A method for increasing the production of salmonella outer membrane vesicles

Abstract

A method for increasing Salmonella outer membrane vesicle production includes the following steps: constructing knockout... tolR Recombinant Salmonella strains containing genes from wild-type Salmonella enterica SDC-11 tolR Obtained after gene knockout; will knockout tolR Recombinant Salmonella strains containing the gene were cultured in LB medium supplemented with glycine at 30–39°C for 2–24 h, and then outer membrane vesicles were collected. This invention constructs a knockout... tolR Salmonella strain sdc-11Δ tolR The OMV production was increased by 1.6 times. Based on this, the culture conditions of the strain were optimized by adding glycine to the culture medium, which further increased the OMV production by 8.8 times, confirming that culturing at 37℃ for 18 h was the optimal production condition. Compared with the wild-type strain sdc-11, the shape and particle size of the OMVs secreted by the recombinant strain under the above conditions were not significantly different.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for increasing the production of Salmonella outer membrane vesicles. Background Technology

[0002] Salmonella is a Gram-negative, facultative anaerobic bacillus with rounded ends, short rod-shaped, and motile via flagella. It has over 2600 serotypes, with *Salmonella enterica* serovar Enteritidis (SE) being one of the most common. SE can invade the digestive system of animals, causing morbidity and even death, resulting in significant economic losses to livestock. It can also infect humans, causing food poisoning and harming human health. Therefore, SE is of great importance in animal health and public safety.

[0003] Vaccines are currently one of the most effective means of controlling salmonellosis. Compared to antibiotics, vaccines not only prevent and control the spread of the disease at its source but also avoid the risks of drug residues and bacterial resistance. Salmonellosis vaccine development presents a parallel landscape of traditional and modern approaches. In terms of traditional vaccines, live attenuated vaccines and inactivated vaccines still dominate: live attenuated vaccines can effectively induce cellular and humoral immunity, but there is a potential risk of virulence reversion; inactivated vaccines have higher safety, but usually require injection immunization, making it difficult to elicit an ideal mucosal immune response, and cross-protection between different serotypes is limited. To address these limitations, modern vaccines have become a research hotspot, with novel candidate vaccines based on bacterial outer membrane vesicles (OMVs) attracting significant attention.

[0004] OMVs are nanoscale (20-200 nm) spherical phospholipid bilayer vesicles secreted by Gram-negative bacteria. They naturally carry various immunogenic components such as outer membrane proteins and lipopolysaccharides, exhibiting both excellent immunogenicity and adjuvant effects. Furthermore, they can be genetically engineered to display exogenous antigens on their surface, demonstrating unique advantages in inducing mucosal immunity and achieving broad-spectrum protection. Although OMVs have promising applications, the yield of natural OMVs is low. Increasing their production is a key technical challenge that must be addressed to develop and industrialize vaccines based on OMVs. Summary of the Invention

[0005] Technical problem to be solved: In view of the problems existing in the prior art, the present invention proposes a method to increase the production of Salmonella outer membrane vesicles, which can significantly increase the production of OMVs.

[0006] Technical solution: A method for increasing the production of Salmonella outer membrane vesicles, comprising the following steps:

[0007] Step 1: Construct a recombinant Salmonella strain with the tolR gene knocked out. The tolR gene was knocked out from wild-type Salmonella enterica sdc-11. The sequence of the knocked-out tolR gene is shown in SEQ ID NO.1.

[0008] Step 2: Incubate the Salmonella recombinant strain with the tolR gene knocked out in LB medium supplemented with 0.75-1.25% (w / v) glycine at 30-39℃ for 2-24 h, and then collect the outer membrane vesicles.

[0009] Preferably, in step one, the knocked-out tolR gene is replaced with sacB-cm, and then the fragment is eliminated using Red recombination technology. The sequence of sacB-cm is shown in SEQ ID NO.2.

[0010] Preferably, in step one, the tolR gene is knocked out using Red recombination technology. Specifically, the homologous recombination fragment sacB-cm, which has upstream and downstream homologous arms of the tolR gene at both ends and contains the fructan sucrase gene sacB and the chloramphenicol resistance gene in the middle, is introduced into Salmonella sdc-11 for homologous recombination. The tolR gene on the Salmonella sdc-11 chromosome is replaced with the sacB-cm fragment, and then the fragment is eliminated using Red recombination technology to obtain Salmonella recombinant strain with the tolR gene knocked out.

[0011] Preferably, the method of eliminating the fragment using the Red recombination technology specifically involves: using the whole genome of wild-type Salmonella enteritidis sdc-11 as a template, amplifying the upstream / downstream fragments of the tolR gene, with the forward primer sequence for amplifying the upstream fragment shown in SEQ ID NO.7 and the reverse primer sequence shown in SEQ ID NO.9, and the forward primer sequence for amplifying the downstream fragment shown in SEQ ID NO.8 and the reverse primer sequence shown in SEQ ID NO.10; fusing the upstream / downstream fragments of the tolR gene, with the forward primer sequence used for fusion shown in SEQ ID NO.7 and the reverse primer sequence shown in SEQ ID NO.10; introducing the fused fragment into Salmonella containing the sacB-cm fragment for homologous recombination to eliminate the sacB-cm gene on the Salmonella sdc-11 chromosome.

[0012] Preferably, in step two, the culture is carried out at 37°C for 18 hours.

[0013] Preferably, 1.25% (w / v) glycine is added in step two.

[0014] Preferably, the composition of the LB medium after adding 1.25% (w / v) glycine is as follows: 10 g tryptone, 5 g yeast extract, 10 g NaCl, and deionized water to a final volume of 1 L. After autoclaving at 121°C for 20 min, 200 mL of LB medium is used to dissolve 12.5 g of glycine. The glycine solution is then sterilized by 0.22 μm filtration and returned to the remaining 800 mL of LB medium.

[0015] Preferably, the collection of outer membrane vesicles is carried out as follows: the culture is centrifuged at 4°C and 8000 × g for 10 min to collect the supernatant. The supernatant is filtered through a 0.22 μm filter membrane for sterilization. The filtrate is concentrated through a 100 kDa ultrafiltration membrane. The concentrate is centrifuged at 4°C and 180,000 × g for 2 h, and the supernatant is discarded. The precipitate is resuspended in 0.2-5 mL of PBS buffer and centrifuged again at 4°C and 180,000 × g for 2 h. The supernatant is discarded, and the precipitate is resuspended in 5 mL of PBS buffer to obtain the purified OMVs product.

[0016] Beneficial Effects: This invention provides a method for increasing the production of Salmonella outer membrane vesicles. By constructing a Salmonella strain sdc-11ΔtolR with the tolR gene knocked out, the production of OMVs was increased by 1.6 times. Based on this, the culture conditions of the sdc-11ΔtolR strain were optimized by adding 1.25% (w / v) glycine to its culture medium, further increasing the OMV production by 8.8 times. It was confirmed that culturing at 37℃ for 18 h was the optimal production condition. Compared with the wild-type strain sdc-11, under the above conditions, the shape and particle size of the OMVs secreted by the recombinant strain sdc-11ΔtolR were not significantly different from those secreted by the wild-type strain sdc-11.

[0017] The technical solution of this invention can be applied to basic research related to Salmonella outer membrane vesicles, including multi-omics research on Salmonella OMVs (proteomics, lipidomics, metabolomics, etc.), research on potential biological functions (pathogenicity, signal transduction, quorum sensing, stress response, etc.), and application in the preparation of formulations using Salmonella OMVs as carriers (drug delivery, antigen targeting, regulation of immune response, etc.). Attached Figure Description

[0018] Figure 1 : Colony PCR verification results of recombinant strain sdc-11ΔtolR, where lanes “M”, “1”, and “2” represent DL2000, sdc-11ΔtolR, and wild-type sdc-11 strain, respectively.

[0019] Figure 2In vitro growth curves of wild-type strain sdc-11 and recombinant strain sdc-11ΔtolR;

[0020] Figure 3 Comparison of OMVs secreted by wild-type strain sdc-11 and recombinant strain sdc-11ΔtolR;

[0021] Figure 4 Comparison of OMVs secreted by wild-type strain sdc-11, recombinant strain sdc-11ΔtolR, sdc-11 supplemented with 1.25% (w / v) glycine, and sdc-11ΔtolR.

[0022] Figure 5 Comparative study of the effects of polymyxin B on the production of OMVs secreted by wild-type strain sdc-11.

[0023] Figure 6 Comparative study of the effects of EDTA on the production of OMVs secreted by wild-type sdc-11 strain;

[0024] Figure 7 Comparative study of the effects of ethanol on the production of OMVs secreted by wild-type sdc-11.

[0025] Figure 8 Comparative study of the effects of H2O2 on the production of OMVs secreted by wild-type sdc-11 strain;

[0026] Figure 9 Comparative study of the effects of NaCl on the production of OMVs secreted by wild-type sdc-11.

[0027] Figure 10 Comparative study of the effects of glycine on the production of OMVs secreted by wild-type strain SDC-11.

[0028] Figure 11 Protein concentrations of OMVs secreted by wild-type strain SDC-11 at 28℃, 30℃, 37℃, and 39℃.

[0029] Figure 12 Protein concentration of OMVs secreted by wild-type sdc-11 strain cultured at 37℃ for 2–24 h;

[0030] Figure 13 Transcriptional levels of IL-1β (a) and TNF-α (b) in mouse macrophages RAW264.7 cells stimulated by OMVs secreted by wild-type sdc-11, recombinant strain sdc-11ΔtolR, and sdc-11ΔtolR supplemented with 1.25% (w / v) glycine.

[0031] Figure 14Transmission electron microscopy images of OMVs secreted by wild-type strain sdc-11 and recombinant strain sdc-11ΔtolR supplemented with 1.25% (w / v) glycine, used to observe the morphology of OMVs, where a is OMVs secreted by wild-type strain sdc-11; b is OMVs secreted by recombinant strain sdc-11ΔtolR.

[0032] Figure 15 Nanoparticle tracking analysis (NTA) results of OMVs secreted by wild-type strain sdc-11 and recombinant strain sdc-11ΔtolR supplemented with 1.25% (w / v) glycine were used to characterize the particle size distribution of OMVs, where a represents OMVs secreted by wild-type strain sdc-11 and b represents OMVs secreted by recombinant strain sdc-11ΔtolR. Detailed Implementation

[0033] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. In the embodiments of the present invention, if specific conditions are not explicitly stated in the experimental methods, conventional experimental operating procedures are generally followed, or standard experimental conditions recommended by the instrument and equipment manufacturer are adopted. Furthermore, unless otherwise defined, the professional terms and scientific expressions appearing in this document are consistent with the concepts commonly understood by those skilled in the art.

[0034] Unless otherwise specified, all raw materials used in the embodiments of this specification are from commercially available products, including:

[0035] The LB liquid culture medium consisted of: 10 g tryptone, 5 g yeast extract, 10 g NaCl, and deionized water to a final volume of 1 L. The medium was then autoclaved at 121°C for 20 min.

[0036] DMEM culture medium was purchased from Gibco.

[0037] Example 1: Construction of a Salmonella strain with a high OMV production rate and the tolR gene deletion

[0038] (1) Experimental steps:

[0039] Salmonella sdc-11 strain (a laboratory-preserved strain, which has been described in the following non-patent literature: Li Gang, Dong Yuhao, Huang Hao, et al. Isolation, identification and biological characteristics analysis of Salmonella phage YT90 [J]. Journal of Nanjing Agricultural University, 2024, 47(02):306-314., which can be obtained from the Dong Yuhao research group of Nanjing Agricultural University) was selected to construct a high-yield OMVs strain.

[0040] First, the candidate strains were prepared into competent cells. The overnight cultured strains were transferred 1:100 to 40 mL of fresh LB liquid medium, and ampicillin was added at a 1:1000 (v / v) concentration. The cells were then cultured at 37°C with shaking at 180 r / min until OD (occurrence limit) was reached. 600 The concentration should reach 0.6-0.8. In a clean bench, transfer the bacterial suspension to pre-chilled 50 mL sterile centrifuge tubes and place them on ice for 30 min to stop bacterial growth. After the ice bath, centrifuge at 4°C, 5,000×g for 10 min, carefully discard the supernatant, and collect the bacterial pellet. Add 10 mL of pre-chilled sterile deionized water to the centrifuge tube and gently resuspend the bacterial pellet by pipetting, being careful to avoid generating air bubbles. Centrifuge at 4°C, 5,000×g for 15 min and carefully discard the supernatant. Repeat this step twice. Add 1-2 mL of pre-chilled 15 wt% glycerol solution (adjust the volume according to the amount of pellet) to the washed bacterial pellet and gently resuspend the bacterial cells by pipetting to fully disperse the cells, thus obtaining a competent cell suspension. Aliquot the prepared competent cells into pre-chilled sterile microcentrifuge tubes, 100 μL per tube, on ice.

[0041] Add 1 μL of the temperature-sensitive plasmid pKD46 (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) expressing the Red system recombinase to a centrifuge tube containing a suspension of competent Salmonella sdc-11 cells. Transfer the suspension to the bottom of a pre-chilled electroporation cuvette. Adjust the electroporator voltage to 2500 V, resistance to 500 Ω, and capacitance to 25 μF. Immediately after electroporation, add 1.0 mL of antibiotic-free LB liquid medium (10 g tryptone, 5 g yeast extract, 10 g NaCl, and deionized water to a final volume of 1 L, autoclaved at 121℃ for 20 min), mix well, and transfer to an EP tube. Incubate in a bacterial shaking incubator at 28℃ and 180 rpm for 2 h. After rejuvenation, centrifuge at 5000 rpm for 3 min, reserving 200 μL of supernatant and discarding the rest. Resuspend the cells and spread them on LB solid medium containing kanamycin (10 g tryptone, 5 g yeast extract, 10 g NaCl, and 15 μF agar powder). Add 1 mL of kanamycin to a solution of 1 g tryptone, 5 g yeast extract, 10 g NaCl, and 1 L deionized water, autoclaved at 121°C for 20 min, and then cooled to 40-50°C. Incubate at 28°C for approximately 24 h. Pick a single colony of Salmonella containing pKD46 and transfer it to a liquid medium containing kanamycin (10 g tryptone, 5 g yeast extract, 10 g NaCl, and 1 L deionized water, autoclaved at 121°C for 20 min, and then add 1:1000 (v / v) kanamycin). Incubate overnight at 28°C and 180 rpm. The next day, transfer the overnight culture to 20 mL LB liquid medium at a 1:100 (v / v) ratio and incubate at 28°C and 180 rpm until OD500.600 The concentration was set to 0.2-0.4, and then 20% L-arabinose was added at a ratio of 1:100 (v / v). The mixture was incubated at 28°C and 180 rpm for 2-4 h to allow the three recombinant genes on the plasmid to express Gam, Exo, and Beta proteins, thus fully utilizing their recombinant function. The bacterial culture was then used to prepare competent cells containing pKD46, following the same procedure as for Salmonella sdc-11 competent cells, for subsequent use.

[0042] Using plasmid pDS132 (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) as a template, the sacB-cm fragment (sequence shown in SEQ ID No. 2) containing upstream and downstream homologous arms of the tolR gene (sequence shown in SEQ ID No. 1) was amplified. The primer sequence sacB-cm-F was: aaaactgttcgcctgttactcgccgtctttcaagccaacgggacgcagactcacatatacctgccgttcac (SEQ ID No. 3), and the sacB-cm-R sequence was: gattctgcaccgccaggcgtttaccgtaagcgaaagcaacaaggggtaagcccgccccgccctgccactcat (SEQ ID No. 4). The PCR reaction system was: 2× TaqPCR Master Mix 25 µL (purchased from Nanjing Novizan Biotechnology Co., Ltd., containing Taq DNA polymerase, dNTPs, Mg...). 2+The reaction buffer consisted of 2.0 µL of forward primer (sacB-cm-F, 10 µM), 2.0 µL of reverse primer (sacB-cm-R, 10 µM), 4.0 µL of template plasmid, and sterile deionized water to a final volume of 50 µL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 30 cycles, and a final extension at 72℃ for 5 min. Take 10 μL of the sacB-cm fragment with the homologous arm and add it to the prepared competent cells containing pKD46. Electroporate with the same parameters, then immediately add 1.0 mL of LB medium, mix well and transfer to an EP tube. Incubate overnight at 28°C and 180 rpm. Spread the mixture onto LB solid medium containing chloramphenicol (10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar powder, deionized water to 1 L, autoclaved at 121°C for 20 min, and add 1 mL of chloramphenicol when cooled to 40-50°C) and incubate in a 28°C incubator for about 24 h. Several single colonies were selected and PCR was performed using primers test-F / R. Colonies in which the sacB-cm fragment was successfully exchanged into the genome were selected. Competent cells were prepared using the same method. The sequence of test-F was: TAACAAAGCATACTATGGCAA (SEQ ID No. 5), and the sequence of test-R was: GTGGCTCTAACTTATCCCAAT (SEQ ID No. 6). The PCR reaction system was: 2× Taq PCR Master Mix 7.5 µL (purchased from Nanjing Novizan Biotechnology Co., Ltd., containing Taq DNA polymerase, dNTPs, Mg...). 2+ The following reagents were prepared: reaction buffer, forward primer (test-F, 10 µM) 1.0 µL, reverse primer (test-R, 10 µM) 1.0 µL, template bacterial culture 1.0 µL, and sterile deionized water to a final volume of 15 µL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 minutes, 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 2 minutes, for a total of 30 cycles, and a final extension at 72℃ for 5 minutes.

[0043] Next, using the complete genome of sdc-11 (NCBI: PRJNA1110004, SRX24632796; due to the excessive length of the sdc-11 genome sequence, SEQ ID No. 13 shows the sequence containing the tolR gene and some upstream and downstream regions of the sdc-11 genome) as a template, fragments of approximately 500 bp upstream and downstream of the tolR gene (527 bp upstream and 603 bp downstream) were amplified. PCR reaction system: 2× Taq PCR Master Mix 25 µL (purchased from Nanjing Novizan Biotechnology Co., Ltd., containing Taq DNA polymerase, dNTPs, Mg...) 2+ The reaction buffer contained 2.0 µL of forward primer (upstream ttcggcctccgcttttttc (SEQ ID No. 7), 10 µM / downstream gacgcagactggcttaccccttgttgcttt (SEQ ID No. 8), 10 µM), 2.0 µL of reverse primer (upstream aagccaacgggacgcagactggcttacccc (SEQ ID No. 9), 10 µM / downstream ttatccagcgaacgcgtatt (SEQ ID No. 10), 10 µM), 4.0 µL of DNA template, and sterile deionized water to a final volume of 50 µL. The upstream and downstream fragments were recovered and then subjected to fusion PCR. The reaction system consisted of: 2× Taq PCR Master Mix 25 µL (purchased from Nanjing Novizan Biotechnology Co., Ltd., containing Taq DNA polymerase, dNTPs, Mg...). 2+The following reagents were prepared: reaction buffer, forward primer (sequence ttcggcctccgcttttttc (SEQ ID No. 7), 10 µM) 2.0 µL, reverse primer (sequence ttatccagcgaacgcgtatt (SEQ ID No. 10), 10 µM) 2.0 µL, upstream template of tolR gene (SEQ ID No. 11, 527 bp) (the template recovered in the previous step) 2.0 µL, downstream template of tolR gene (SEQ ID No. 12, 603 bp) (the template recovered in the previous step) 2.0 µL, and sterile deionized water to a final volume of 50 µL. The PCR reaction procedure was the same as above. After recovery, 10 μL of the fusion fragment was electroporated into prepared competent cells and cultured at 28℃ and 180 rpm for 2 h. The culture was then plated onto 20% sucrose solid medium (10 g tryptone, 5 g yeast extract, 200 g sucrose, 15 g agar, autoclaved at 115℃ for 10 min) and incubated at 37℃ for 12 h. Single colonies were picked and identified by PCR using primers tolR-P1 / P4(TTCGGCCTCCGCTTTTTTC (SEQ ID No. 7) / TTATCCAGCGAACGCGTATT (SEQ ID No. 10). The reaction system and procedure were the same as above. PCR results are shown in [Figure number missing]. Figure 1 Lane 1 shows the band of the deletion strain, which is 429 bp shorter than the band of the wild-type strain sdc-11 in lane 2. A high-OMV-producing Salmonella strain with the tolR gene deletion was successfully obtained, denoted as recombinant Salmonella sdc-11ΔtolR. The strain was cultured at 37°C on a shaker at 180 rpm, and OD was measured every hour. 600 According to OD 600 Draw Figure 2 The growth curves show that the deletion of the tolR gene does not affect the normal growth of Salmonella.

[0044] Single colonies of Salmonella sdc-11 and recombinant Salmonella sdc-11ΔtolR were inoculated into LB liquid medium and cultured overnight at 37°C and 180 rpm with shaking. One mL of the overnight culture was then used to measure its OD value. 600 The value was adjusted to 1.0, and then the inoculum was transferred to 50 mL of fresh LB medium at a rate of 1:100 (v / v), and ampicillin was added at a rate of 1:1000 (v / v). The medium was then cultured at 37°C with shaking at 180 rpm for 14 h.

[0045] Next, the OMVs secreted by each group were extracted using ultracentrifugation, and the bacterial concentration of each group after 14 h of culture was adjusted to 1×10⁻⁶. 8CFU / mL, then an equal volume of bacterial culture was centrifuged at 4°C, 8000×g for 10 min to collect the supernatant. The supernatant was filtered through a 0.22 μm filter membrane for sterilization. The filtrate was concentrated to 20 mL using a 100 kDa ultrafiltration membrane. The concentrate was centrifuged at 4°C, 180,000×g for 2 h, and the supernatant was discarded. The OMVs were resuspended in an appropriate amount (0.2–5 mL) of PBS buffer according to the amount of precipitate, and centrifuged again at 4°C, 180,000×g for 2 h, and the supernatant was discarded. The product was resuspended in 1 mL of PBS buffer to obtain the purified OMVs product. The protein concentration of the purified OMVs product was determined according to the instructions of the BCA protein assay kit (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) to characterize the yield of OMVs.

[0046] (2) Test results:

[0047] The results are as follows Figure 3 As shown, the OMVs secreted by the recombinant strain sdc-11ΔtolR were 1.22 mg / mL, which is 1.6 times that of sdc-11 (0.76 mg / mL).

[0048] The sequence of the tolR gene is shown in SEQ ID No. 1, as follows:

[0049] TCAGATTGGCTGCGTCATTAAGCCAACCGATTTTACGCCCGCGCTGTGTAACAAGTTCAGCGCTTTAATTATTTCATCGTACGGCACCTCTTTCGCGCCGCCGATTAAAAGACTGTTTTCGGATTAGCTGCAGATGACGCTTTACTTCTGCGATCACCTGTTCAGACGGCAGTTGATCCATTCGATCTTTATCAACCACTACGCTGTATTGC CCTACTCCGGAAACCTCAATAATGACCGGTGGATCGTCGTTACTACTGACCGCCTGCGACTGATTCGCCTCCGGCAAGTCGACCTCCACGCTCTGGGTAATGATCGGCGCGGTTGCCATAAAGATCAGCAGCAACACCAACAGTACGTCGAGTAGCGGTACAATATTGATTTCGGACTTAAGTTCGCGACGACCTCGTCCACGCGTTCTGGCCAT

[0050] The sequence of the sacB-cm fragment is shown in SEQ ID No. 2, as follows:

[0051]

[0052] Upstream fragment of tolR gene (SEQ ID No.11):

[0053] Ttcggcctccgcttttttcttcgcgtccgccgccgctttcgccgcttcttcggcctgttgctgctgctgttgcgccagttttgccgcttcttcagcctgcttttgctgctcctgagccgctaaacgttctttctcaagttgtttcaaccgctcctgttcggcagcctgcttctgctgcagctcctctgcttgctgctgttgcagctttttacgctcttcttccgcgcgtctggcgctggcctgttgatcctgctgacggttgtactgctgcacaacggcgccaggatcgaccatcaccgcgtcgatagcggaaccaccgccgccgccggcagaagcctctatatgctcatcaaacgaactccagatcagcactgcaaataagatgatatgcagcacggctgaaataattatcgcccgtttgagcttgtcgttttgttcggttgcctttgacactctcggttcccaaaaaactgttcgcctgttactcgccgtctttcaagccaacgggacgcagactggcttacccc

[0054] Downstream fragment of tolR gene (SEQ ID No.12):

[0055] Gacgcagactggcttac; cccttgttgctttcgcttacggtaaacgcctggcggtgcagaatcgcggtgaactcttccataaagttgtcgtaattcagttccagcttgttcacgcgctgattcagtcggttgtaagccataaccgcagggatggcggcaaacagaccaatcgccgtggcaatcaatgcttcggcaatacccggcgcaaccatttgcagagtcgcctgtttcaccgcgcccagggcgataaacgcatgcataatcccccatacggtgccaaacagaccgatataaggactgattgagcctaccgtgccaagaaacgggatatgcgtttccagcgtttccagctctcggttcatggagatgcgcatcgcacgcgacgccccctctaccactgcctccggcgcatggctgttggcgcgatggagccggacaaactctttgaacccgctataaaagatttgttccgagcccgacagactatcgcgcctcccctggctttcctggtacagacgcgatagttcgattccggaccagaatttatcttcaaacgcttccgcctcacgcgcagcggcgttcagaatacgcgttcgctggataa

[0056] Upstream and downstream fragments (SEQ ID No.13) including the tolR gene in the sdc-11 whole genome sequence:

[0057]

[0058] Example 2: Effect of Salmonella sdc-11ΔtolR combined with glycine on the production of outer membrane vesicles

[0059] (1) Experimental steps:

[0060] Single colonies of Salmonella sdc-11 and recombinant strain sdc-11ΔtolR were picked from the plate and inoculated into 1 mL of LB liquid medium. The culture was carried out at 37°C and 180 r / min with shaking until the logarithmic phase. The activated Salmonella sdc-11 and recombinant strain sdc-11ΔtolR seed culture were inoculated into 50 mL of the corresponding medium at a ratio of 1:100 (v / v), and ampicillin was added at a ratio of 1:1000 (v / v). The cultures were divided into four groups, with the following specific inoculation methods: Group 1 (sdc-11 control, denoted as WT): WT strains were inoculated into LB medium without glycine; Group 2 (sdc-11ΔtolR control, denoted as ΔtolR): sdc-11ΔtolR strains were inoculated into LB medium without glycine; Group 3 (sdc-11+glycine, denoted as Gly): WT strains were inoculated into LB medium containing 1.25% (w / v) glycine; Group 4 (sdc-11ΔtolR+glycine, denoted as Gly-ΔtolR): sdc-11ΔtolR strains were inoculated into LB medium containing 1.25% (w / v) glycine. All groups were placed in a shaker at 37℃ and shaken at 180 r / min. After 14 h of culture, the bacterial culture of each group was adjusted to 1×10⁻⁶. 8 CFU / mL, OMVs were extracted with the same volume of bacterial culture and their yield was evaluated.

[0061] (2) Test results:

[0062] The results are as follows Figure 4 As shown, the production of OMVs secreted by Gly-ΔtolR was 5.54 mg / mL, which is 8.8 times that of sdc-11 (0.63 mg / mL).

[0063] Comparative Example 1: Effect of polymyxin B on Salmonella SDC-11 OMVs production

[0064] (1) Experimental steps:

[0065] Prepare a 4 mg / mL stock solution of polymyxin B, sterilize it by filtration through a 0.22 μm filter, and store it at -20℃ protected from light for later use. Dilute with LB liquid medium to the required working concentration before use. Final concentrations are 1, 2, and 4 μg / mL. The following are general experimental conditions: Inoculate activated Salmonella SDC-11 at a ratio of 1:100 (v / v) into a conical flask containing 50 mL of LB liquid medium, and add 1:1000 (v / v) ampicillin. Incubate at 37℃ with shaking at 180 r / min until mid-logarithmic growth (OD2). 600 ≈0.6). Different concentrations of inducing agent solution were added to each experimental group (see each comparative example for specific preparation methods and concentration gradients), while no inducing agent was added to the control group.

[0066] Next, OMVs secreted by each group were extracted using ultracentrifugation. The bacterial concentration of each group, after 12–14 h of culture, was adjusted to 1 × 10⁻⁶. 8 CFU / mL, then an equal volume of bacterial culture was centrifuged at 4℃, 8000 × g for 10 min to collect the supernatant. The supernatant was filtered through a 0.22 μm filter membrane for sterilization. The filtrate was concentrated to 20 mL using a 100 kDa ultrafiltration membrane. The concentrate was centrifuged at 4℃, 180,000 × g for 2 h, and the supernatant was discarded. The OMVs were resuspended in an appropriate amount of PBS buffer according to the amount of precipitate, and centrifuged again at 4℃, 180,000 × g for 2 h, and the supernatant was discarded. The product was resuspended in 1 mL of PBS buffer to obtain the purified OMVs product. The protein concentration of the purified OMVs product was determined according to the instructions of the BCA protein assay kit (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) to characterize the yield of OMVs.

[0067] (2) Test results:

[0068] The results are as follows Figure 5 As shown, the production of OMVs secreted by Salmonella sdc-11 decreased after adding different concentrations of polymyxin B, with the lowest reduction to 71% of the control group.

[0069] Comparative Example 2: Effect of EDTA on Salmonella SDC-11 OMVs Production

[0070] (1) Experimental steps:

[0071] Prepare a 0.5 mol / L stock solution: Weigh 18.61 g of EDTA-Na2·2H2O, dissolve in 80 mL of deionized water, adjust the pH to 8.0 with NaOH, and bring the volume to 100 mL. Filter through a 0.22 μm filter membrane for sterilization. When using, ensure the final concentration in LB liquid medium is 1, 5, or 10 mmol / L. Culture Salmonella SDC-11 under the general experimental conditions described in Comparative Example 1, then extract OMVs from each group using the same method and determine the total protein concentration.

[0072] (2) Test results:

[0073] The results are as follows Figure 6 As shown, the production of OMVs secreted by Salmonella sdc-11 decreased after adding different concentrations of EDTA, with the lowest reduction to 69% of the control group.

[0074] Comparative Example 3: Effect of ethanol on Salmonella SDC-11 OMVs production

[0075] (1) Experimental steps:

[0076] Anhydrous ethanol was added to achieve final concentrations of 1%, 2.5%, and 5% (v / v) in LB liquid medium. Salmonella SDC-11 was cultured under the general experimental conditions described in Comparative Example 1, and OMVs were extracted from each group using the same method to determine the total protein concentration.

[0077] (2) Test results:

[0078] The results are as follows Figure 7 As shown, the production of OMVs secreted by Salmonella SDC-11 increased after adding different concentrations of ethanol. The OMV production of the group with added 5% ethanol was 0.72 mg / mL, which was 1.28 times that of the control group (0.56 mg / mL).

[0079] Comparative Example 4: Effect of H2O2 on Salmonella sdc-11 OMVs production

[0080] (1) Experimental steps:

[0081] Prepare a 10 mol / L H2O2 stock solution and sterilize it by filtration through a 0.22 μm filter membrane. When using, ensure the final concentration in LB liquid medium is 1, 5, or 10 mmol / L. Culture Salmonella SDC-11 under the general experimental conditions described in Comparative Example 1, then extract OMVs from each group using the same method and determine the total protein concentration.

[0082] (2) Test results:

[0083] The results are as follows Figure 8As shown, the production of OMVs secreted by Salmonella sdc-11 increased after adding different concentrations of H2O2. The OMV production of the group with added 5 mM H2O2 was 0.75 mg / mL, which was 1.34 times that of sdc-11 (0.56 mg / mL).

[0084] Comparative Example 5: Effect of NaCl on Salmonella sdc-11 OMVs Production

[0085] (1) Experimental steps:

[0086] A 6 mol / L NaCl stock solution was prepared with the following formula: 35.1 g NaCl, 1 g peptone, 0.5 g yeast extract, and 100 mL deionized water. The solution was autoclaved at 121°C for 20 min. The final concentrations in LB broth were 0.25, 0.5, and 1 mol / L. Salmonella SDC-11 was cultured under the general experimental conditions described in Comparative Example 1. OMVs were then extracted from each group using the same method, and the total protein concentration was determined.

[0087] (2) Test results:

[0088] The results are as follows Figure 9 As shown, the production of OMVs secreted by Salmonella sdc-11 increased after adding different concentrations of NaCl. The OMV production of the group with added 0.5 M NaCl was 0.69 mg / mL, which was 1.2 times that of sdc-11 (0.58 mg / mL).

[0089] Comparative Example 6: Effect of glycine on Salmonella SDC-11 OMVs production

[0090] (1) Experimental steps:

[0091] Weigh out 0.125, 0.25, 0.375, 0.5, 0.625, and 0.75 g of glycine respectively, dissolve them in 5 mL of 50 mL LB liquid medium, filter through a 0.22 μm filter membrane for sterilization, and return the solution to the medium to achieve final glycine mass-volume fractions of 0.25%, 0.5%, 0.75%, 1%, 1.25%, and 1.5%, respectively. Resuscitate Salmonella bacteria were inoculated at a ratio of 1:100 (v / v) into the LB liquid medium containing different concentrations of glycine. After supplementing with 1:1000 (v / v) ampicillin, the medium was directly placed in a shaker at 37℃ for 14 h. OMVs of each group were extracted according to the method in Comparative Example 1, and the total protein concentration was determined.

[0092] (2) Test results:

[0093] The results are as follows Figure 10 As shown, the OMV production of sdc-11 with added 1.25% glycine was 2.07 mg / mL, which is 3.7 times that of sdc-11 without added glycine (0.56 mg / mL). This was the highest OMV production. When the glycine concentration reached 1.5%, the OMV production actually decreased.

[0094] Comparative Example 7: Effect of culture temperature on Salmonella SDC-11 OMVs yield

[0095] (1) Experimental steps:

[0096] The activated Salmonella sdc-11 was transferred to 50 mL LB liquid medium at a ratio of 1:100 (v / v) and cultured in shakers at 28℃, 30℃, 37℃, and 39℃, respectively, with a shaking speed of 180 rpm. After 14 h of overnight culture, OMVs were extracted according to the method in Comparative Example 1, and the protein concentration of each group of OMVs was determined using a BCA protein assay kit to determine the culture temperature that maximizes the production of Salmonella sdc-11 outer membrane vesicles.

[0097] (2) Test results:

[0098] The results are as follows Figure 11 As shown, the yield of Salmonella sdc-11 OMVs reached its highest level at 37℃, at 0.53 mg / mL.

[0099] Comparative Example 8: Effect of culture time on Salmonella SDC-11 outer membrane vesicle production

[0100] (1) Experimental steps:

[0101] The activated Salmonella SDC-11 was transferred to 500 mL of LB liquid medium at a ratio of 1:100 (v / v) and incubated at 37°C and 180 rpm in a shaker. OD was measured every two hours starting from the second hour. 600 50 mL of bacterial culture was taken from the culture until 24 h. OMVs were extracted from the bacterial culture according to the method in Comparative Example 1, and the protein concentration of OMVs at each time point was determined by BCA protein assay kit to determine the culture time with the highest yield of Salmonella sdc-11ΔtolR outer membrane vesicles.

[0102] (2) Test results

[0103] The results are as follows Figure 12 As shown, the production of Salmonella sdc-11 OMVs reached its highest level at 18 hours, at 3.12 mg / mL.

[0104] The detection results of Examples 1-2 and Comparative Examples 1-8 show that the deletion of the tolR gene and the induction of 1.25% (w / v) glycine have a significant synergistic effect, which can achieve a cumulative increase in OMVs production, resulting in an 8.8-fold increase in OMVs concentration.

[0105] Example 3: OMVs-stimulated RAW264.7 cytokine detection

[0106] (1) Experimental steps:

[0107] Log-phase RAW264.7 cells (purchased from Wuhan Pronosei Biotechnology Co., Ltd.) were seeded into 24-well plates at a density of 500 μL per well (approximately 2 × 10⁻⁶ cells). 5 Cells / well). Gently shake to distribute cells evenly, and incubate overnight at 37°C with 5% CO2 to allow cell adhesion. The next day, observe cell growth and confluence (approximately 80%-90%) under a microscope. Discard the old culture medium from each well and add the following treatment solutions: 1 mL of serum-free DMEM medium for the blank control group; 1 mL of DMEM medium containing 100 ng / mL for the LPS-positive control group. -1 LPS were cultured in DMEM medium; the sdc-11 OMVs group (denoted as sdc-11), sdc-11ΔtolR OMVs group (ΔtolR), and Gly-ΔtolR OMVs group (denoted as Gly-ΔtolR) served as the sdc-11 control group, sdc-11ΔtolR control group, and sdc-11ΔtolR+glycine group, respectively, with 1 mL of a protein concentration of 1000 ng·mL⁻¹ added. -1 DMEM medium for the corresponding OMVs. Three replicates were set for each group. The culture plates were placed in a 37°C, 5% CO2 incubator and cultured for another 12 h.

[0108] After 12 hours, remove the culture plate, discard the culture medium from each well, and wash the cells three times with PBS. Add 1 mL of TRIzol to each well and repeatedly pipette to lyse the cells thoroughly. Transfer the lysis buffer to sterile, enzyme-free 1.5 mL microcentrifuge tubes and incubate on ice for 5 min. Add 200 μL of chloroform to each tube, tighten the cap, and shake vigorously for 15 s, then incubate on ice for 3 min. Centrifuge at 12,000 × g for 15 min at 4 °C. Carefully remove the centrifuge tube and transfer approximately 400 μL of the upper aqueous phase to a new sterile, enzyme-free centrifuge tube, being careful to avoid aspirating the middle layer. Add an equal volume of isopropanol (approximately 400 μL), gently invert to mix, and incubate on ice for 10 min. Centrifuge at 12,000 × g for 10 min at 4 °C, discard the supernatant, and a white, gelatinous RNA precipitate will be visible at the bottom of the tube. Add 1 mL of pre-chilled 75% ethanol (prepared with sterile DEPC water) and gently invert to wash the precipitate. Centrifuge at 7,500×g for 5 min at 4℃, discard the supernatant, and aspirate as much residual liquid as possible. Open the tube cap and allow to dry at room temperature for 5-10 min to allow the ethanol to evaporate completely. Add 20-30 μL of sterile DEPC water to dissolve the RNA precipitate and gently mix with a pipette. Take 1-2 μL of RNA sample and determine the concentration and purity (A) using a micro-spectrophotometer. 260 / A 280 The ratio should be between 1.8 and 2.1. The extracted total RNA should be used immediately for reverse transcription or stored at -80°C for later use.

[0109] Take 1 μg of total RNA, add 4 μL of 4×gDNA wiper Mix, and bring the total volume to 16 μL with RNase-free ddH2O. Mix thoroughly and incubate at 42℃ for 2 min to remove genomic DNA contamination. Then add 4 μL of 5×HiScript II qRT SuperMix for reverse transcription (50℃ for 15 min, 85℃ for 5 s). The resulting cDNA is stored on ice for later use. Next, use quantitative real-time PCR to detect the transcription levels of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in RAW264.7 cells stimulated with OMVs in each group. Using β-actin as an internal control gene and cDNA from each group as a template, each sample is tested in triplicate. -ΔΔCtThe relative expression levels of each target gene were calculated using a method with a blank control group as the calibration sample and β-actin gene as an internal reference for normalization. The quantitative PCR reaction system consisted of: 1 μL cDNA template, 0.4 μL forward primer (10 μM) (TNF-α: GACCCTCACACTCACAAACCA (SEQ ID No. 14); IL-1β: TGCCACCTTTTGACAGTGATG (SEQ ID No. 15)), 0.4 μL reverse primer (10 μM) (TNF-α: TGTGGGTGAGGAGCACGTA (SEQ ID No. 16); IL-1β: ATACTGCCTGCCTGAAGCTC (SEQ ID No. 17)), 10 μL 2× qPCR Master Mix, and 8.2 μL nuclease-free water. The quantitative PCR reaction program was: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 10 s, annealing / extension at 60℃ for 30 s, for a total of 40 cycles.

[0110] (2) Test results:

[0111] The results are as follows Figure 13 As shown, the transcriptional levels of TNF-α and IL-1β mRNA induced by OMVs in the Gly-ΔtolR group were significantly lower than those in the WT group (P<0.01). Furthermore, the expression levels of all inflammatory factors in the LPS-positive control group were significantly higher than those in the OMV-treated groups (P<0.01). These results indicate that the combined optimization strategy (ΔtolR gene deletion combined with 1.25% (w / v) glycine induction) significantly increased OMV production while effectively reducing the inflammatory stimulation of macrophages by OMVs derived from Salmonella sdc-11 strain, decreasing the transcriptional expression of inflammatory factors, and thus alleviating the inflammatory response of macrophages.

[0112] Example 4: Transmission electron microscopy (TEM) observation and nanoparticle tracking analysis (NTA) of Salmonella sdc-11ΔtolR outer membrane vesicles

[0113] (1) Experimental steps:

[0114] Place the copper mesh on an adhesive backing. Add 50 μL of the outer membrane vesicles of the above-mentioned SDC-11 and SDC-11ΔtolR combined with 1.25% (w / v) glycine to the copper mesh. After settling naturally for 10 min, blot the liquid at the edge of the copper mesh with absorbent paper. Stain with 2 wt% phosphotungstic acid for 2 min. Quickly blot away the phosphotungstic acid with filter paper. Transfer the copper mesh to a new filter paper. Bake with an infrared baking lamp for 15 min. Place the copper mesh in the sample well and observe it under a transmission electron microscope.

[0115] 100 μL of outer membrane vesicle samples were diluted 100 times with PBS, and the particle size distribution and concentration of OMVs were determined using an NTA300 system (Malvern). The detection conditions were a laser wavelength of 488 nm and a temperature of 25 ℃. Each sample was analyzed three times, for 60 s each time.

[0116] (2) Test results

[0117] like Figure 14 As shown, OMVs exhibit a typical spherical structure under TEM with a clean background. Furthermore, the OMVs secreted by sdc-11ΔtolR show no significant difference in shape, structure, or size from the wild-type strain. Figure 15 As shown, nanoparticle tracking analysis (NTA) determined the concentration of OMVs generated by sdc-11ΔtolR to be approximately 2.59 × 10⁻⁶. 13 The average particle size of OMVs was approximately 64 nm, while the concentration of OMVs produced by the wild-type strain sdc-11 was approximately 2.14 × 10⁻⁶. 12 The average particle size of OMVs was approximately 63 nm. The particle size distributions of the two groups were similar, with no significant difference. These results indicate that OMVs prepared via ΔtolR gene deletion combined with glycine induction maintain the same basic physical properties as natural OMVs, including morphology and particle size. This confirms that the optimization method significantly improved yield without significantly affecting the inherent structural characteristics of OMVs.

[0118] Finally, it should be noted that the above embodiments are merely illustrative examples of the technical solutions of the present invention and are not intended to limit the scope of the invention. Any modifications, equivalent substitutions, or improvements made by those skilled in the art to the technical solutions of the present invention based on existing technology and the above embodiments, without departing from the core technical concept and protection scope of the present invention, should be included within the protection scope of the claims of the present invention.

Claims

1. A method for increasing the yield of Salmonella outer membrane vesicles, characterized in that, The steps are as follows: Step 1: Construct a recombinant Salmonella strain with the tolR gene knocked out. The tolR gene was knocked out from wild-type Salmonella enterica sdc-11. The sequence of the knocked-out tolR gene is shown in SEQ ID NO.

1. Step 2: Incubate the Salmonella recombinant strain with the tolR gene knocked out in LB medium supplemented with 0.75-1.25% w / v glycine at 30-39℃ for 2-24 h, and then collect the outer membrane vesicles.

2. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 1, characterized in that, In step one, the knocked-out tolR gene is replaced with sacB-cm, and then the fragment is eliminated using Red recombination technology. The sequence of sacB-cm is shown in SEQ ID NO.

2.

3. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 2, characterized in that, In step one, the tolR gene is knocked out using Red recombination technology. Specifically, the homologous recombination fragment sacB-cm, which has upstream and downstream homologous arms of the tolR gene at both ends and contains the fructan sucrase gene sacB and the chloramphenicol resistance gene in the middle, is introduced into Salmonella sdc-11 for homologous recombination. The tolR gene on the Salmonella sdc-11 chromosome is replaced with the sacB-cm fragment. Then, the fragment is eliminated using Red recombination technology to obtain Salmonella recombinant strains with the tolR gene knocked out.

4. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 3, characterized in that, The specific steps for eliminating the fragment using the Red recombination technology are as follows: Using the whole genome of wild-type Salmonella enteritidis sdc-11 as a template, the upstream / downstream fragments of the tolR gene are amplified. The forward primer sequence for amplifying the upstream fragment is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.

9. The forward primer sequence for amplifying the downstream fragment is shown in SEQ ID NO.8, and the reverse primer sequence is shown in SEQ ID NO.

10. The upstream / downstream fragments of the tolR gene are then fused. The forward primer sequence used for fusion is shown in SEQ ID NO.7, and the reverse primer sequence is shown in SEQ ID NO.

10. The fused fragment is then introduced into Salmonella containing the sacB-cm fragment for homologous recombination, thereby eliminating the sacB-cm gene on the Salmonella sdc-11 chromosome.

5. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 1, characterized in that, In step two, the culture is carried out at 37°C for 18 hours.

6. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 1, characterized in that, In step two, 1.25% w / v glycine is added.

7. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 6, characterized in that, The composition of the LB medium after adding 1.25% w / v glycine is as follows: 10 g tryptone, 5 g yeast extract, 10 g NaCl, and deionized water to a final volume of 1 L. After autoclaving at 121℃ for 20 min, 12.5 g g of glycine is dissolved in 200 mL of LB medium. The glycine solution is then sterilized by 0.22 μm filtration and returned to the remaining 800 mL of LB medium.

8. The method for increasing the yield of Salmonella outer membrane vesicles according to claim 1, characterized in that, The collection of outer membrane vesicles is as follows: After culture, the culture is centrifuged at 4℃ and 8000 × g for 10 min to collect the supernatant. The supernatant is filtered through a 0.22 μm filter membrane for sterilization. The filtrate is concentrated through a 100 kDa ultrafiltration membrane. The concentrate is centrifuged at 4℃ and 180,000 × g for 2 h, and the supernatant is discarded. The precipitate is resuspended in 0.2~5 mL of PBS buffer and centrifuged again at 4℃ and 180,000 × g for 2 h. The supernatant is discarded, and the precipitate is resuspended in 5 mL of PBS buffer to obtain the purified OMVs product.

Images