one control group for each gradient. Colony growth was observed in the media. If enrichment was required, the activated medium was incubated on a shaker at 30℃ for 12 h before dilution and spreading. Once single colonies appeared on the surface of the media, typical yeast colonies were selected based on their color, transparency, diameter, thickness, and growth rate, and examined under a microscope to determine if they were pure cultures.

[0041] (2) Pick the target colonies into sterile water to prepare a bacterial suspension, ensuring that the bacterial concentration is 10. 7 Inoculate YPD liquid medium with a concentration of 1 / mL of mycelium at a rate of 3 v / v%, shake well, and incubate at 30 °C and 200 r / min for 3 days. Pour the product obtained from the solid medium into a sterile kraft paper bag and dry it at 40 °C for 24 h in a ventilated environment to obtain mycelial powder.

[0042] (3) The ester-producing yeasts with yeast morphological characteristics obtained by screening were subjected to molecular biological identification, and a phylogenetic tree was constructed based on ITS sequence and Neighbor-Joining method. The results are as follows: Figure 1 and 2 As shown.

[0043] Figure 1 a represents the colony morphology of Pichia pastoris LJ-5 obtained by screening in this invention on YPD solid medium. Figure 1 b shows the cell morphology under an optical microscope. Figure 1c shows the cell morphology under a scanning electron microscope (SEM). The colonies on YPD solid medium are milky white, round, smooth, opaque, moist inside, and easily picked up.

[0044] Phylogenetic tree reference Figure 2 As shown, the identification results indicate that the screened yeast strain is... Pichia kudriavzevii and named it Pichia kudriavzevii LJ-5, ITS sequence is shown in SEQ ID NO:1.

[0045] The screened and identified Pichia pastoris LJ-5 was deposited on November 20, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. Its accession number is CCTCC NO: M20252599, and its classification name is... Pichia kudriavzevii .

[0046] Example 2: Optimization of ester production conditions and ester production capacity testing of Pichia pastoris LJ-5 YPD liquid medium was used, with the sugar concentration adjusted to 8 Brix° and pH to 6.0. OD was inoculated at a rate of 3 v / v%. 600 The bacterial culture was prepared at a concentration of 1.2 and cultured at 30 °C and 200 rpm for 24 h. Different concentrations of ethanol and acetic acid were added, and the culture was continued for another 4 days. After the culture was completed, the fermentation broth was mixed with the extraction agent n-heptane at a volume ratio of 1:1 for extraction. After extraction, the supernatant was used to determine the ethyl acetate content in the fermentation broth using GC-FID.

[0047] Based on this method, the amounts of ethanol and acetic acid added, the culture time, the amount of bacterial culture added, the ethanol addition time, and the hexanoic acid addition time were optimized. The optimized fermentation conditions were: shake flask culture with an inoculum of 5% (v / v) at a rotation speed of 200 r / min. At 24 h of fermentation, 5% (v / v) ethanol and 0.05% (v / v) acetic acid were added, and the culture was continued statically for another 48 h. The highest ethyl acetate yield was obtained after optimization, with a yield of 206.27 mg / L.

[0048] Example 3: Application of Pichia pastoris LJ-5 in simulated brewing to enhance fermentation (1) Take 400 g of fermented mash and add 0% and 3% (v / w) of the mash into the pit respectively. Pichia kudriavzevii LJ-5 bacterial solution was mixed with the fermented mash and the bacterial solution, then placed in a sealed tank for anaerobic fermentation for 30 days. A blank control group was set up with the same mass of sterile water but without the bacterial solution powder. Pichia kudriavzevii The concentration of LJ-5 bacterial culture in the fermentation system was 10.6 ~10 7 CFU / g.

[0049] (2) The content of flavor substances in the mash was determined by using headspace solid phase microextraction technology, which is conventional in this field.

[0050] Figure 3 The content of the four major esters in baijiu (Chinese liquor) fermentation mash was determined. The ethyl acetate content in ordinary fermented mash was 2.99 μg / g, while the ethyl acetate content in fermented mash inoculated with 3% bacterial solution reached 14.65 μg / g, showing a significant increase. The results indicate that the present invention... Pichia kudriavzevii LJ-5 has the ability to increase the content of ester compounds, especially ethyl acetate, in fermented grains, thereby enhancing the flavor quality of the fermented grains by increasing the concentration of ester compounds in them.

[0051] Tables 1 and 2 show the content of other typical flavor compounds in the fermented mash. Among other esters, the fermented mash inoculated with 3% bacterial solution showed varying degrees of change compared to ordinary fermented mash. The content of isoamyl acetate increased significantly from 28.8 μg / 100g to 235.2 μg / 100g. Several acids decreased to varying degrees, while alcohols increased to varying degrees, with isobutanol, 3-methyl-1-butanol, and phenylethanol increasing by 76%, 80%, and 34%, respectively. The results indicate that the present invention… Pichia kudriavzevii LJ-5 has varying degrees of influence on other typical esters, acids, aldehydes, alcohols, and other flavor compounds in fermented grains. The main effects are an increase in fruity and floral esters and alcohols, and a significant reduction in pungent sourness and unpleasant rancid odors, indicating that this strain can improve the flavor quality of fermented grains.

[0052] Table 1. Flavor Compounds (Esters), with flavor compound content in μg / 100g fermented mash.

[0053] Table 2 Flavor Compounds (Non-esters), the units for flavor compound content in the table are all μg / 100g fermented mash.

[0054] The above description is merely an exemplary embodiment of the present invention. It should be noted that those skilled in the art can make improvements to the present invention without departing from the inventive concept, and all such improvements fall within the scope of protection of the present invention.

Claims

1. Pichia pastoris kudriazwiel ( Pichia kudriavzevii LJ-5, characterized in that, The accession number is CCTCC NO: M20252599.

2. A microbial inoculant, characterized in that, It contains Pichia kudricazwiel LJ-5 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The concentration of the Kudriavzevii Pichia pastoris LJ-5 in the microbial inoculant is 10 8 ~ 10 9 CFU / mL.

4. A microbial fermentation broth, characterized in that, It contains Pichia kudricazwiel LJ-5 as described in claim 1.

5. The application of Pichia pastoris LJ-5 as described in claim 1, the microbial agent as described in claim 2, or the microbial fermentation broth as described in claim 4 in the brewing of baijiu or the preparation of fermented mash.

6. The application according to claim 5, characterized in that, The baijiu is selected from at least one of the following: soy sauce aroma type, light aroma type, or strong aroma type.

7. The application of Pichia pastoris LJ-5 as described in claim 1, the microbial agent as described in claim 2, or the microbial fermentation broth as described in claim 4 in increasing the content of ethyl acetate, ethyl butyrate, ethyl hexanoate, and / or ethyl lactate in baijiu.

8. A method for brewing baijiu (Chinese white liquor), characterized in that, Includes the following steps: Mix the baijiu mash with the Pichia pastoris LJ-5 as described in claim 1 or the microbial agent as described in claim 2, and then carry out sealed anaerobic fermentation.

9. The method for brewing baijiu according to claim 8, characterized in that, The concentration of the Kudriavzevii Pichia pastoris LJ-5 in the fermentation system is 10 6 ~ 10 7 CFU / g.

10. The method for brewing baijiu according to claim 8, characterized in that, The microbial agent is added to the fermentation system at a mass of 1–5 v / w.