Sulfonylurea derivatives and their use

Abstract

The present application relates to sulfonylurea derivatives or pharmaceutically acceptable salts thereof and uses thereof. In particular, the present application relates to the use of sulfonylurea derivatives or pharmaceutically acceptable salts thereof as NLRP3 inflammasome inhibitors, wherein the structure of the sulfonylurea derivatives is according to Formula I, wherein the definitions of the substituents are as described in the specification.

Description

Sulfonylurea derivatives and their applications

[0001] This application claims priority to the Chinese patent application filed on December 1, 2023, with application number 202311640461.0 and invention name “Sulfonylurea derivatives and their applications”, the contents of which should be understood as incorporated into this application by reference. Technical Field

[0002] The present invention relates to but is not limited to the field of medicine, and in particular to a sulfonylurea derivative or a pharmaceutically acceptable salt thereof and use thereof. Background Art

[0003] The nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) inflammasome is a multimeric protein complex that activates caspase-1 (cysteine ​​asparate protease-1), thereby inducing the maturation of interleukin (IL)-1β and IL-18.

[0004] NLRP3 inhibitors directly target NLRP3 and interact with the NACHT or PYD domain of NLRP3. Possible effects include inhibiting the enzymatic activity of NLRP3 and inhibiting the interaction between NLRP3, thereby affecting the NLRP3 inflammasome assembly process (i.e., the activation process).

[0005] Initially, the sulfonylurea compound glibenclamide was found to be a potent NLRP3 inhibitor when a phenotypic screening of a diarylsulfonylurea library was performed on interleukin 1β (IL-1β) secreted by human monocytes (J.Pharmacol.Experimental Therapeutics 2001, 299(1), 187-197.), although its activity was weak. Subsequently, these compounds were further optimized and their mechanism of action was initially investigated, with the initial hypothesis that they acted by inhibiting GST omega 1-1. Further work revealed that these compounds acted through NLRP3 inhibition (J.Biol.Chem.2003, 278, 16567-16578.). One of the derivatives of glibenclamide, CRID3 or CP456,773, was renamed MCC950 and was found to be a potent inhibitor of the NLRP3 inflammasome (Nat.Med.2015, 21(3), 248-255.). MCC950 was clinically tested in rheumatoid arthritis, but the trial was discontinued, possibly due to elevated serum liver enzyme levels in patients. MCC950 works by binding to the Walker B motif in the NACHT domain of NLRP3 and blocking NLRP3-mediated ATP hydrolysis. Since then, MCC950 has been used as a tool compound in a wide range of in vitro and in vivo studies involving NLRP3 diseases. This tool compound, combined with a range of target validation technologies, has demonstrated significant NLRP3 activity in numerous diseases, including cryopyrin associated periodic syndrome (CAPS), inflammatory bowel disease (IBD), non-alcoholic steatohepatitis (NASH), gout, multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease.

[0006] MCC950 is a compound with a well-defined mechanism of action, high cellular activity, high oral availability and plasma concentrations, and demonstrated efficacy in animal models. However, MCC950 cannot effectively cross the blood-brain barrier (BBB), limiting its efficacy in various diseases requiring BBB penetration, such as multiple sclerosis, stroke, Alzheimer's disease, and Parkinson's disease. Therefore, structural modification to obtain NLRP3 inhibitors with both robust cellular activity and excellent pharmacokinetic properties while also being able to efficiently cross the BBB has been a significant challenge and a key research direction in the development of NLRP3 inhibitors. Summary of the Invention

[0007] The following is a summary of the subject matter described in detail herein. This summary is not intended to limit the scope of the claims.

[0008] The present application provides a sulfonylurea derivative or a pharmaceutically acceptable salt thereof, wherein the structure of the sulfonylurea derivative is shown in Formula I, wherein each substituent is as defined herein. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof provided herein can be used as an inhibitor of the NLRP3 inflammasome.

[0009] Specifically, the present application provides a sulfonylurea derivative or a pharmaceutically acceptable salt thereof, wherein the structure of the sulfonylurea derivative is as shown in Formula I,

[0010] in:

[0011] R1 is a non-alkyl substituent, for example, selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl;

[0012] R2 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 2-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl;

[0013] R3 is a non-alkyl substituent, for example, selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkylamino, aryl, aryloxy, aryl C 1-6 alkoxy, heteroaryl, carboxyl, and heteroalkyl;

[0014] R4 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 2-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl;

[0015] wherein the four substituents R1, R2, R3, and R4 are not H at the same time;

[0016] R5 is C 1-6 alkyl;

[0017] R6 is C 1-6 alkyl;

[0018] When R4 is C1-6 When it is an alkyl group, R6 and R4 together form a heterocyclic hydrocarbon group;

[0019] Or when R3 is C 1-6 When it is an alkyl group, R6 and R3 together form a heterocyclic hydrocarbon group;

[0020] Or when R4 is C 1-6 In the case of an alkoxy group, the methylene group connected to the nitrogen atom forms a heterocyclic hydrocarbon group together with R4.

[0021] In some embodiments, the halogen is F, Cl, Br, or I, preferably F or Cl.

[0022] In some embodiments, R1 is selected from H, halogen, nitro, or amino, preferably H, F, Cl, -NO2, or -NH2.

[0023] In some embodiments, R2 is H or halogen, preferably H or F.

[0024] In some embodiments, R3 is selected from H, C 1-3 Alkoxy, halogenated C 1-3 Alkoxy, aryl C 1-3 Alkoxy, hydroxy, halogen or amino, preferably H, -OCH3, -OBn, F, Cl, -NH2, -OCF3, -OCH2CH3, -OCH(CH3)2 or -OH.

[0025] In some embodiments, R4 is selected from H, halogen, C 1-3 Alkyl, C 1-3 Alkoxy, amino, hydroxy or nitro, preferably H, -NO2, -OCH2CH3, -NH2, F, Cl, -CH3 or -OH; when R4 is -OCH2CH3, the methylene group connected to the N atom forms a six-membered heterocyclic hydrocarbon group together with R4.

[0026] In some embodiments, R5 and R6 are each independently methyl or ethyl; preferably, R5 and R6 are both methyl or both ethyl.

[0027] In some embodiments, R6 and R4 are taken together to form a six-membered heterocycloalkyl.

[0028] In some embodiments, R6 and R3 are taken together to form a six-membered heterocycloalkyl.

[0029] In some embodiments, the sulfonylurea derivative is selected from:

[0030] In some embodiments, the sulfonylurea derivative is a compound having a structure as shown in Formula I, wherein:

[0031] R1 is selected from H, halogen (preferably F) and nitro;

[0032] R2 is selected from H and halogen (preferably F);

[0033] R3 is selected from H, halogen (preferably F), amino, hydroxyl, C 1-6 Alkoxy and aryl C 1-6 alkoxy;

[0034] R4 is selected from H, halogen (preferably F), nitro, amino, C 1-6 alkyl;

[0035] wherein the four substituents R1, R2, R3, and R4 are not H at the same time;

[0036] R5 and R6 are each independently C 1-6 Alkyl; preferably, R5 and R6 are both methyl or ethyl.

[0037] In some embodiments, the sulfonylurea derivative is selected from:

[0038] In some embodiments, the sulfonylurea derivative is selected from:

[0039] The present application also provides the above-mentioned sulfonylurea derivative or a pharmaceutically acceptable salt thereof, for use as:

[0040] (i) NLRP3 inflammasome inhibitors; and / or

[0041] (ii) a modulator of one or more of IL-1β, IL-17, IL-18, IL-1α, IL-37, IL-33 and Th17 cells.

[0042] The present application also provides a composition comprising the above-mentioned sulfonylurea derivative or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0043] The present application also provides use of the above-mentioned sulfonylurea derivative or a pharmaceutically acceptable salt thereof or the above-mentioned composition in the preparation of a medicament for treating or preventing a disease, disorder or condition.

[0044] The present application also provides the above-mentioned sulfonylurea derivative or a pharmaceutically acceptable salt thereof or the above-mentioned composition for use in treating or preventing a disease, disorder or condition.

[0045] The present application also provides a method for treating or preventing a disease, disorder or condition, comprising administering the above-mentioned sulfonylurea derivative or a pharmaceutically acceptable salt thereof or the above-mentioned composition to a subject in need thereof.

[0046] Diseases, disorders or conditions that can be treated or prevented using the above-mentioned sulfonylurea derivatives or pharmaceutically acceptable salts thereof or the above-mentioned compositions are:

[0047] (i) immune system disease, disorder or condition;

[0048] (ii) an inflammatory disease, disorder or condition or an autoimmune disease, disorder or condition;

[0049] (iii) skin diseases, disorders or conditions;

[0050] (iv) diseases, disorders or conditions of the cardiovascular system;

[0051] (v) tumors;

[0052] (vi) diseases, disorders or conditions of the renal system;

[0053] (vii) gastrointestinal diseases, disorders or conditions;

[0054] (viii) respiratory diseases, disorders or conditions;

[0055] (ix) diseases, disorders or conditions of the endocrine system;

[0056] (x) central nervous system (CNS) diseases, disorders or conditions; and / or

[0057] (xi) Local or systemic infection.

[0058] In some embodiments, the disease, disorder or condition is selected from the group consisting of constitutive inflammation including cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS) and neonatal-onset multisystem inflammatory disease (NOMID), autoinflammatory diseases, familial Mediterranean fever (FMF), TNF receptor-associated periodic syndrome (TRAPS), mevalonate kinase deficiency (MKD), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Majid syndrome, septic arthritis, pyoderma gangrenosum and acne syndrome (PAPA) , A20 haploinsufficiency (HA20), juvenile granulomatous arthritis (PGA), PLCG2-associated antibody deficiency and immune dysregulation (PLAID), PLCG2-associated autoinflammatory, antibody deficiency and immune dysregulation (APLAID), and sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay (SIFD); autoimmune diseases, including multiple sclerosis (MS), type 1 diabetes, psoriasis, rheumatoid arthritis, Behçet's disease, Sjögren's syndrome, and Schnitz syndrome; macrophage activation syndrome; Blau's syndrome; respiratory diseases, including chronic obstructive pulmonary disease (COPD), asthma, such as allergic asthma and steroid-resistant asthma, and asbestosis , silicosis, and cystic fibrosis; dermatitis, including contact dermatitis; central nervous system diseases, including Parkinson's disease, Alzheimer's disease, motor neuron disease, Huntington's disease, cerebral malaria, and brain damage due to pneumococcal meningitis; metabolic diseases, including type 2 diabetes, atherosclerosis, obesity, gout, and pseudogout; eye diseases, including those of the ocular epithelium, age-related macular degeneration (AMD), uveitis, corneal infections, and dry eye; kidney diseases, including chronic kidney disease, oxalate nephropathy, nephrocalcinosis, and diabetic nephropathy; liver diseases, including nonalcoholic steatohepatitis (NASH) and alcoholic liver disease; inflammatory skin reactions, including contact hypersensitivity and sunburn; and inflammatory arthritis reactions, including osteoarthritis. Arthritis, systemic juvenile idiopathic arthritis, adult-onset Still's disease, relapsing polychondritis; viral infections, including alphaviruses (Chikungunya, Ross River) and flaviviruses (dengue, Zika), influenza, and HIV; hidradenitis suppurativa (HS) and other cyst-causing skin diseases; cancer, including lung metastasis, pancreatic cancer, gastric cancer, myelodysplastic syndrome, and leukemia; polymyositis; stroke, including ischemic stroke; myocardial infarction, including recurrent myocardial infarction; congestive heart failure; embolism; cardiovascular disease; graft-versus-host disease; hypertension; colitis; helminthic infections; bacterial infections; abdominal aortic aneurysm; wound healing; depression and psychological stress; sepsis; and septic shock.Ischemia-reperfusion injury and any disease in which the individual has been identified as harboring a germline or somatic non-silent mutation in NLRP3;

[0059] In some embodiments, the disease, disorder, or condition is:

[0060] (i) autoinflammatory diseases such as cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS), familial Mediterranean fever (FMF), neonatal-onset multisystem inflammatory disease (NOMID), tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Majid syndrome, or septic arthritis, pyoderma gangrenosum, and acne (PAPA);

[0061] (ii) Parkinson's disease or Huntington's disease;

[0062] (iii) gout or juvenile idiopathic arthritis;

[0063] (iv) nonalcoholic steatohepatitis (NASH);

[0064] (v) oxalate nephropathy or nephrocalcinosis;

[0065] (vi) uveitis;

[0066] (vii) hidradenitis suppurativa (HS);

[0067] (viii) myelodysplastic syndrome, macrophage activation syndrome, Schnitz syndrome, adult-onset Still's disease, or Behçet's disease; or

[0068] (ix) Sepsis and septic shock.

[0069] Compared with the prior art, the present application has achieved the following beneficial effects: the compounds of the present invention have good NLRP3 inhibitory activity, excellent pharmacokinetic properties and can efficiently penetrate the blood-brain barrier, and can be used for both non-neurological diseases and neurological diseases that need to penetrate the blood-brain barrier.

[0070] Other features and advantages of the present application will be described in the following description and, in part, will become apparent from the description or may be learned by practicing the present application. Other advantages of the present application may be realized and obtained by the solutions described in the description and accompanying drawings. Other aspects will become apparent after reading and understanding the accompanying drawings and detailed description.

[0071] Summary of the Figures

[0072] The accompanying drawings are intended to facilitate understanding of the technical solutions of this application and constitute a part of the specification. Together with the examples of this application, they are used to explain the technical solutions of this application and do not constitute a limitation of the technical solutions of this application. Different NLRP3 activation models correspond to different pathological conditions, and therefore the inhibitory effects reflected in the same examples may vary.

[0073] Figure 1 shows that in Experimental Example 1, Examples 1, 5, 17, 20, 24, 25, 26, 27, and 28 can effectively inhibit the release of IL-1β at a concentration of 1 μM (relative to the positive control, the release amount is reduced by more than 80%). However, Examples 16 and 21 have a weaker inhibitory effect on IL-1β release at a concentration of 1 μM (relative to the positive control, the release amount is reduced by between 20% and 80%).

[0074] Figure 2 shows that in Experimental Example 1, Examples 2, 3, 4, and 6 can effectively inhibit the release of IL-1β at a concentration of 1 μM (the release amount is reduced by more than 80% compared to the positive control), while Examples 8 and 9 have only a weak inhibitory effect at 1 μM (the release amount is reduced by between 20% and 80% compared to the positive control).

[0075] Figure 3 shows that in Experimental Example 1, Examples 7, 10, 14, 15, 18, 19, 22, and 23 can effectively inhibit the release of IL-1β at a concentration of 1 μM (the release amount is reduced by more than 80% compared to the positive control). However, Example 10 has no inhibitory effect at a concentration of 1 μM.

[0076] Figure 4 shows that in Experimental Example 1, Example 11 can effectively inhibit the release of IL-1β at a concentration of 1 μM (the release amount is reduced by more than 80% compared to the positive control). Example 12 has a weaker inhibitory effect on IL-1β release at a concentration of 1 μM (the release amount is reduced by between 20% and 80% compared to the positive control), and Example 13 has no inhibitory effect at a concentration of 1 μM.

[0077] Figure 5 shows that in Experimental Example 2, Examples 3, 5, 14, 17, 18, 19, 20, 22, 23, 24, 25, and 26 had effective inhibitory effects at a concentration of 10 μM (reduced by more than 50% compared to the positive control).

[0078] FIG6 shows that in Experimental Example 4, Examples 17 and 27 had effective inhibitory effects at a concentration of 1 μM (reduced by more than 75% compared to the release amount of the positive control minus the LPS control alone).

[0079] FIG7 shows that in Experimental Example 4, Example 29 has an effective inhibitory effect at a concentration of 1 μM (reduced by more than 50% compared to the positive control).

[0080] FIG8 shows that in Experimental Example 4, Example 31 has an effective inhibitory effect at a concentration of 1 μM (reduced by more than 50% compared to the positive control).

[0081] FIG9 shows that in Experimental Example 4, Example 32 has an effective inhibitory effect at a concentration of 1 μM (reduced by more than 50% compared to the positive control).

[0082] FIG10 shows that in Experimental Example 7, Example 19 can significantly inhibit the release of IL-1β in the mouse sepsis model, has a faster onset of action than MCC950, and improves the survival rate of mice better than MCC950.

[0083] FIG11 shows that in Experimental Example 8, Example 19 can significantly inhibit the release of IL-1β in a mouse gout-related peritonitis model, and the inhibitory effect is stronger than that of MCC950.

[0084] FIG12 shows the results of mouse plasma pharmacokinetic analysis in Example 3.

[0085] FIG13 shows the results of mouse plasma pharmacokinetic analysis in Example 5.

[0086] FIG14 shows the results of mouse plasma pharmacokinetic analysis of Example 19.

[0087] FIG15 shows the results of mouse plasma pharmacokinetic analysis of the control drug MCC950.

[0088] FIG16 shows the results of mouse plasma pharmacokinetic analysis of Example 17.

[0089] FIG17 shows the results of mouse plasma pharmacokinetic analysis of Example 27.

[0090] FIG18 shows the results of mouse plasma pharmacokinetic analysis of Example 29.

[0091] FIG19 shows the results of rat plasma pharmacokinetic analysis of Example 5.

[0092] FIG20 shows the results of rat plasma pharmacokinetic analysis of Example 19.

[0093] FIG21 shows the results of rat plasma pharmacokinetic analysis of MCC950.

[0094] Details

[0095] The present invention is further illustrated by the following examples, but any example or combination thereof should not be construed as limiting the scope or implementation of the present invention. The scope of the present invention is defined by the appended claims. In conjunction with this specification and common knowledge in the art, a person of ordinary skill in the art will clearly understand the scope defined by the claims. Without departing from the spirit and scope of the present invention, those skilled in the art may make any modifications or changes to the technical solution of the present invention, and such modifications and changes are also included in the scope of the present invention.

[0096] the term

[0097] As used herein, halogen refers to a fluorine, chlorine, bromine or iodine atom.

[0098] In this article, C m-n Refers to a moiety having an integer number of carbon atoms in a given range. For example, "C 1-6 ” means that the group can have 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, or 6 carbon atoms.

[0099] The term "alkyl" refers to a group of the formula C n H 2n+1 The alkyl group can be straight chain or branched. For example, the term "C 1-6 The term "alkyl" refers to an alkyl group containing 1 to 6 (e.g., 1, 2, 3, 4, 5, 6) carbon atoms (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, neopentyl, hexyl, 2-methylpentyl, etc.). Similarly, the alkyl portion (i.e., alkyl) of alkoxy, alkylamino, and heteroalkyl has the same definition as above.

[0100] The term "alkenyl" refers to an unsaturated aliphatic hydrocarbon group consisting of a straight or branched chain of carbon atoms and hydrogen atoms and having at least one double bond. For example, the term " “Alkenyl” is understood to mean preferably a linear or branched monovalent hydrocarbon radical containing one or more double bonds and having 2, 3, 4, 5, or 6 carbon atoms. It is understood that in case the alkenyl contains more than one double bond, the double bonds may be separated from each other or conjugated. Such alkenyl groups include, but are not limited to, ethenyl, propenyl, (E)-2-methylethenyl, (Z)-2-methylethenyl, (E)-but-2-enyl, (Z)-but-2-enyl, (E)-but-1-enyl, (Z)-but-1-enyl, isopropenyl, 2-methylprop-2-enyl, 1-methylprop-2-enyl, 2-methylprop-1-enyl, (E)-1-methylprop-1-enyl, (Z)-1-methylprop-1-enyl, and the like. The above description of alkenyl may apply to alkenylene, but alkenylene is a divalent radical.

[0101] The term "alkynyl" refers to a straight or branched unsaturated aliphatic hydrocarbon group consisting of carbon atoms and hydrogen atoms and having at least one triple bond. For example, the term " The term "alkynyl" is understood to mean preferably a linear or branched hydrocarbon group containing one or more triple bonds and having 2, 3, 4, 5, or 6 carbon atoms. Alkynyl includes, but is not limited to, ethynyl and propynyl.

[0102] The term "alkoxy" refers to an -O-alkyl group.

[0103] The term "alkylamino" refers to an -NH-alkyl group.

[0104] The term "heteroalkyl" refers to an alkyl group containing 1 to 5 heteroatoms (eg, 1, 2, 3, 4, or 5 heteroatoms) independently selected from sulfur, oxygen, and / or nitrogen.

[0105] The term "hydroxy" refers to an -OH group.

[0106] The term "nitro" refers to a -NO2 group.

[0107] The term "amino" refers to a -NH2 group.

[0108] The term "carboxy" refers to a -COOH group.

[0109] The term "membered" refers to the number of backbone atoms constituting the ring. For example, "3-membered to 12-membered" refers to the number of backbone atoms constituting the ring being 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.

[0110] The term "aryl" refers to a monocyclic or fused polycyclic ring system consisting only of carbon atoms as ring atoms and having at least one aromatic ring. 6-18 "Aryl" refers to an aromatic group as defined above having 6 to 18 (e.g., 6 to 15, 6 to 12, 6 to 10, 6 to 8) carbon atoms. Aryl includes a ring system formed by fusion of an aromatic ring with an aromatic ring, or an aromatic ring with a non-aromatic carbocyclic ring (e.g., cycloalkanes, cycloalkenes, or cycloalkynes). Non-limiting examples of aryl include, but are not limited to, phenyl, naphthyl, anthracenyl, 1,2,3,4-tetrahydronaphthyl, indanyl, and the like.

[0111] The term "heteroaryl" refers to a monocyclic or fused polycyclic ring system containing at least one (e.g., 1 to 5, such as 1, 2, 3, 4, or 5) ring atom selected from N, O, and S, with the remaining ring atoms being carbon, and having at least one aromatic ring. The ring carbon atoms and heteroatoms may be substituted with oxo or thio groups. The term "C 2-18"Heteroaryl" refers to a heteroaryl group as defined above having 2-18 (e.g., 2 to 15, 2 to 12, 2 to 10, 2 to 8) carbon atoms. The heteroaryl group includes a ring system formed by fusion of a heteroaromatic ring with an aromatic carbocycle, a heteroaromatic ring with a heteroaromatic ring, or a heteroaromatic ring with a non-aromatic carbocycle (e.g., cycloalkane, cycloalkene, or cycloalkyne) or a heterocycle (e.g., heterocycloalkane, heterocycloalkene, or heterocycloalkyne), and in the aforementioned fused heteroaryl group, the point of attachment of the heteroaryl group to the rest of the molecule can be on the heteroaromatic ring or on the other ring fused to the heteroaromatic ring. Non-limiting examples of heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, quinolyl, isoquinolyl, tetrazolyl, triazolyl, triazinyl, benzofuranyl, benzothienyl, indolyl, and isoindolyl.

[0112] The term "aryloxy" refers to an -O-aryl group.

[0113] The term "heterocyclic hydrocarbon group" refers to a cyclic group that is fully saturated or partially saturated and can exist as a monocyclic, condensed, bridged, or spirocyclic ring. The heterocyclic ring can be a 3-12 membered ring containing 1 to 5 heteroatoms (e.g., 1, 2, 3, 4, or 5 heteroatoms) independently selected from sulfur, oxygen, and / or nitrogen, such as a 3-10 membered, 3-8 membered, 3-7 membered, or 5-7 membered ring. Examples of 3-membered heterocycloalkyl groups include, but are not limited to, oxiranyl, thioranyl, and aziridinyl. Non-limiting examples of 4-membered heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetanyl, thietanyl, and azetidinyl. Examples of 5-membered heterocycloalkyl groups include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, isoxazolidinyl, oxazolidinyl, isothiazolidinyl, thiazolidinyl, imidazolidinyl, and tetrahydropyrazolyl. Examples of 6-membered heterocycloalkyl groups include, but are not limited to, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, morpholinyl, piperazinyl, 1,4-thioxanyl, 1,4-dioxanyl, thiomorpholinyl, 1,3-dithianyl, and 1,4-dithianyl. Examples of 7-membered heterocycloalkyl groups include, but are not limited to, azepanyl, oxetanyl, thiepanyl, and 2-oxa-6-aza-spiro[3,3]heptanyl. Examples of 8-membered heterocyclic hydrocarbon groups include, but are not limited to, 8-azabicyclo[3.2.1]octanyl, 3,8-diazabicyclo[3.2.1]octanyl, and hexahydropyrrolizinyl. Other examples of heterocyclic hydrocarbon groups include, but are not limited to, octahydroquinolizinyl and 1,1-dioxothiomorpholinyl.

[0114] In this article, the sulfonylurea compounds of the present application include all stereoisomers, geometric isomers, tautomers and isotopic variants of the described structure. Unless otherwise specified, compounds whose structures or names are determined with a specific tautomer herein also include other tautomers. Unless otherwise specified, the sulfonylurea compounds of the present application can exist as enantiomers, epimers or its racemates or mixtures. The stereoisomers of the sulfonylurea compounds of the present application include cis and trans isomers, optical isomers (such as enantiomers), epimers, geometric isomers, rotational isomers, steric isomers, conformational isomers and tautomers of the sulfonylurea compounds of the present application, as well as mixtures of multiple isomerized existences, and mixtures of racemates and epimer pairs.

[0115] In this article, the atoms in the sulfonylurea compounds of the present application may be present in natural isotopic abundance, or one or more of the atoms may be specific isotopes that are artificially enriched, and the isotopes have the same atomic number, but their atomic mass is different from the atomic mass that predominantly exists in nature. The present application includes all suitable isotopic variants of the sulfonylurea compounds described herein, such as deuterated compounds, and deuterium enrichment may provide certain therapeutic advantages, such as increasing half-life in vivo or reducing dosage requirements, or may provide compounds that can be used as standards for characterizing biological samples. Those skilled in the art can prepare isotopically enriched compounds using appropriate isotopically enriched reagents or intermediates according to known conventional techniques, or with reference to the preparation methods in the examples herein. Examples of isotopes that can be incorporated into the sulfonylurea compounds of the present application include 2 H. 3 H. 13 C. 14 C. 15 N. 18 O. 17 O. 31 P. 32 P. 35 S. 18 F. 36 Cl, 82 Br, 123 I. 124 I. 129 I and 131 I.

[0116] In this article, the sulfonylurea compound of the present application can exist as a solvate or an unsolvate. Solvate described herein includes a hydrate, and in the solvate or hydrate, solvent or water and the sulfonylurea compound of the present application can be a strong binding relationship (i.e. stoichiometric), or a weak binding relationship (such as solvent or water of adsorption). The solvate refers to the complex formed by the sulfonylurea compound of the present application and more than one pharmaceutically acceptable solvent molecules, and the pharmaceutically acceptable solvent can be methanol, ethanol, acetone, diformamide or water etc. When the solvent is water, the solvate is a hydrate.

[0117] In this article, the sulfonylurea compound of the present invention can be present in the form of its pharmaceutically acceptable salt, such as an acid addition salt or a base addition salt of the sulfonylurea compound of the present invention. Here, the acid can be an inorganic acid or an organic acid, such as hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, sulfuric acid, acid sulfuric acid, sulfurous acid, acid sulfurous acid, phosphoric acid, acid phosphoric acid, carbonic acid, acid carbonic acid, such as formic acid, acetic acid, propionic acid, pantothenic acid, lactic acid, oxalic acid, salicylic acid, citric acid, acid citric acid, tartaric acid, acid tartaric acid, succinic acid, maleic acid, fumaric acid, glucose Glucuronic acid, gluconic acid, benzoic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, ascorbic acid, gentisic acid, pamoic acid, camphorsulfonic acid, mandelic acid, saccharic acid, amino acids (such as natural amino acids, L-glycine, L-aspartic acid, L-glutamic acid, L-valine, etc.); the base can be an inorganic base or an organic base, the inorganic base is for example a hydroxide of sodium, potassium, calcium, magnesium, manganese, iron, zinc or aluminum, the organic base includes basic amino acids (such as arginine, lysine, histidine), ammonia, primary amines, secondary amines, tertiary amines, cyclic amines (such as piperidine, morpholine, piperazine).

[0118] As used herein, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0119] As used herein, the term "pharmaceutically acceptable excipient" refers to any excipient that is non-irritating to organisms and does not impair the biological activity and properties of the active compound. Suitable excipients are well known to those skilled in the art and include, for example, carbohydrates, waxes, water-soluble and / or water-swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, and water.

[0120] As used herein, the word “comprise” or “comprises” and its English variants such as comprises or comprising should be understood as having an open, non-exclusive meaning, ie, “including but not limited to”.

[0121] As used herein, the term "pharmaceutical composition" refers to a mixture of one or more compounds of the present application or their salts and pharmaceutically acceptable excipients. The purpose of a pharmaceutical composition is to facilitate administration of the compounds of the present application to an organism.

[0122] As used herein, the effective amount refers to an amount of the sulfonylurea compound or pharmaceutical composition of the present application sufficient to affect any one or more beneficial or desirable aspects of a disease, including the biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes presented during the course of the disease. The therapeutically effective amount refers to an amount of the compound that alleviates, to a certain extent, one or more symptoms of the condition being treated.

[0123] As used herein, the term "treatment" means administering the compound or formulation described herein to improve or eliminate a disease or one or more symptoms associated with the disease, and includes:

[0124] (i) inhibiting a disease or disease state, i.e., arresting its development;

[0125] (ii) ameliorating the disease or condition, i.e., causing regression of the disease or condition.

[0126] As used herein, the term "prevention" means administering the compound or formulation described herein to prevent a disease or one or more symptoms associated with the disease, and includes:

[0127] Preventing a disease or disease state from occurring in a subject (eg, a mammal) is particularly useful when such subject is susceptible to having the disease state but has not yet been diagnosed as having the disease state.

[0128] The compounds of the present application can be prepared by a variety of synthetic methods, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthesis methods, and equivalent replacement methods well known to those skilled in the art. Preferred embodiments include but are not limited to the examples of the present application.

[0129] The chemical reactions described in the specific embodiments of the present application are carried out in a suitable solvent that is compatible with the chemical transformations described herein and the reagents and materials required. To obtain the compounds described herein, it may sometimes be necessary for those skilled in the art to modify or select synthetic steps or reaction schemes based on existing embodiments.

[0130] This application uses the following abbreviations:

[0131] Toluene: toluene; NCS: N-chlorosuccinimide; HCl: hydrochloric acid; ACN or MeCN: acetonitrile; H2O: water; NH3: ammonia; BTC or triphosgene: triphosgene; TFA: trifluoroacetic acid; NH4HCO3: ammonium bicarbonate; DMSO: dimethyl sulfoxide; EA: ethyl acetate; THF: tetrahydrofuran; DIEA: N,N-diisopropylethylamine; DMF: N,N-dimethylformamide; DCM: dichloromethane; Pd2(dba)3: trisdibenzylideneacetone dipalladium; LCMS: liquid chromatography-mass spectrometry; TLC: thin layer chromatography; HPLC: high performance liquid chromatography; RP-HPLC: reversed-phase high performance liquid chromatography; STAB or NaBH(AcO)3: sodium triacetoxyborohydride; AcOH: acetic acid; MeOH: methanol; EtOH: ethanol; PPh3: triphenylphosphine; Pd(PPh3)4: tetrakis(triphenylphosphine)palladium; TEA or Et3N: triethylamine; Boc2O: di-tert-butyl dicarbonate; DMAP: 4-dimethylaminopyridine; XantPhos: 4,5-bis(diphenylphosphino-9,9-dimethylxanthene); HSBn: benzyl mercaptan; PE: petroleum ether; t-BuXphos: 2-di-tert-butylphosphino-2',4',6'-triisopropylbiphenyl; TTC: 2,3,5-triphenyltetrazolium chloride; HEPES: 4-hydroxyethylpiperazineethanesulfonic acid; EGTA: ethylene glycol bis(2-aminoethyl ether)tetraacetic acid; Na2-ATP: disodium adenosine triphosphate; -OBn: benzyloxy; flash: medium pressure preparation, flash column chromatography; 2M 1 M in THF: 2 mol / L tetrahydrofuran solution; 1 M in THF: 1 mol / L tetrahydrofuran solution. Unless otherwise specified, all chemical reagents were purchased from Shanghai Jizhi Biochemical Technology Co., Ltd.

[0132] The instrument model information involved in the experiment is as follows:

[0133] LCMS: Agilent 1260-G6125 liquid chromatography-mass spectrometry (LC-MS / MS) was used. Reaction monitoring and compound identification were performed using the default ESI mode, while pharmacokinetic (DMPK) testing was performed using the SIM mode.

[0134] Detection HPLC: Agilent 1260 high performance liquid chromatograph

[0135] Preparative HPLC: Xiaohe LC5100 preparative high performance liquid chromatography

[0136] NMR instrument: Oxford Quantum-1plus AS400 NMR

[0137] Medium-pressure preparation instrument (flash, rapid column chromatography): Airs AP-200 medium-pressure preparation instrument

[0138] Unless otherwise specified, preparative HPLC uses a gradient elution from 10% acetonitrile / water to 100% acetonitrile / water, with 0.05% trifluoroacetic acid added to the mobile phase; LCMS uses a gradient elution from 10% acetonitrile / water to 100% acetonitrile, with 0.1% formic acid added to the mobile phase; for medium-pressure preparation, if the mobile phase is not specified, acetonitrile / water is used by default, with a gradient elution from 10% acetonitrile / water to 100% acetonitrile. The remaining two solvents will be listed, with a default gradient elution from 100% of the first solvent to 100% of the second solvent. If trifluoroacetic acid is added, the proportion of trifluoroacetic acid is fixed at 0.05%, and if ammonium bicarbonate is added, the proportion of ammonium bicarbonate is fixed at 0.05%.

[0139] Unless otherwise specified, the ratios of solvents or liquid reagents mentioned herein are by volume.

[0140] Example 1: 2-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0141] Synthesis route:

[0142] Step 1: 1-(3-Bromo-2-chlorophenyl)-N,N-dimethylmethanamine

[0143] 3-Bromo-2-chlorobenzaldehyde (0.6 g) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (15 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring, and the mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. After stirring at room temperature for 2 h, LCMS indicated the formation of the title compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and passed through a flash column chromatography (DCM / MeOH) to obtain 520 mg of the title compound as a yellow oil.

[0144] Step 2: 1-(3-(Benzylmercapto)-2-chlorophenyl)-N,N-dimethylmethanamine

[0145] 1-(3-Bromo-2-chlorophenyl)-N,N-dimethylmethanamine (520 mg) was weighed into a 40 mL microwave tube. Toluene (15 mL) and benzyl mercaptan (2 eq.) were added. DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction mixture was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 400 mg of the crude target compound as a yellow oil.

[0146] Step 3: 3-((Dimethylamino)methyl)-2-chlorobenzenesulfonamide

[0147] 6M HCl (0.3 mL) was placed in a 50 mL single-necked flask, and MeCN (5 mL) was added. The mixture was stirred and cooled. NCS (3 eq.) was added at 0°C to form a reaction solution. 1-(3-(Benzylmercapto)-2-chlorophenyl)-N,N-dimethylmethanamine (200 mg) was dissolved in 5 mL of MeCN and added dropwise to the reaction solution at 0°C. The mixture was stirred for 0.5 h. In a separate 100 mL single-necked flask, NH4OH (10 mL) was added. The reaction solution was added dropwise to NH4OH using a constant pressure dropping funnel while stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction solution was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (50 mL). The residue was dried and concentrated under reduced pressure to yield 210 mg of the target compound as a crude yellow oil.

[0148] Step 4: 2-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0149] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (100 mg) was weighed into a 40 mL single-necked vial. DCM (8 mL) and DIEA (5 eq.) were added. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 210 mg of crude 3-((dimethylamino)methyl)-2-chlorobenzenesulfonamide was dissolved in DCM (4 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly mixed with silica gel and flash-filtered (DCM / MeOH) to obtain the crude product. The crude product was then flash-filtered (0.05% NH4HCO3) and lyophilized to obtain 20 mg of the target compound as a white solid. MS: 448 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ8.15 (s, 1H), 7.92 (t, J = 7.2Hz, 1H), 7.56 (s, 1H), 7.40-7.32 (m, 1H), 6.8 0(s,1H),3.56(s,2H),2.74(t,J=7.2Hz,4H),2.64-2.54(m,4H),2.22(s,6H),1.93-1.85(m,4H).

[0150] Example 2: 5-((dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0151] Synthesis route:

[0152] Step 1: 1-(3-Bromo-4-fluorophenyl)-N,N-dimethylmethanamine

[0153] 3-Bromo-4-fluorobenzaldehyde (1.0 g) was weighed into a single-necked flask, followed by the addition of anhydrous methanol (15 mL) and a solution of dimethylamine in tetrahydrofuran (2 eq.). The mixture was stirred at room temperature overnight. Sodium cyanoborohydride (2 eq.) was added and stirred at room temperature for 1 hour. Workup and purification: LCMS indicated the formation of the title compound and complete reaction of the starting materials. The reaction mixture was purified by flash column chromatography on silica gel (dichloromethane / methanol, 0-100% methanol gradient) in the forward phase to afford 0.61 g of the title compound.

[0154] Step 2: 1-(3-(Benzylmercapto)-4-fluorophenyl)-N,N-dimethylmethanamine

[0155] 1-(3-Bromo-4-fluorophenyl)-N,N-dimethylmethanamine (450 mg) was weighed into a single-necked flask, followed by the addition of Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purification by flash column chromatography (dichloromethane / methanol, 0-100% methanol gradient) afforded 420 mg of the pure target compound.

[0156] Step 3: 5-((Dimethylamino)methyl)-2-fluorobenzenesulfonamide

[0157] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (6 mL) and 6M HCl (3 mL) and stir at 0°C for 15 min. Add 1-(3-(benzylmercapto)-4-fluorophenyl)-N,N-dimethylmethanamine (400 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (25 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 420 mg of the crude product.

[0158] Step 4: 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0159] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (5 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 5-((Dimethylamino)methyl)-2-fluorobenzenesulfonamide (400 mg) was placed in a single-necked vial, followed by the addition of DCM (5 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 191 mg of the product as a white solid. MS: 432 [M+H]+. 1 H NMR (400MHz, DMSO-d6) δ9.97(s,1H),8.56(s,1H),8.16(dd,J=6.9,2.1Hz,1H),7.88(dddd,J=8.3,6.9,4.5,2.2Hz,1H),7.65( dd,J=10.1,8.7Hz,1H),6.94(s,1H),4.39(d,J=7.4Hz,2H),2.82-2.69(m,13H),2.55(d,J=7.2Hz,2H),1.93(p,J=7.4Hz,4H).

[0160] Example 3: 3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0161] Synthesis route:

[0162] Step 1: (5-Bromo-2-methoxyphenyl)-N,N-dimethylmethanamine

[0163] 5-Bromo-2-methoxybenzaldehyde (3.0 g) was weighed into a single-necked flask. Dichloromethane (50 mL), dimethylamine tetrahydrofuran solution (2 eq.), and acetic acid (1 drop) were then added and stirred at room temperature for 15 minutes. Sodium acetate borohydride (4 eq.) was added and stirred at room temperature for 2 hours. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The reaction system was diluted with water, and the pH was adjusted to >7 with saturated sodium bicarbonate. The system was extracted with dichloromethane, dried, and concentrated to yield 3.6 g of the crude target compound.

[0164] Step 2: 1-(5-(Benzylmercapto)-2-methoxyphenyl)-N,N-dimethylmethanamine

[0165] Weigh (5-bromo-2-methoxyphenyl)-N,N-dimethylmethanamine (3.6 g) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (50 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 4.1 g of the pure target compound.

[0166] Step 3: 3-((Dimethylamino)methyl)-4-methoxybenzenesulfonamide

[0167] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (40 mL) and 6M HCl (12 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-methoxyphenyl)-N,N-dimethylmethanamine (4 g) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (200 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 2 g of crude product.

[0168] Step 4: ((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0169] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (20 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-4-methoxybenzenesulfonamide (2 g) was placed in a single-necked vial, followed by the addition of DCM (20 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA.H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3.H2O / MeCN) and lyophilization afforded 1.08 g of the product as a white solid. MS: 444 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.50(s,1H),8.20(s,1H),8.08-7.98(m,2H),7.35(d,J=8.8Hz,1H),6.92(s,1H) ,4.28(s,2H),3.94(s,3H),2.77(t,J=7.3Hz,4H),2.70(s,6H),2.54(d,J=7.3Hz,4H),1.96-1.89(m,4H).

[0170] Example 4: 4-(Benzyloxy-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0171] Synthesis route:

[0172] Step 1: (2-(Benzyloxy)-5-bromophenyl)-N,N-dimethylmethanamine

[0173] 2-(Benzyloxy)-5-bromobenzaldehyde (800 mg) was weighed into a single-necked flask. Dichloromethane (20 mL), dimethylamine tetrahydrofuran solution (2 eq.), and acetic acid (1 drop) were added and stirred at room temperature for 15 minutes. Sodium acetate borohydride (4 eq.) was added and stirred at room temperature for 2 hours. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The reaction mixture was diluted with water, and the pH was adjusted to >7 with saturated sodium bicarbonate. The mixture was extracted with dichloromethane, dried, and concentrated to yield 950 mg of the crude target compound.

[0174] Step 2: 1-(2-(Benzyloxy)-5-(Benzylmercapto)phenyl)-N,N-dimethylmethanamine

[0175] Weigh (2-(Benzyloxy)-5-bromophenyl)-N,N-dimethylmethanamine (950 mg) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (15 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify by flash column chromatography (dichloromethane / methanol) to obtain 790 mg of the pure target compound.

[0176] Step 3: 4-(Benzyloxy)-3-((dimethylamino)methyl)benzenesulfonamide

[0177] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (10 mL) and 6M HCl (5 mL) and stir at 0°C for 15 min. Add 1-(2-(benzyloxy)-5-(benzylmercapto)phenyl)-N,N-dimethylmethanamine (790 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (40 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 666 mg of the crude product.

[0178] Step 4: 4-(Benzyloxy)-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0179] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (6 mL) and DIEA (3 eq.). BTC (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 4-(Benzyloxy)-3-((dimethylamino)methyl)benzenesulfonamide (666 mg) was placed in a single-necked vial, followed by the addition of DCM (6 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA.H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3.H2O / MeCN) and lyophilization afforded 313 mg of the product as a white solid. MS: 520 [M+H] + .1 H NMR (400MHz, DMSO-d6) δ9.52(s,1H),8.42(s,1H),8.11(d,J=2.1Hz,1H),8.01(dd,J=8.8,2.1Hz,1H),7.52(d,J=7.4Hz,2H), 7.44-7.35(m,4H),6.92(s,1H),5.32(s,2H),4.38(s,2H),2.76(d,J=7.3Hz,10H),2.53(d,J=7.3Hz,4H),1.94-1.88(m,4H).

[0180] Example 5: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzenesulfonamide

[0181] Synthesis route:

[0182] 5-Bromo-2-methoxybenzaldehyde (3.5 g) was weighed into a single-necked flask, followed by the addition of anhydrous ethanol (100 mL) and palladium on carbon (0.2 eq.). The mixture was stirred at room temperature under a hydrogen atmosphere for 1 h. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting material. The reaction mixture was filtered, the filter cake rinsed three times with ethanol, and concentrated to obtain the crude product. Purification by flash column chromatography (NH₄HCO₃.H₂O / MeCN) and lyophilization afforded 512 mg of the product as a white solid. MS: 430 [M+H]+. 1 H NMR(400MHz,DMSO-d6)δ7.87(s,1H),7.69-7.61(m,2H),6.90-6.81(m,2H),3.65(s,2H), 2.76(t,J=7.3Hz,4H), 2.54(t,J=7.2Hz,4H), 2.28(s,6H), 1.89(dd,J=14.4,7.0Hz,4H).

[0183] Example 6: 3-((Dimethylamino)methyl)-4-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0184] Synthesis route:

[0185] Step 1: (5-Bromo-2-fluorobenzene)-N,N-dimethylmethanamine

[0186] 5-Bromo-2-fluorobenzaldehyde (2.0 g) was weighed into a single-necked flask, followed by the addition of anhydrous methanol (30 mL) and a solution of dimethylamine in tetrahydrofuran (2 eq.). The mixture was stirred at room temperature overnight. Sodium cyanoborohydride (2 eq.) was added and stirred at room temperature for 1 hour. Workup and purification: LCMS indicated the formation of the title compound and complete reaction of the starting materials. The reaction mixture was purified by flash column chromatography on silica gel (dichloromethane / methanol) in the normal phase to afford 0.88 g of the title compound.

[0187] Step 2: 1-(5-(Benzylmercapto)-2-fluorophenyl)-N,N-dimethylmethanamine

[0188] Weigh 1-(5-bromo-2-fluorophenyl)-N,N-dimethylmethanamine (600 mg) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 560 mg of the pure target compound.

[0189] Step 3: 3-((Dimethylamino)methyl)-4-fluorobenzenesulfonamide

[0190] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (6 mL) and 6M HCl (3 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-fluorophenyl)-N,N-dimethylmethanamine (540 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (25 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 600 mg of the crude product.

[0191] Step 4: 3-((Dimethylamino)methyl)-4-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0192] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (10 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-4-fluorobenzenesulfonamide (580 mg) was placed in a single-necked vial, followed by the addition of DCM (10 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and the complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 336 mg of the product as a white solid. MS:432[M+H]+. 1 H NMR (400MHz, DMSO-d6) δ10.23(s,1H),8.74(s,1H),8.28(dd,J=6.7,2.4Hz,1H),8.12(ddd,J=8.7,4.7,2.4Hz,1H),7.67-7. 56(m,1H),6.92(s,1H),4.44(d,J=9.8Hz,2H),2.77(d,J=5.0Hz,10H),2.54(d,J=7.2Hz,3H),1.93(tt,J=14.8,7.5Hz,5H).

[0193] Example 7: 4-amino-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0194] Synthesis route:

[0195] Step 1: 1-(5-Bromo-2-nitrophenyl)-N,N-dimethylmethanamine

[0196] 5-Bromo-2-nitrobenzaldehyde (1.5 g) was weighed into a 100 mL single-necked flask. A solution of dimethylamine in THF (6.5 mL, 2 M) and DCM (50 mL) were then added. NaBH(OAc)3 (6.9 g) and two drops of acetic acid were added portionwise, and the mixture was stirred at room temperature for 5 h. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The mixture was diluted with an appropriate amount of water, extracted three times with DCM, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. 1.3 g of the crude target compound was obtained as a white solid, which was used in the next step without further purification.

[0197] Step 2: 1-(5-(Benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine

[0198] Weigh 1-(5-bromo-2-nitrophenyl)-N,N-dimethylmethanamine (1.3 g) into a 100 mL single-necked flask, then add benzyl mercaptan (750 mg), Pd2(dba)3 (231 mg), XantPhos (175 mg), DTEA (1.3 g), and toluene (50 mL). Heat to 115°C and continue stirring overnight. Post-treatment and purification: TLC confirms complete reaction of the starting materials. Dilute the reaction system with an appropriate amount of water, extract the aqueous layer three times with ethyl acetate, and combine the organic phases. Wash twice with saturated brine, dry over anhydrous Na2SO4, and concentrate. Purify by column chromatography to obtain 730 mg of the target compound as a yellow solid.

[0199] Step 3: 3-((Dimethylamino)methyl)-4-nitrobenzenesulfonamide

[0200] To a 25mL single-necked flask, add 6mL of acetonitrile and 1.9mL of 6N aqueous HCl, respectively. Cool to below 0°C and add NCS (1.28g) portionwise. Then, add dropwise a solution of 1-(5-(benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine (730mg) in acetonitrile. After stirring at room temperature for 1 hour, TLC confirmed complete reaction of the starting material. Slowly add dropwise to aqueous ammonia (30mL) and continue stirring overnight. Post-processing and purification: TLC confirmed complete reaction of the starting material. Purify by concentrating column chromatography (dichloromethane / methanol) to obtain 510mg of the desired product as a white solid.

[0201] Step 4: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacenyl-yl)carbamoyl)-4-nitrobenzenesulfonamide

[0202] 3-((Dimethylamino)methyl)-4-nitrobenzenesulfonamide (510 mg), 1,2,3,5,6,7-hexahydro-s-indacene-4-amine (341 mg), DIEA (508 mg), and DCM (50 mL) were placed in a 100 mL single-necked vial. Triphosgene (583 mg) was added portionwise at room temperature. The mixture was heated to 50°C and stirred for 12 h. Post-processing and purification: TLC confirmed complete reaction of the starting materials. The product was purified by column chromatography (petroleum ether / ethyl acetate, 0-100% ethyl acetate gradient) to yield 173 mg of the desired product as a yellow solid.

[0203] Step 5: 4-amino-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0204] 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacenyl)carbamoyl)-4-nitrobenzenesulfonamide (120 mg), zinc powder (95 mg), saturated NH4Cl solution (5 mL), and ethanol (15 mL) were weighed into a 50 mL single-necked flask and stirred at reflux overnight. Post-treatment and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Concentrate, extract the aqueous layer three times with ethyl acetate, combine the organic phases, dry, and concentrate. Purify by preparative HPLC, and lyophilize to obtain 85 mg of the trifluoroacetate salt of the white solid product. MS: 429 [M+H] + . 1 H NMR(400MHz,DMSO)δ8.82(s,1H),7.66-7.45(m,2H),6.89(s,1H),6.72(d,J=8.6Hz,1H),3 .34(s,6H),2.76(t,J=7.3Hz,4H),2.55(t,J=7.3Hz,4H),2.50(s,2H),2.06-1.82(m,6H).

[0205] Example 8: 4-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0206] Synthesis route:

[0207] Step 1: (5-Bromo-2-chlorophenyl)-N,N-dimethylmethanamine

[0208] 5-Bromo-2-chlorobenzaldehyde (2.0 g) was weighed into a single-necked flask, followed by the addition of anhydrous methanol (30 mL) and a solution of dimethylamine in tetrahydrofuran (2 eq.). The mixture was stirred at room temperature overnight. Sodium cyanoborohydride (2 eq.) was added and stirred at room temperature for 1 hour. Workup and purification: LCMS indicated the formation of the title compound and complete reaction of the starting materials. The reaction mixture was purified by flash column chromatography on silica gel (dichloromethane / methanol) in the normal phase to afford 1.3 g of the title compound.

[0209] Step 2: 1-(5-(Benzylmercapto)-2-chlorophenyl)-N,N-dimethylmethanamine

[0210] Weigh 1-(5-bromo-2-chlorophenyl)-N,N-dimethylmethanamine (800 mg) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 840 mg of the pure target compound.

[0211] Step 3: 4-Chloro-3-((dimethylamino)methyl)benzenesulfonamide

[0212] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (8 mL) and 6M HCl (4 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-chlorophenyl)-N,N-dimethylmethanamine (840 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (35 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 810 mg of the crude product.

[0213] Step 4: 4-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0214] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (10 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 4-Chloro-3-((dimethylamino)methyl)benzenesulfonamide (800 mg) was placed in a single-necked vial, followed by the addition of DCM (10 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and the complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 89 mg of the product as a white solid. MS:448[M+H]+. 1H NMR (400MHz, DMSO-d6) δ10.02(s,1H),8.77(s,1H),8.31(d,J=2.1Hz,1H),8.03(dd,J=8.5,2.2Hz,1H),7.88(d,J= 8.5Hz,1H),6.92(s,1H),4.53(s,2H),2.78(d,J=12.8Hz,10H),2.54(d,J=7.2Hz,3H),1.92(h,J=8.1,7.5Hz,4H).

[0215] Example 9: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-(trifluoromethoxy)benzenesulfonamide

[0216] Synthesis route:

[0217] Step 1: 1-(5-Bromo-2-(trifluoromethoxy)phenyl)-N,N-dimethylmethanamine

[0218] Weigh 5-bromo-2-(trifluoromethoxy)benzaldehyde (200 mg) into a single-necked flask, then add DCM (10 mL), dimethylamine tetrahydrofuran solution (2 eq.), and acetic acid (1 drop). Stir at room temperature for 15 minutes. Add STAB (4 eq.) and stir at room temperature for 2 hours. Workup and purification: LCMS indicates formation of the title compound and complete reaction of the starting materials. Dilute the system with an appropriate amount of DCM, adjust the pH to >7 with saturated sodium bicarbonate, and wash with water three times and once with saturated brine. Dry the organic phase and concentrate. 220 mg of crude title compound is obtained.

[0219] Step 2: 1-(5-(Benzylmercapto)-2-(trifluoromethoxy)phenyl)-N,N-dimethylmethanamine

[0220] Weigh 1-(5-bromo-2-(trifluoromethoxy)phenyl)-N,N-dimethylmethanamine (200 mg) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 193 mg of the pure target compound.

[0221] Step 3: 3-((Dimethylamino)methyl)-4-(trifluoromethoxy)benzenesulfonamide

[0222] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (5 mL) and 6M HCl (2 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-(trifluoromethoxy)phenyl)-N,N-dimethylmethanamine (160 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (10 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 150 mg of the crude product.

[0223] Step 4: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-(trifluoromethoxy)benzenesulfonamide

[0224] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (5 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-4-(trifluoromethoxy)benzenesulfonamide (120 mg) was placed in a 250 mL single-necked vial, followed by the addition of DCM (5 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and the complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 61 mg of the product as a white solid. MS:498[M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.02(s,1H),8.57(s,1H),8.36(d,J=2.1Hz,1H),8.17(dd,J=8.8,2.1Hz,1H),7.8 1-7.74(m,1H),6.93(s,1H),4.46(s,2H),2.76(d,J=9.4Hz,11H),2.52-2.51(m,3H),1.90(p,J=7.4Hz,4H).

[0225] Example 10: 2-Chloro-5-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0226] Synthesis route:

[0227] Step 1: 1-(3-Bromo-4-chlorophenyl)-N,N-dimethylmethanamine

[0228] Weigh 3-bromo-4-chlorobenzaldehyde (1.0 g) into a 100 mL single-necked flask, then add dimethylamine (2.3 mL, 2 M) in THF and DCM (30 mL). Add NaBH(OAc)3 (4.84 g) in batches and two drops of acetic acid. Stir at room temperature for 5 h. Post-processing and purification: LCMS indicated the formation of the title compound and complete reaction of the starting materials. Dilute the system with an appropriate amount of water, extract with DCM three times, wash with saturated brine, dry the organic phase over anhydrous sodium sulfate, and concentrate. This yielded 920 mg of the crude title compound as a white solid, which was used in the next step without further purification.

[0229] Step 2: 1-(5-(Benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine

[0230] Weigh 1-(3-bromo-4-chlorophenyl)-N,N-dimethylmethanamine (920 mg) into a 100 mL single-necked flask, then add benzyl mercaptan (750 mg), Pd2(dba)3 (231 mg), XantPhos (175 mg), DTEA (1.3 g), and toluene (50 mL). Heat to 115°C and continue stirring overnight. Post-treatment and purification: TLC confirms complete reaction of the starting materials. Dilute the reaction system with an appropriate amount of water, extract the aqueous layer three times with ethyl acetate, and combine the organic phases. Wash twice with saturated brine, dry over anhydrous NaSO4, and concentrate. Purify by column chromatography to obtain 380 mg of the target compound as a yellow-brown solid.

[0231] Step 3: 2-Chloro-5-((dimethylamino)methyl)benzenesulfonamide

[0232] To a 25mL single-necked flask, add 6mL of acetonitrile and 1mL of 6N aqueous HCl, respectively. Cool to 0°C and add NCS (694.7mg) portionwise. Then, add dropwise a solution of 1-(5-(benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine (380mg) in acetonitrile. After stirring at room temperature for 1 hour, TLC confirmed complete reaction of the starting material. Slowly add dropwise to aqueous ammonia (20mL) and continue stirring overnight. Post-processing and purification: TLC confirmed complete reaction of the starting material. Purify by concentrating column chromatography (dichloromethane / methanol) to obtain 160mg of the desired product as a white solid.

[0233] Step 4: 2-Chloro-5-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0234] 2-Chloro-5-((dimethylamino)methyl)benzenesulfonamide (150 mg), 1,2,3,5,6,7-hexahydro-s-indacene-4-amine (105 mg), DIEA (195 mg) and DCM (30 mL) were weighed into a 100 mL single-necked bottle and triphosgene (174 mg) was added portionwise at room temperature. The temperature was raised to 50°C and stirred for 12 h. Post-processing and purification: LCMS confirmed the formation of the target compound and the complete reaction of the starting materials. The mixture was concentrated, and the aqueous layer was extracted three times with ethyl acetate. The organic phases were combined, dried, and concentrated. The product was purified by preparative HPLC (acetonitrile / water binary mobile phase, acetonitrile ratio 10-100% gradient, 0.05% trifluoroacetic acid added to the mobile phase) and lyophilized to obtain 160 mg of the trifluoroacetate salt of the white solid product. MS: 448 [M+H] + . 1 H NMR(400MHz,DMSO)δ8.59(s,1H),8.13(s,1H),8.08(s,1H),7.62-7.55(m,2H),6.85(s,1H) ,3.90(s,2H),2.74(t,J=7.3Hz,4H),2.58(t,J=7.0Hz,4H),2.42(s,6H),1.92-1.85(m,4H).

[0235] Example 11: 5-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide

[0236] Synthesis route:

[0237] Step 1: 1-(3-Bromo-4-nitrophenyl)-N,N-dimethylmethanamine

[0238] 3-Bromo-4-nitrobenzaldehyde (1.0 g) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (30 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (30 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and purified by flash column chromatography (DCM / MeOH) to obtain 1.0 g of the crude target compound as a yellow oil.

[0239] Step 2: 1-(3-(Benzylmercapto)-4-nitrophenyl)-N,N-dimethylmethanamine

[0240] 1-(3-Bromo-4-nitrophenyl)-N,N-dimethylmethanamine (1.0 g) was weighed into a 40 mL microwave tube. Toluene (15 mL), benzyl mercaptan (2 eq.), DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 1.0 g of the crude target compound as a yellow oil.

[0241] Step 3: 5-((Dimethylamino)methyl)-2-nitrobenzenesulfonamide

[0242] 6M HCl (2.8 mL) was placed in a 50 mL single-necked bottle. MeCN (15 mL) was added and the mixture was stirred and cooled to 0°C. NCS (4 eq.) was added. 1-(3-(Benzylmercapto)-4-nitrophenyl)-N,N-dimethylmethanamine (1.0 g) was dissolved in 10 mL of MeCN and added dropwise to the reaction mixture at 0°C. The mixture was stirred for 0.5 h. In a separate 100 mL single-necked bottle, NH₄OH (50 mL) was added and the reaction mixture was added dropwise to NH₄OH with stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 v / v (50 mL). The mixture was dried and concentrated under reduced pressure to afford 1.2 g of the target compound as a crude yellow oil.

[0243] Step 4: 5-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide

[0244] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (400 mg) was weighed into a 40 mL single-necked vial. DCM (10 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 800 mg of crude 5-((dimethylamino)methyl)-2-nitrobenzenesulfonamide was dissolved in DCM (5 mL) and DIEA (3 eq.). After complete dissolution, the solution was added dropwise to the reaction mixture at 50°C. The reaction was continued at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly mixed with silica gel and passed through a flash column (DCM / MeOH) to obtain the crude product. The crude product was purified by flash column chromatography (acetonitrile / water gradient elution, acetonitrile ratio 0-100%, 0.05% NH4HCO3 added to the mobile phase) and lyophilized to obtain 240 mg of the target compound as a white solid. MS:459[M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.70(s,1H),8.17(s,1H),7.77(d,J=8.2Hz,1H),7.66(d,J=8.2Hz,2H),6.8 0(s,1H),4.13(s,2H),2.74(t,J=7.6Hz,4H),2.63(t,J=7.4Hz,4H),2.57(s,6H),1.93~1.83(m,4H).

[0245] Example 12: 2-amino-5-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0246] Synthesis route:

[0247] 5-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide (140 mg) was weighed into a 40 mL single-necked vial. EtOH (6 mL) and H₂O (3 mL) were added. Zinc powder (15 eq.) and ammonium chloride (5 eq.) were added with stirring at room temperature. After addition, the reaction mixture was heated to 60°C for 4 h. LCMS confirmed the formation of the target compound and complete reaction of the starting material. Workup and purification: The reaction mixture was filtered through celite. The filter cake was rinsed with 100 mL of DCM / MeOH (10 / 1 v / v). The filtrate was concentrated, and the remaining crude product was passed through a flash column. The crude product was purified by flash column chromatography (0.05% NH₄HCO₃) and lyophilized to obtain the target compound as a white solid (240 mg). MS: 429 [M+H] + . 1 H NMR(400MHz,DMSO-d6)δ9.52(s,1H),8.20-7.96(m,1H),7.65-7.55(m,1H),7.34-7.19(m,1H),7.00-6.71(m,2H ),6.33(s,1H),3.94(s,1H),3.85(s,1H),2.79-2.68(m,4H),2.60-2.53(m,4H),2.50(s,6H),1.99-1.86(m,4H).

[0248] Example 13: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0249] Synthesis route:

[0250] Step 1: N-(5-bromo-2-methoxybenzyl)-N-ethylethanamine

[0251] Weigh 5-bromo-2-methoxybenzaldehyde (1 g) into a single-necked flask, then add dichloromethane (30 mL), diethylamine (5 eq.), and acetic acid (1 drop). Stir at room temperature for 15 minutes. Add sodium acetate borohydride (5 eq.) and stir at room temperature overnight. Workup and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. Dilute the reaction system with water, adjust the pH to >7 with saturated sodium bicarbonate, extract the system with dichloromethane, dry, and concentrate to yield 1.3 g of the crude target compound.

[0252] Step 2: N-(5-(Benzylmercapto)-2-methoxybenzyl)-N-ethylethanamine

[0253] Weigh N-(5-bromo-2-methoxybenzyl)-N-ethylethanamine (1 g) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (15 mL), and benzylmercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 900 mg of the pure target compound.

[0254] Step 3: 3-((Diethylamino)methyl)-4-methoxybenzenesulfonamide

[0255] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (10 mL) and 6M HCl (5 mL) and stir at 0°C for 15 min. Add N-(5-(benzylmercapto)-2-methoxybenzyl)-N-ethylethanamine (800 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (40 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 621 mg of the crude product.

[0256] Step 4: ((Diethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0257] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (6 mL) and DIEA (3 eq.). BTC (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Diethylamino)methyl)-4-methoxybenzenesulfonamide (500 mg) was placed in a single-necked vial, followed by the addition of DCM (6 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA.H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3.H2O / MeCN) and lyophilization afforded 40 mg of the product as a white solid. MS: 472 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.05(s,1H),8.48(s,1H),8.12-7.89(m,2H),7.40-7.29(m,1H),6.92(s,1H),4.33(dd,J=11.0,5.0Hz,2H),3.94(d,J =5.8Hz,3H),3.09(dd,J=11.4,6.1Hz,4H),2.76(d,J=7.4Hz,4H),2.55(d,J=7.3Hz,2H),1.91(p,J=7.4Hz,4H),1.23(dt,J=14.4,7.2Hz,8H).

[0258] Example 14: 3-((Dimethylamino)methyl)-4-ethoxy-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0259] Synthesis route:

[0260] Step 1: 5-Bromo-2-ethoxybenzaldehyde

[0261] 5-Bromo-2-hydroxybenzaldehyde (1.0 g) was weighed into a single-necked flask, followed by the addition of DMF (20 mL), potassium carbonate (2 eq.), and iodoethane (1.2 eq.), and the mixture was stirred at 60°C for 2 h. Post-processing and purification: LCMS confirmed the formation of the title compound. The reaction mixture was then purified by flash column chromatography (dichloromethane / methanol) on silica gel in the normal phase to afford 1.1 g of the title compound.

[0262] Step 2: (5-Bromo-2-ethoxyphenyl)-N,N-dimethylmethanamine

[0263] Weigh 5-bromo-2-ethoxybenzaldehyde (1.0 g) into a single-necked flask, then add dichloromethane (20 mL), dimethylamine tetrahydrofuran solution (2 eq.), and acetic acid (1 drop). Stir at room temperature for 15 minutes. Add sodium acetate borohydride (4 eq.) and stir at room temperature for 2 hours. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. Dilute the reaction system with water, adjust the pH to >7 with saturated sodium bicarbonate, extract the system with dichloromethane, dry, and concentrate to obtain 1.3 g of crude target compound.

[0264] Step 3: 1-(5-(Benzylmercapto)-2-ethoxyphenyl)-N,N-dimethylmethanamine

[0265] (5-Bromo-2-ethoxyphenyl)-N,N-dimethylmethanamine (600 mg) was weighed into a single-necked flask, followed by the addition of Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purification by flash column chromatography (dichloromethane / methanol, ratio) afforded 660 mg of the pure target compound.

[0266] Step 4: 3-((Dimethylamino)methyl)-4-ethoxybenzenesulfonamide

[0267] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (10 mL) and 6M HCl (5 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-ethoxyphenyl)-N,N-dimethylmethanamine (600 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (40 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 350 mg of the crude product.

[0268] Step 5: 3-((Dimethylamino)methyl)-4-ethoxy-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0269] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (8 mL) and DIEA (3 eq.). BTC (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-4-ethoxybenzenesulfonamide (300 mg) was placed in a single-necked vial, followed by the addition of DCM (8 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 189 mg of the product as a white solid. MS: 458 [M+H]+. 1H NMR (400MHz, DMSO-d6) δ9.57(s,1H),8.50(s,1H),8.10(d,J=2.3Hz,1H),8.03(dd,J=8.8,2.3Hz,1H),7.36(d,J=8.9Hz,1H),6.94(s,1H) ,4.35(s,2H),4.24(q,J=7.0Hz,2H),2.78(d,J=6.5Hz,10H),2.56(d,J=7.3Hz,4H),1.95(dp,J=14.8,7.4Hz,4H),1.42(t,J=6.9Hz,3H).

[0270] Example 15: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-isopropoxybenzenesulfonamide

[0271] Synthesis route:

[0272] Step 1: 4-Bromo-2-((dimethylamino)methyl)phenol

[0273] 5-Bromo-2-hydroxybenzaldehyde (3.0 g) was weighed into a single-necked flask, followed by the addition of anhydrous methanol (50 mL) and a solution of dimethylamine in tetrahydrofuran (2 eq.). The mixture was stirred at room temperature overnight. Sodium cyanoborohydride (2 eq.) was added and stirred at room temperature for 1 hour. Workup and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The reaction mixture was purified by flash column chromatography on silica gel (dichloromethane / methanol) in the normal phase to afford 2.3 g of the target compound.

[0274] Step 2: 4-(Benzylmercapto)-2-((dimethylamino)methyl)phenol

[0275] Weigh 4-bromo-2-((dimethylamino)methyl)phenol (2.1 g) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (25 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 2.5 g of the pure target compound.

[0276] Step 3: 1-(5-(Benzylmercapto)-2-isopropoxyphenyl)-N,N-dimethylmethanamine

[0277] 4-(Benzylmercapto)-2-((dimethylamino)methyl)phenol (500 mg) was weighed into a single-necked flask. DMF (5 mL), potassium carbonate (2 eq.), and 2-bromopropane (1.1 eq.) were then added and stirred at 60°C for 2 h. Post-processing and purification: LCMS confirmed the formation of the title compound. The reaction mixture was purified by forward phase flash column chromatography (dichloromethane / methanol) on silica gel to afford 200 mg of the title compound.

[0278] Step 4: 3-((Dimethylamino)methyl)-4-isopropoxybenzenesulfonamide

[0279] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (4 mL) and 6M HCl (1.5 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-2-isopropoxyphenyl)-N,N-dimethylmethanamine (170 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (15 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 95 mg of the crude product.

[0280] Step 5: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-isopropoxybenzenesulfonamide

[0281] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (3 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-4-isopropoxybenzenesulfonamide (95 mg) was placed in a single-necked vial, followed by the addition of DCM (3 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 16 mg of the product as a white solid. MS: 472 [M+H]+. 1H NMR (400MHz, DMSO-d6) δ9.65(s,1H),8.57(s,1H),8.11(d,J=2.3Hz,1H),8.01(dd,J=8.9,2.3Hz,1H),7.39(d,J=9.0Hz,1H),6.94(s,1H),4.87 (dq,J=11.8,6.0Hz,1H),4.32(s,2H),2.78(d,J=7.1Hz,11H),2.70(t,J=7.2Hz,1H),2.56(s,2H),1.92(p,J=7.3Hz,4H),1.37(d,J=6.0Hz,6H).

[0282] Example 16: 3-((Dimethylamino)methyl)-5-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0283] Synthesis route:

[0284] Step 1: 5-Bromo-3-fluoro-2-methoxybenzaldehyde

[0285] 5-Bromo-3-fluoro-2-hydroxybenzaldehyde (0.8 g) was weighed into a single-necked flask, followed by the addition of DMF (20 mL), potassium carbonate (2 eq.), and iodomethane (1.2 eq.), and the mixture was stirred at 60°C for 2 h. Post-processing and purification: LCMS confirmed the formation of the title compound. The reaction mixture was then purified by flash column chromatography (dichloromethane / methanol) on silica gel in the normal phase to afford 0.67 g of the title compound.

[0286] Step 2: 1-(5-Bromo-3-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine

[0287] 5-Bromo-3-fluoro-2-methoxybenzaldehyde (0.67 g) was weighed into a single-necked flask. Dichloromethane (20 mL), dimethylamine tetrahydrofuran solution (2 eq.), and acetic acid (1 drop) were then added and stirred at room temperature for 15 minutes. Sodium acetate borohydride (4 eq.) was added and stirred at room temperature for 2 hours. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The reaction system was diluted with water, and the pH was adjusted to >7 with saturated sodium bicarbonate. The system was extracted with dichloromethane, dried, and concentrated to yield 0.47 g of the crude target compound.

[0288] Step 3: 1-(5-(Benzylmercapto)-3-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine

[0289] Weigh 1-(5-bromo-3-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine (400 mg) into a single-necked flask, then add Pd2(dba)3 (0.1 eq.), Xantphos (0.2 eq.), diisopropylethylamine (2 eq.), toluene (10 mL), and benzyl mercaptan (1.5 eq.). Stir overnight at 110°C under nitrogen. Post-processing and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. Filter the reaction mixture, rinse the filter cake with dichloromethane, and concentrate the filtrate to obtain the crude product. Purify the product by flash column chromatography (dichloromethane / methanol) to obtain 480 mg of the pure target compound.

[0290] Step 4: 3-((Dimethylamino)methyl)-5-fluoro-4-methoxybenzenesulfonamide

[0291] Weigh NCS (4 eq.) into a single-necked flask, then add acetonitrile (10 mL) and 6M HCl (5 mL) and stir at 0°C for 15 min. Add 1-(5-(benzylmercapto)-3-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine (400 mg) and stir at 0°C for 1 h. Slowly add the reaction system dropwise to aqueous ammonia (40 mL) and stir at room temperature for 1 h. Post-processing and purification: LCMS confirms the formation of the target compound. Extract the reaction system three times with appropriate amounts of DCM. Combine the organic phases, wash once with saturated brine, and concentrate to yield 270 mg of the crude product.

[0292] Step 5: 3-((Dimethylamino)methyl)-5-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0293] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (1 eq.) was placed in a single-necked vial, followed by the addition of DCM (8 mL) and DIEA (3 eq.). Triphosgene (0.5 eq.) was added at 0°C and stirred at 50°C for 1 hour (referred to as System A). 3-((Dimethylamino)methyl)-5-fluoro-4-methoxybenzenesulfonamide (200 mg) was placed in a single-necked vial, followed by the addition of DCM (8 mL) and DIEA (3 eq.), and stirred at room temperature for 1 hour (referred to as System B). System B was slowly added to System A at room temperature and stirred at 50°C for 3 hours. Workup and purification: LCMS confirmed the formation of the target compound and the complete reaction of the starting material. The reaction mixture was concentrated and purified by flash column chromatography (TFA / H2O / MeCN) to obtain the crude product. Purification by flash column chromatography (NH4HCO3 / H2O / MeCN) and lyophilization afforded 58 mg of the product as a white solid. MS:462[M+H]+. 1H NMR (400MHz, DMSO-d6) δ10.40(s,1H),7.97(s,1H),7.77(s,1H),7.70(dd,J=11.4,1.8Hz,1H),6.87(s,1H),3.95 (d,J=2.3Hz,3H),3.77(s,2H),2.76(t,J=7.3Hz,4H),2.56(t,J=7.1Hz,4H),2.50(s,6H),1.90(p,J=7.3Hz,4H).

[0294] Example 17: 3-((Dimethylamino)methyl)-5-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzenesulfonamide

[0295] Synthesis route:

[0296] 3-((Dimethylamino)methyl)-5-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide (40 mg) was weighed into a single-necked flask, followed by the addition of ultra-dry dichloromethane (3 mL). Boron tribromide (2 eq.) was added under nitrogen at 0°C, and the mixture was allowed to warm to room temperature and stirred overnight. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting material. Methanol was added to quench the reaction at 0°C. Purification by flash column chromatography (NH4HCO3.H2O / MeCN) and lyophilization afforded 5 mg of the product as a white solid. MS: 448 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ7.32(d,J=26.1Hz,2H),6.70(d,J=41.6Hz,1H),3.67(s,2H ),2.74(t,J=7.0Hz,3H),2.62(s,3H),2.50(s,4H),2.27(s,4H),1.92-1.84(m,4H).

[0297] Example 18: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide

[0298] Synthesis route:

[0299] Step 1: 1-(3-Bromo-2-nitrophenyl)-N,N-dimethylmethanamine

[0300] 3-Bromo-2-nitrobenzaldehyde (600 mg) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (25 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (30 mL). The organic phases were combined, washed with saturated brine, dried, and rotary evaporated. Flash column chromatography (DCM / MeOH) afforded 520 mg of the crude title compound as a yellow oil.

[0301] Step 2: 1-(3-(Benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine

[0302] 1-(3-Bromo-2-nitrophenyl)-N,N-dimethylmethanamine (520 mg) was weighed into a 40 mL microwave tube. Toluene (12 mL), benzyl mercaptan (2 eq.), DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Post-processing and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 420 mg of the crude target compound as a yellow oil.

[0303] Step 3: 3-((Dimethylamino)methyl)-2-nitrobenzenesulfonamide

[0304] 6M HCl (1.0 mL) was placed in a 50 mL single-necked bottle. MeCN (15 mL) was added, stirred, and cooled to 0°C. NCS (3 eq.) was added. 1-(3-(Benzylmercapto)-2-nitrophenyl)-N,N-dimethylmethanamine (420 mg) was dissolved in 10 mL of MeCN as the reaction solution. This solution was added dropwise to the single-necked bottle at 0°C and stirred for 0.5 h. In a separate 100 mL single-necked bottle, NH4OH (35 mL) was added. The reaction solution was added dropwise to NH4OH while stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction solution was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 v / v (50 mL). The product was dried and concentrated under reduced pressure to yield 0.5 g of the target compound as a crude yellow oil.

[0305] Step 4: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide

[0306] 300 mg of 1,2,3,5,6,7-hexahydro-s-indacen-4-amine was weighed into a 40 mL single-necked vial. DCM (10 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added with stirring at room temperature. The reaction mixture was heated to 50°C for 1 h. 500 mg of crude 3-((dimethylamino)methyl)-2-nitrobenzenesulfonamide was dissolved in DCM (5 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The reaction was continued at 50°C for 2 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH). The crude product was then purified by flash column chromatography (0.05% NH4HCO3) and lyophilized to obtain 280 mg of the target compound as a white solid. MS: 459 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.53(s,1H),8.09(d,J=7.6Hz,1H),7.94(s,1H),7.85(d,J=7.2Hz,1H),7.76(t,J=7.6 Hz,1H),6.90(s,1H),3.64(s,2H),2.78(t,J=7.2Hz,4H),2.60(t,J=7.0Hz,4H),2.27(s,6H),1.98-1.86(m,4H).

[0307] Example 19: 2-amino-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0308] Synthesis route:

[0309] 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-nitrobenzenesulfonamide (280 mg) was weighed into a 40 mL single-necked vial. EtOH (6 mL) and H₂O (3 mL) were added. Zinc powder (15 eq.) and ammonium chloride (5 eq.) were added with stirring at room temperature. After addition, the reaction mixture was heated to 60°C for 4 h. LCMS confirmed the formation of the target compound and complete reaction of the starting material. Workup and purification: The reaction mixture was filtered through Celite. The filter cake was rinsed with 100 mL of DCM / MeOH (10 / 1 v / v). The filtrate was concentrated, and the remaining crude product was passed through a flash column. The crude product was purified by flash column chromatography (0.05% NH₄HCO₃) and lyophilized to obtain 210 mg of the target compound as a white solid. MS: 429 [M+H]+ . 1 H NMR (400MHz, DMSO-d6) δ8.00(s,1H),7.63(d,J=8.4,Hz,1H),7.24(d,J=6.8Hz,1H),6.90(s,1H),6.62(t, J=7.6Hz,1H),3.56(s,2H),2.76(t,J=7.4Hz,4H),2.52(t,J=7.4Hz,4H),2.24(s,6H),1.95-1.86(m,4H).

[0310] Example 20: 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0311] Synthesis route:

[0312] Step 1: 5-Bromo-4-fluoro-2-methoxybenzaldehyde

[0313] 5-Bromo-4-fluoro-2-hydroxybenzaldehyde (1.0 g) was weighed into a 100 mL single-necked flask, followed by the addition of DMF (20 mL) and Cs2CO3 (3 eq.). CHCl (2 eq.) was then added with stirring at room temperature. The mixture was stirred at room temperature for 4 h. LCMS indicated the formation of the title compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with ethyl acetate. The organic phase was washed three times with water and then with saturated brine. The mixture was then dried and rotary evaporated to yield 1 g of the title compound as a yellow solid.

[0314] Step 2: 1-(5-bromo-4-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine

[0315] 5,5-Bromo-4-fluoro-2-methoxybenzaldehyde (1.0 g) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (30 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring, and the mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. After stirring at room temperature for 2 h, LCMS indicated the formation of the title compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (30 mL). The organic phases were combined, washed with saturated brine, dried, and rotary evaporated. Flash column chromatography (DCM / MeOH) afforded 800 mg of the crude title compound as a yellow oil.

[0316] Step 3: 1-(5-(Benzylmercapto)-4-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine

[0317] 1-(5-Bromo-4-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine (600 mg) was placed in a 40 mL microwave tube. Toluene (12 mL) and 8 drops of THF, benzyl mercaptan (2 eq.), DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the title compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 300 mg of the crude title compound as a yellow oil.

[0318] Step 4: 5-((Dimethylamino)methyl)-2-fluoro-4-methoxybenzenesulfonamide

[0319] 6M HCl (0.8 mL) was placed in a 50 mL single-necked bottle, and MeCN (10 mL) was added. The mixture was stirred and cooled to 0°C, followed by the addition of NCS (3 eq.). 1-(5-(Benzylmercapto)-4-fluoro-2-methoxyphenyl)-N,N-dimethylmethanamine (300 mg) was dissolved in 5 mL of MeCN and added dropwise to the reaction mixture at 0°C. The mixture was stirred for 0.5 h. In a separate 100 mL single-necked bottle, NH₄OH (25 mL) was added. The reaction mixture was then added dropwise to NH₄OH with stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 v / v (50 mL). The mixture was dried, concentrated under reduced pressure, and purified by flash column chromatography (0.05% NH₄HCO₃) to afford 60 mg of the target compound as a pale yellow solid.

[0320] Step 5: 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0321] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (100 mg) was weighed into a 40 mL single-necked vial. DCM (6 mL) and DIEA (5 eq.) were added. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 5-((Dimethylamino)methyl)-2-fluoro-4-methoxybenzenesulfonamide (60 mg) was dissolved in DCM (5 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then purified by flash column chromatography (acetonitrile / water, 0.05% NH4HCO3) and lyophilized to obtain 40 mg of the target compound as a white solid. MS: 462 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.24(s,1H),8.01-7.88(m,2H),7.17(d,J=12.0Hz,1H),6.87(s,1H),3.94 (s,2H),3.89(s,3H),2.76(t,J=7.2Hz,4H),2.57(t,J=7.2Hz,4H),2.50(s,6H),1.95-1.86(m,4H).

[0322] Example 21: 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzamide

[0323] Synthesis route:

[0324] 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide (30 mg) was weighed into a 20 mL single-necked vial and DCM (5 mL) was added. The temperature was cooled to 0°C under nitrogen. Three drops of BBr3 were added dropwise with a pipette. The mixture was warmed to room temperature and stirred for 2 hours. LCMS confirmed the formation of the target compound and the complete reaction of the starting material (if the starting material was not completely reacted, additional BBr3 was added). Post-treatment and purification: The reaction solution was cooled to 0°C and quenched by the addition of 0.5 mL of methanol. 3 mL of acetonitrile was added and the dichloromethane was removed by vortexing at low temperature. When a small amount of liquid remained, the reaction solution was purified by flash column chromatography. The crude product was purified by flash column chromatography (0.05% HCOOH) and lyophilized to obtain 210 mg of the target compound as a white solid. MS: 448 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ7.50(s,1H),6.81(s,1H),6.51(s,1H),3.57(s,2H),2.82-2.61(m,8H),2.25(s,6H),1.99-1.83(m,4H).

[0325] Example 22: 4-amino-5-((dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0326] Synthesis route:

[0327] Step 1: 1-(5-Bromo-4-fluoro-2-nitrophenyl)-N,N-dimethylmethanamine

[0328] 5-Bromo-4-fluoro-2-nitrobenzaldehyde (500 mg) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (25 mL). Dimethylmethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Post-treatment and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and purified by flash column chromatography (DCM / MeOH) to obtain 300 mg of the title compound as a yellow oil.

[0329] Step 2: 1-(5-(Benzylmercapto)-4-fluoro-2-nitrophenyl)-N,N-dimethylmethanamine

[0330] 1-(5-Bromo-4-fluoro-2-nitrophenyl)-N,N-dimethylmethanamine (300 mg) was weighed into a 40 mL microwave tube. Toluene (8 mL), benzyl mercaptan (2 eq.), DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the title compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 100 mg of the crude title compound as a yellow oil.

[0331] Step 3: 5-((Dimethylamino)methyl)-2-fluoro-4-nitrobenzenesulfonamide

[0332] 6M HCl (0.25 mL) was placed in a 50 mL single-necked bottle, and MeCN (15 mL) was added. The temperature was lowered to 0°C, and NCS (3 eq.) was added. 1-(5-(Benzylmercapto)-4-fluoro-2-nitrophenyl)-N,N-dimethylmethanamine (100 mg) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. The mixture was stirred for 0.5 h. In a separate 100 mL single-necked bottle, NH4OH (10 mL) was added. The reaction mixture was then added dropwise to NH4OH with stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (50 mL). The residue was dried and concentrated under reduced pressure to afford 125 mg of the target compound as a crude yellow oil.

[0333] Step 4: 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-nitrobenzenesulfonamide

[0334] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (100 mg) was weighed into a 40 mL single-necked vial. DCM (8 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 5-((Dimethylamino)methyl)-2-fluoro-4-nitrobenzenesulfonamide (125 mg) was dissolved in DCM (4 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then purified by flash column chromatography (0.05% NH4HCO3) and lyophilized to obtain 50 mg of the target compound as a white solid.

[0335] Step 5: 4-amino-5-((dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0336] 5-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-nitrobenzenesulfonamide (35 mg) was weighed into a 40 mL single-necked flask. EtOH (6 mL) and H₂O (3 mL) were added. Zinc powder (15 eq.) and ammonium chloride (5 eq.) were added with stirring at room temperature. After addition, the reaction mixture was heated to 60°C for 4 h. LCMS confirmed the formation of the target compound and complete reaction of the starting material. Post-processing and purification: The reaction mixture was filtered through Celite. The filter cake was rinsed with 100 mL of DCM / MeOH (10 / 1 v / v). The filtrate was concentrated. The remaining residue was purified by flash column chromatography (0.05% NH₄HCO₃) and lyophilized to obtain 10 mg of the target compound as a white solid. MS: 447 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.47(s,1H),7.88(s,1H),7.41(d,J=8.2Hz,1H),6.90(s,1H),6.54-6.30 (m,3H),3.36(s,2H),2.77(t,J=7.2Hz,4H),2.55(t,J=7.2Hz,4H),2.16(s,6H),1.97-1.88(m,4H).

[0337] Example 23: 3-((Dimethylamino)methyl)-2,4-difluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0338] Synthesis route:

[0339] Step 1: 1-(3-Bromo-2,6-difluorophenyl)-N,N-dimethylmethanamine

[0340] 3-Bromo-2,6-difluorobenzaldehyde (400 mg) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (20 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1) (30 mL). The organic phases were combined, washed with saturated brine, dried, and rotary evaporated. Flash column chromatography (DCM / MeOH) afforded 200 mg of the crude target compound as a yellow oil.

[0341] Step 2: 1-(3-(Benzylmercapto)-2,6-difluorophenyl)-N,N-dimethylmethanamine

[0342] 1-(3-Bromo-2,6-difluorophenyl)-N,N-dimethylmethanamine (200 mg) was weighed into a 40 mL microwave tube. Toluene (6 mL), SHBn (2 eq.), DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 120 mg of the crude target compound as a yellow oil.

[0343] Step 3: 3-((Dimethylamino)methyl)-2,4-difluorobenzenesulfonamide

[0344] 6M HCl (0.3 mL) was placed in a 50 mL single-necked bottle, and MeCN (6 mL) was added. The mixture was stirred and cooled to 0°C, followed by the addition of NCS (3 eq.). 1-(3-(Benzylmercapto)-2,6-difluorophenyl)-N,N-dimethylmethanamine (120 mg) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. The mixture was stirred for 0.5 h. In a separate 100 mL single-necked bottle, NH4OH (15 mL) was added. The reaction mixture was then added dropwise to NH4OH with stirring at room temperature. The mixture was stirred for 0.5 h. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH (10:1) (50 mL). The mixture was dried and concentrated under reduced pressure. The crude product was purified by flash column chromatography (acetonitrile / water, 10-100% acetonitrile, supplemented with 0.05% HCOOH) to afford 50 mg of the target compound as a pale yellow solid.

[0345] Step 4: 3-((Dimethylamino)methyl)-2,4-difluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0346] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (60 mg) was weighed into a 40 mL single-necked vial. DCM (6 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 3-((dimethylamino)methyl)-2,4-difluorobenzenesulfonamide (60 mg) was dissolved in DCM (3 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then purified by flash column chromatography (acetonitrile / water supplemented with 0.05% NH4HCO3) and lyophilized to obtain 15 mg of the target compound as a white solid. MS: 450 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.82(s,1H),7.98-7.88(m,2H),7.31(t,J=8.8Hz,1H),6.90(s,1H) ,3.77(s,2H),2.78(t,J=7.2Hz,4H),2.57(t,J=7.2Hz,4H),2.32(s,6H),1.97-1.88(m,4H).

[0347] Example 24: 3-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0348] Synthesis route:

[0349] Step 1: 1-(3-Bromo-2-fluorophenyl)-N,N-dimethylmethanamine

[0350] 3-Bromo-2-fluorobenzaldehyde (1.0 g) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (30 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Post-treatment and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (50 mL). The organic phases were combined, washed with saturated brine, dried, and rotary evaporated. The title compound was obtained by flash column chromatography (DCM / MeOH) as a yellow oil (900 mg).

[0351] Step 2: 1-(3-(Benzylmercapto)-2-fluorophenyl)-N,N-dimethylmethanamine

[0352] 1-(3-Bromo-2-fluorophenyl)-N,N-dimethylmethanamine (400 mg) was weighed into a 40 mL microwave tube. Toluene (15 mL) and benzyl mercaptan (2 eq.) were added. DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction mixture was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 100 mg of the crude target compound as a yellow oil.

[0353] Step 3: 3-((Dimethylamino)methyl)-2-fluorobenzenesulfonamide

[0354] 6M HCl (0.3 mL) was placed in a 50 mL single-necked bottle. MeCN (5 mL) was added, stirred, and cooled to 0°C. NCS (3 eq.) was added. 1-(3-(Benzylmercapto)-2-fluorophenyl)-N,N-dimethylmethanamine (200 mg) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h. In a separate 100 mL single-necked bottle, NH4OH (10 mL) was added. The reaction mixture was then dripped into NH4OH with stirring at room temperature. Stir for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (50 mL). After drying and concentration under reduced pressure, 95 mg of the target compound was obtained as a crude yellow oil.

[0355] Step 4: 3-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0356] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (100 mg) was weighed into a 40 mL single-necked vial. DCM (8 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 3-((Dimethylamino)methyl)-2-fluorobenzenesulfonamide (95 mg) was dissolved in DCM (4 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then lyophilized by flash column chromatography (acetonitrile / water, 0.05% NH4HCO3) to afford 80 mg of the target compound as a white solid. MS: 432 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.71(s,1H),7.97(s,1H),7.82(t,J=7.2Hz,1H),7.67(t,J=6.6Hz,1H),7.33(t,J=7.6 Hz,1H),6.86(s,1H),3.79(s,2H),2.75(t,J=7.2Hz,4H),2.55(t,J=6.8Hz,4H),2.35(s,6H),1.95-1.85(m,4H).

[0357] Example 25: 3-((Dimethylamino)methyl)-2,6-difluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0358] Synthesis route:

[0359] Step 1: 1-(3-Bromo-2,4-difluorophenyl)-N,N-dimethylmethanamine

[0360] 3-Bromo-2,4-difluorobenzaldehyde (600 mg) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (25 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1 v / v) (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and purified by flash column chromatography (DCM / MeOH) to afford 450 mg of the title compound as a yellow oil.

[0361] Step 2: 1-(3-(Benzylmercapto)-2,4-difluorophenyl)-N,N-dimethylmethanamine

[0362] 1-(3-Bromo-2,4-difluorophenyl)-N,N-dimethylmethanamine (450 mg) was weighed into a 40 mL microwave tube. Toluene (15 mL) and benzyl mercaptan (2 eq.) were added. DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and flash column chromatography (DCM / MeOH) was performed to obtain 400 mg of the crude target compound as a yellow oil.

[0363] Step 3: 3-((Dimethylamino)methyl)-2,6-fluorobenzenesulfonamide

[0364] 6M HCl (0.4 mL) was placed in a 50 mL single-necked bottle. MeCN (6 mL) was added, stirred, and cooled to 0°C. NCS (4 eq.) was added. 1-(3-(Benzylmercapto)-2,4-difluorophenyl)-N,N-dimethylmethanamine (200 mg) was dissolved in 4 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h. In a separate 100 mL single-necked bottle, NH4OH (10 mL) was added. The reaction mixture was then dripped into NH4OH with stirring at room temperature. Stir for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (50 mL). The mixture was dried and concentrated under reduced pressure to yield 200 mg of the target compound as a crude yellow oil.

[0365] Step 4: 3-((Dimethylamino)methyl)-2,6-difluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0366] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (120 mg) was weighed into a 40 mL single-necked vial. DCM (10 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 800 mg of crude 3-((dimethylamino)methyl)-2,6-fluorobenzenesulfonamide was dissolved in DCM (5 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The reaction was continued at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then lyophilized by flash column chromatography (0.05% NH4HCO3) to obtain 25 mg of the target compound as a white solid. MS: 450 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.49(s,1H),7.71(s,1H),7.64-7.55(m,1H),7.16(t,J=9.2Hz,1H),6.81 (s,1H),3.94(s,2H),2.75(t,J=7.2Hz,4H),2.60(t,J=7.2Hz,4H),2.48(s,6H),1.95-1.84(m,4H).

[0367] Example 26: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methylbenzenesulfonamide

[0368] Synthesis route:

[0369] Step 1: 1-(3-Bromo-2-methylphenyl)-N,N-dimethylmethanamine

[0370] 3-Bromo-2-methylbenzaldehyde (500 mg) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (25 mL). Dimethylamine (2 M in THF) (2 eq.) and HOAc (0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Post-treatment and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH = 10:1 v / v (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and purified by flash column chromatography (DCM / MeOH) to obtain 400 mg of the title compound as a yellow oil.

[0371] Step 2: 1-(3-(Benzylmercapto)-2-methylphenyl)-N,N-dimethylmethanamine

[0372] 1-(3-Bromo-2-methylphenyl)-N,N-dimethylmethanamine (400 mg) was weighed into a 40 mL microwave tube. Toluene (10 mL) and benzyl mercaptan (2 eq.) were added. DIEA (3 eq.), Pd2(dba)3 (0.1 eq.), and Xantphos (0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C and allowed to react for 12 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel, rotary evaporated, and purified by flash column chromatography (DCM / MeOH) to obtain the crude target compound. The crude product was then purified by flash column chromatography (0.05% HCOOH) to afford 50 mg of a yellow oil.

[0373] Step 3: 3-((Dimethylamino)methyl)-2-methylbenzenesulfonamide

[0374] 6M HCl (0.2 mL) was placed in a 50 mL single-necked bottle. MeCN (5 mL) was added, stirred, and cooled to 0°C. NCS (3 eq.) was added. 1-(3-(Benzylmercapto)-2-methylphenyl)-N,N-dimethylmethanamine (50 mg) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h. In a separate 50 mL single-necked bottle, NH4OH (8 mL) was added. The reaction mixture was then dripped into NH4OH with stirring at room temperature. Stir for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 v / v (50 mL). After drying, the mixture was concentrated under reduced pressure to yield 45 mg of the target compound as a crude yellow oil.

[0375] Step 4: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methylbenzenesulfonamide

[0376] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (50 mg) was weighed into a 40 mL single-necked vial. DCM (8 mL) and DIEA (5 eq.) were added portionwise. Triphosgene (0.4 eq.) was added portionwise with stirring at room temperature. The reaction mixture was heated to 50°C for 1 hour. 3-((Dimethylamino)methyl)-2-methylbenzenesulfonamide (45 mg) was dissolved in DCM (4 mL) and DIEA (3 eq.). Once dissolved, the solution was added dropwise to the reaction mixture at 50°C. The mixture was reacted at 50°C for 2 hours. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was directly applied to silica gel and purified by flash column chromatography (DCM / MeOH) to obtain the crude product. The crude product was then lyophilized by flash column chromatography (0.05% NH4HCO3) to obtain 80 mg of the target compound as a white solid.

[0377] MS:428[M+H] + .

[0378] 1 H NMR (400MHz, DMSO-d6) δ10.79(s,1H),8.10(s,1H),7.90(d,J=8.0Hz,1H),7.51(d,J=7.2Hz,1H),7.32(t,J=8.0Hz,1H) ,6.88(s,1H),3.60(s,2H),2.75(t,J=7.2Hz,4H),2.66(s,3H),2.52(t,J=7.2Hz,4H),2.25(s,6H),1.94-1.85(m,4H).

[0379] Example 27: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-hydroxybenzenesulfonamide

[0380] Synthesis route:

[0381] Step 1: 3-Bromo-2-methoxybenzaldehyde

[0382] 3-Bromo-2-hydroxybenzaldehyde (1.8 g, 1 eq.) was weighed into a 100 mL single-necked flask, and DMF (40 mL) and Cs2CO3 (5.85 g, 2 eq.) were added. CH3I (1.9 g, 1.5 eq.) was added with stirring at room temperature. The reaction was allowed to react for 2 h at room temperature. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of water, extracted with 60 mL of EA (2x), washed twice with water and saturated brine, dried, and mixed with silica gel for rotary evaporation. Purification by flash chromatography (PE / EA) afforded 1.8 g of the target compound as a pale yellow solid.

[0383] Step 2: 3-(Benzylmercapto)-2-methoxybenzaldehyde

[0384] 3-Bromo-2-methoxybenzaldehyde (900 mg, 1 eq.) was weighed into a 40 mL single-necked flask. Xylene (10 mL), benzyl mercaptan (780 mg, 1.5 eq.), DIEA (1.65 g, 3 eq.), Pd2(dba)3 (385 mg, 0.1 eq.), and Xantphos (486 mg, 0.2 eq.) were added under nitrogen. The reaction was heated to 125°C for 8 h. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was added to silica gel and rotary evaporated. The crude product was flash purified (PE / EA) to obtain 1.2 g of the target compound as a yellow oil.

[0385] Step 3: 1-(3-(Benzylmercapto)-2-methoxyphenyl)-N,N-dimethylmethanamine

[0386] 3-(Benzylmercapto)-2-methoxybenzaldehyde (1.2 g, 1 eq.) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (30 mL). Dimethylamine (2M in THF) (4.6 mL, 2 eq.) and HOAc (55 mg, 0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 3 h. After 2 h, NaBH(OAc)3 (3.45 g, 3.5 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1) (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and flash filtered (DCM / MeOH) to obtain 450 mg of the crude target compound as a yellow oil.

[0387] Step 4: 3-((Dimethylamino)methyl)-2-methoxybenzenesulfonamide

[0388] 6M HCl (1.5 mL) was placed in a 40 mL single-necked bottle. MeCN (6 mL) was added, stirred, and the temperature was lowered to 0°C. NCS (625 mg, 3 eq.) was added. 1-(3-(Benzylmercapto)-2-methoxyphenyl)-N,N-dimethylmethanamine (450 mg, 1 eq.) was dissolved in 4 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h to prepare a reserve solution. In a separate 100 mL single-necked bottle, NH4OH (15 mL) was added dropwise to the reserve solution at 0°C while stirring at room temperature. The mixture was warmed to room temperature and stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (30 mL). The mixture was dried and concentrated under reduced pressure to yield 500 mg of the target compound as a crude yellow oil.

[0389] Step 5: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methoxybenzenesulfonamide

[0390] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (354 mg, 1.0 eq.) was weighed into a 40 mL single-necked vial. DCM (10 mL) and DIEA (1.3 g, 5 eq.) were added portionwise. Triphosgene (242 mg, 0.4 eq.) was added with stirring at room temperature. After addition, the reaction mixture was heated to 50°C and allowed to react for 1 h. Crude 3-((dimethylamino)methyl)-2-methoxybenzenesulfonamide (500 mg, 1.0 eq.) was dissolved in DCM (5 mL) and DIEA (790 mg, 3 eq.). After complete dissolution, this solution was added dropwise to the reaction mixture at 50°C. The reaction was continued at 50°C for 2 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was directly added to silica gel and flash purified (DCM / MeOH) to yield 350 mg of an off-white solid.

[0391] Step 6: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-hydroxybenzenesulfonamide

[0392] 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methoxybenzenesulfonamide (200 mg, 1 eq.) was placed in a 25 mL single-necked vial. DCM (5 mL) was added, the temperature was lowered to 0°C, BBr (15 drops) was added dropwise, and the mixture was allowed to warm to room temperature for 4 hours. LCMS confirmed the formation of the target compound. Post-treatment and purification: The reaction mixture was quenched by the addition of 2 mL of methanol dropwise under an ice-water bath. 5 mL of MeCN was added, and the DCM was removed by vortexing at low temperature. The remaining liquid was flash purified (0.05% HCOOH) and lyophilized to obtain the target compound as a white solid (14 mg). MS: 430 [M+H] + . 1 H NMR(400MHz,DMSO-d6)δ8.18(s,1H),7.68(d,J=7.6Hz,1H),7.35(d,J=7.4,1H),6.86-6 .78(m,2H),4.15(s,2H),2.76(t,J=7.4Hz,4H),2.71-2.61(m,10H),1.98-1.86(m,4H).

[0393] Example 28: 2-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0394] Synthesis route:

[0395] Step 1: 3-Bromo-2-chloro-6-methoxybenzaldehyde

[0396] 3-Bromo-2-chloro-6-hydroxybenzaldehyde (610 mg, 1 eq.) was weighed into a 100 mL single-necked flask, and DMF (40 mL) and Cs2CO3 (1.7 g, 2 eq.) were added. CH3I (556 mg, 1.5 eq.) was added with stirring at room temperature. The mixture was allowed to react for 2 h at room temperature. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of water, extracted with 40 mL of EA (2x), washed twice with water, then with saturated brine, dried, and mixed with silica gel for rotary evaporation. Purification by flash chromatography (PE / EA) afforded 620 mg of the target compound as a pale yellow solid.

[0397] Step 2: 1-(3-Bromo-2-chloro-6-methoxyphenyl)-N,N-dimethylmethanamine

[0398] 3-Bromo-2-chloro-6-methoxybenzaldehyde (320 mg, 1 eq.) was weighed into a 100 mL single-necked flask, followed by the addition of DCM (15 mL). Dimethylamine (2M in THF) (1.3 mL, 2 eq.) and HOAc (17 mg, 0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (1.1 g, 4 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Workup and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1) (50 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and flash filtered (DCM / MeOH) to obtain 200 mg of the crude title compound as a yellow oil.

[0399] Step 3: 1-(3-(Benzylmercapto)-2-chloro-6-methoxyphenyl)-N,N-dimethylmethanamine

[0400] 1-(3-Bromo-2-chloro-6-methoxyphenyl)-N,N-dimethylmethanamine (200 mg, 1 eq.) was placed in a 20 mL microwave tube. Toluene (5 mL), benzyl mercaptan (135 mg, 1.5 eq.), DIEA (279 mg, 3 eq.), Pd2(dba)3 (66 mg, 0.1 eq.), and Xantphos (83 mg, 0.2 eq.) were added under nitrogen. The reaction was heated to 112°C for 24 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was added to silica gel and rotary evaporated. The crude product was flash washed (DCM / MeOH) to obtain 220 mg of the target compound as a yellow oil.

[0401] Step 4: 2-Chloro-3-((dimethylamino)methyl)-4-methoxybenzenesulfonamide

[0402] 6M HCl (0.5 mL) was placed in a 40 mL single-necked bottle. MeCN (4 mL) was added, stirred, and cooled to 0°C. NCS (274 mg, 3 eq.) was added. 1-(3-(Benzylmercapto)-2-chloro-6-methoxyphenyl)-N,N-dimethylmethanamine (220 mg, 1 eq.) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h to prepare a reserve solution. In a separate 100 mL single-necked bottle, NH₄OH (10 mL) was added dropwise to the reserve solution at 0°C. With stirring at room temperature, the mixture was warmed to room temperature and stirred for 0.5 h. LCMS confirmed the formation of the target compound. Workup and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (30 mL). The product was dried and concentrated under reduced pressure to yield 240 mg of the target compound as a crude yellow oil.

[0403] Step 5: 2-Chloro-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-methoxybenzenesulfonamide

[0404] 1,2,3,5,6,7-Hexahydro-s-indacen-4-amine (150 mg, 1.0 eq.) was weighed into a 40 mL single-necked vial. DCM (6 mL) and DIEA (560 mg, 5 eq.) were added portionwise. Triphosgene (102 mg, 0.4 eq.) was added with stirring at room temperature. After addition, the reaction mixture was heated to 50°C and allowed to react for 1 h. Crude 2-chloro-3-((dimethylamino)methyl)-4-methoxybenzenesulfonamide (240 mg, 1.0 eq.) was dissolved in DCM (3 mL) and DIEA (340 mg, 3 eq.). After complete dissolution, this solution was added dropwise to the reaction mixture at 50°C. The reaction was continued at 50°C for 2 h. LCMS confirmed the formation of the target compound. Post-treatment and purification: The reaction mixture was directly mixed with silica gel and flash purified (DCM / MeOH) to obtain a crude product. The crude product was flash purified (0.05% NH4HCO3) and lyophilized to obtain 25 mg of the title compound as a white solid. MS: 478 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.34(s,1H),8.02(d,J=9.2Hz,1H),7.96(s,1H),7.17(d,J=9.2Hz,1H),6.87(s,1 H),3.89(s,3H),3.79(s,2H),2.75(t,J=7.6Hz,4H),2.55(t,J=7.6Hz,4H),2.33(s,6H),1.96-1.84(m,4H).

[0405] Example 29: N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonamide

[0406] Synthesis route:

[0407] Step 1: 7-Bromo-2-methyl-1,2,3,4-tetrahydroisoquinoline

[0408] 7-Bromo-1,2,3,4-tetrahydroisoquinoline (2.5 g) was weighed into a 100 mL single-necked flask, followed by paraformaldehyde (3.5 g) and DCM (50 mL). NaBH(OAc)3 (7.5 g) and two drops of acetic acid were added portionwise, and the mixture was stirred at room temperature for 12 h. Post-processing and purification: LCMS indicated the formation of the target compound and complete reaction of the starting materials. The mixture was diluted with an appropriate amount of water and extracted with DCM (30 mL x 3). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. 2.2 g of the crude target compound was obtained as a white solid.

[0409] Step 2: 7-(Benzylmercapto)-2-methyl-1,2,3,4-tetrahydroisoquinoline

[0410] 7-Bromo-2-methyl-1,2,3,4-tetrahydroisoquinoline (1.0 g) was weighed into a 100 mL single-necked flask, followed by the addition of benzyl mercaptan (658 mg), Pd(dba) (200 mg, 0.05 eq.), XantPhos (128 mg), DIEA (1.14 g), and toluene (50 mL). The mixture was heated to 105°C and stirred overnight. Post-treatment and purification: TLC confirmed complete reaction of the starting materials. After cooling to room temperature, the reaction system was diluted with an appropriate amount of water. 6N HCl solution was added and stirred for 30 minutes. Extraction was performed with ethyl acetate, and the layers were separated. The organic phase was discarded, and the pH of the aqueous phase was adjusted to alkaline with aqueous ammonia. The aqueous layer was extracted three times with ethyl acetate, and the organic phases were combined. The reaction mixture was washed twice with saturated brine, dried over anhydrous NaSO, and concentrated. 920 mg of the crude target compound was obtained as a yellow solid.

[0411] Step 3: 2-Methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonamide

[0412] To a 50 mL single-necked flask, add acetonitrile (10 mL) and 6N HCl (1.7 mL) in water. Cool to 0°C and add NCS (1.0 g) portionwise. Then, add 7-(benzylmercapto)-2-methyl-1,2,3,4-tetrahydroisoquinoline (500 mg) in acetonitrile dropwise. After stirring at room temperature for 1 hour, the reaction mixture was slowly added dropwise to aqueous ammonia (30 mL) and stirred at room temperature for another 1 hour. Post-processing and purification: TLC confirmed complete reaction of the starting material. Concentration and purification by column chromatography (dichloromethane / methanol) afforded 320 mg of the desired product as a white solid.

[0413] Step 4: N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonamide

[0414] 2-Methyl-1,2,3,4-tetrahydroisoquinoline-7-sulfonamide (100 mg), phenyl (1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamate (129 mg), triethylamine (90 mg), and DCM (20 mL) were placed in a 100 mL single-necked vial and stirred at room temperature for 12 hours. Workup and purification: LCMS confirmed the formation of the target compound and complete reaction of the starting materials. The product was concentrated, purified by preparative HPLC, and lyophilized to afford the trifluoroacetate salt of the product as a white solid (150 mg). MS: 426 [M+H]+. 1 HNMR (400MHz, DMSO) δ8.02(s,1H),7.68(dd,J=8.1,2.0Hz,1H),7.63(d,J=2.0Hz,1H),7.34(d,J=8.1Hz,1H),6.90(s, 1H), 3.72 (s, 2H), 2.93 (t, J = 6.0Hz, 2H), 2.83-2.71 (m, 6H), 2.54 (t, J = 7.3Hz, 4H), 2.46 (s, 3H), 1.92 (p, J = 7.4Hz, 4H).

[0415] Example 30: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxy-2-methylbenzenesulfonamide

[0416] Synthesis route:

[0417] Step 1: 3-Bromo-6-methoxy-2-methylbenzaldehyde

[0418] Weigh 0.9 g, 1 eq. of 2-methoxy-6-methylbenzaldehyde into a 100 mL single-necked flask, then add DMF (20 mL). The temperature was lowered to 0°C, and NBS (1.6 g, 1.5 eq.) was added portionwise. After addition, the mixture was allowed to react for 2 h. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted with 50 mL of EA twice. The organic phase was washed with saturated brine, dried, and rotary evaporated. Purification by flash chromatography (PE / EA) afforded 0.95 g of the target compound as a pale yellow solid.

[0419] Step 2: 3-Bromo-6-hydroxy-2-methylbenzaldehyde

[0420] 3-Bromo-6-methoxy-2-methylbenzaldehyde (350 mg, 1 eq.) was weighed into a 25 mL single-necked vial. DCM (10 mL) was then added, the temperature was lowered to 0°C, and BBr (1.2 g, 3 eq.) was added dropwise. The mixture was incubated for 4 h. LCMS indicated the formation of the title compound. Post-treatment and purification: 0.5 mL of methanol was added dropwise under an ice bath to quench the reaction. The reaction mixture was poured into an appropriate amount of ice water and extracted with 30 mL of DCM twice. The organic phase was washed with saturated brine, dried, and purified by rotary evaporation. Purification by flash chromatography (PE / EA) afforded 250 mg of the title compound as an off-white solid.

[0421] Step 3: 6-(Benzyloxy)-3-bromo-2-methylbenzaldehyde

[0422] 3-Bromo-6-hydroxy-2-methylbenzaldehyde (250 mg, 1 eq.) was weighed into a 20 mL single-necked flask, and DMF (6 mL) and Cs2CO3 (760 mg, 2 eq.) were added. Benzyl chloride (275 mg, 1.5 eq.) was added with stirring at room temperature. The reaction was allowed to react overnight at room temperature. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of water, extracted with 30 mL of EA (2 x 30 mL), washed twice with water and saturated brine, dried, and mixed with silica gel for rotary evaporation. Purification by flash chromatography (PE / EA) afforded 280 mg of the target compound as a crude, pale yellow oil.

[0423] Step 4: 6-Benzyloxy-3-benzylmercapto-2-methylbenzaldehyde

[0424] 6-(Benzyloxy)-3-bromo-2-methylbenzaldehyde (280 mg, 1 eq.) was placed in a 20 mL microwave tube. Toluene (5 mL), benzyl mercaptan (225 mg, 2 eq.), DIEA (475 mg, 4 eq.), Pd2(dba)3 (84 mg, 0.1 eq.), and Xantphos (105 mg, 0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C for 24 h. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was added to silica gel and rotary evaporated. The crude product was flash purified (PE / EA) to yield 200 mg of the target compound as a yellow oil.

[0425] Step 5: 1-(6-(Benzyloxy)-3-(Benzylmercapto)-2-methylphenyl)-N,N-dimethylmethanamine

[0426] 6-Benzyloxy-3-benzylmercapto-2-methylbenzaldehyde (200 mg, 1 eq.) was weighed into a 40 mL single-necked flask, followed by the addition of DCM (10 mL). Dimethylamine (2M in THF) (0.57 mL, 2 eq.) and HOAc (7 mg, 0.2 eq.) were added with stirring. After stirring at room temperature for 2 h, NaBH(OAc)3 (425 mg, 3.5 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred for 2 h. LCMS indicated the formation of the title compound. Post-treatment and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1) (30 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and flash filtered (DCM / MeOH) to obtain 150 mg of the crude title compound as a yellow oil.

[0427] Step 6: 4-Benzyloxy-3-((dimethylamino)methyl)-2-methylbenzenesulfonamide

[0428] 6M HCl (0.4 mL) was placed in a 20 mL single-necked bottle. MeCN (6 mL) was added, and the mixture was stirred and cooled to 0°C. NCS (158 mg, 3 eq.) was added. 1-(6-(Benzyloxy)-3-(Benzylmercapto)-2-methylphenyl)-N,N-dimethylmethanamine (150 mg, 1 eq.) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h to prepare a reserve solution. In a separate 40 mL single-necked bottle, NH₄OH (6 mL) was added. The reserve solution was added dropwise to NH₄OH with stirring at room temperature and stirred for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (30 mL). The mixture was dried and concentrated under reduced pressure to afford 180 mg of the target compound as a crude yellow oil.

[0429] Step 7: 4-(Benzyloxy)-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methylbenzenesulfonamide

[0430] 4-Benzyloxy-3-((dimethylamino)methyl)-2-methylbenzenesulfonamide (180 mg, 1 eq.) was placed in a 25 mL single-necked flask. THF (6 mL) was added, followed by phenyl (1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamate (126 mg, 0.8 eq.). LiOH (20 mg, 1.5 eq.) was added while stirring at room temperature. The mixture was stirred at room temperature for 2 h. LCMS confirmed the formation of the target compound. For post-processing and purification, the reaction mixture was filtered and rotary evaporated. The crude product was purified by TLC (DCM / MeOH = 10:1) to yield 70 mg of a yellow solid.

[0431] Step 8: 3-((Dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxy-2-methylbenzenesulfonamide

[0432] 4-(Benzyloxy)-3-((dimethylamino)methyl)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-2-methylbenzenesulfonamide (70 mg, 1 eq.) was placed in a 25 mL single-necked flask. EtOH (3 mL) and DCM (3 mL) were added. If the solution did not dissolve, Pd / C (60% aqueous solution, 50 mg) was added while stirring at room temperature to displace H2. The mixture was stirred at room temperature for 3 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was filtered through Celite, and the filter cake was rinsed with 50 mL of DCM:MeOH (2:1). The filtrate was rotary evaporated and flash purified (0.5‰ TFA) and lyophilized to obtain the target compound as a white solid (20 mg). MS: 444 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ11.88-10.71(m,2H),9.00(s,1H),8.24(s,1H),7.97(d,J=8.8Hz,1H),6.97(d,J=8.8 Hz,1H),6.94(s,1H),4.39(s,2H),2.83-2.76(m,10H),2.69(s,3H),2.54(t,J=6.4Hz,4H),1.98-1.87(m,4H).

[0433] Example 31: 3-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzenesulfonamide

[0434] Synthesis route:

[0435] Step 1: 3-Bromo-2-fluoro-6-hydroxybenzaldehyde

[0436] 3-Bromo-2-fluoro-6-methoxybenzaldehyde (350 mg, 1 eq.) was weighed into a 25 mL single-necked vial. DCM (10 mL) was then added, the temperature was lowered to 0°C, and BBr (1.15 g, 3 eq.) was added dropwise. The reaction was incubated for 4 h. LCMS indicated the formation of the title compound. Post-treatment and purification: 0.5 mL of methanol was added dropwise under an ice bath to quench the reaction. The reaction mixture was poured into an appropriate amount of ice water and extracted with 30 mL of DCM twice. The organic phase was washed with saturated brine, dried, rotary evaporated, and flash purified (PE / EA) to yield 280 mg of the title compound as an off-white solid.

[0437] Step 2: 6-(Benzyloxy)-3-bromo-2-fluorobenzaldehyde

[0438] 3-Bromo-2-fluoro-6-hydroxybenzaldehyde (280 mg, 1 eq.) was weighed into a 20 mL single-necked vial. DMF (6 mL) and Cs2CO3 (835 mg, 2 eq.) were added. BnCl (305 mg, 1.5 eq.) was added with stirring at room temperature. The reaction was allowed to react overnight at room temperature. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was poured into an appropriate amount of water, extracted with 30 mL of EA (2 x 30 mL), washed twice with water and saturated brine, dried, and mixed with silica gel for rotary evaporation. Purification by flash chromatography (PE / EA) afforded 250 mg of the target compound as a crude, pale yellow oil.

[0439] Step 3: 6-(Benzyloxy)-3-(Benzylmercapto)-2-fluorobenzaldehyde

[0440] 6-(Benzyloxy)-3-bromo-2-fluorobenzaldehyde (240 mg, 1 eq.) was placed in a 20 mL microwave tube. Toluene (5 mL), benzyl mercaptan (190 mg, 2 eq.), DIEA (402 mg, 4 eq.), Pd2(dba)3 (70 mg, 0.1 eq.), and Xantphos (90 mg, 0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C for 24 h. TLC indicated the formation of the target compound. Post-processing and purification: The reaction mixture was added to silica gel and rotary evaporated. The crude product was flash purified (PE / EA) to yield 150 mg of the target compound as a yellow oil.

[0441] Step 4: 1-(6-(Benzyloxy)-3-(Benzylmercapto)-2-fluorophenyl)-N,N-dimethylformamide

[0442] 6-(Benzyloxy)-3-(Benzylmercapto)-2-fluorobenzaldehyde (150 mg, 1 eq.) was weighed into a 40 mL single-necked flask, followed by the addition of DCM (10 mL). Dimethylamine (2M in THF) (0.4 mL, 2 eq.) and HOAc (6 mg, 0.2 eq.) were added with stirring. The mixture was stirred at room temperature for 2 h. After 2 h, NaBH(OAc)3 (271 mg, 3 eq.) was added portionwise to the reaction mixture at room temperature. The mixture was stirred at room temperature for 2 h. LCMS indicated the formation of the title compound. Workup and purification: The reaction mixture was poured into an appropriate amount of ice water and extracted twice with DCM:MeOH (10:1) (30 mL). The organic phases were combined, washed with saturated brine, dried by rotary evaporation, and flash filtered (DCM / MeOH) to obtain 80 mg of the crude title compound as a yellow oil.

[0443] Step 5: 4-(Benzyloxy)-3-((dimethylamino)methyl)-2-fluorobenzenesulfonamide

[0444] 6M HCl (0.2 mL) was placed in a 20 mL single-necked bottle. MeCN (6 mL) was added, stirred, and cooled to 0°C. NCS (84 mg, 3 eq.) was added. 1-(6-(Benzyloxy)-3-(Benzylmercapto)-2-fluorophenyl)-N,N-dimethylformamide (80 mg, 1 eq.) was dissolved in 3 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 0.5 h to prepare a reserve solution. In a separate 40 mL single-necked bottle, ammonia (5 mL) was added dropwise to the reserve solution while stirring at room temperature. Stir for 0.5 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted twice with DCM:MeOH = 10:1 (30 mL). The product was dried and concentrated under reduced pressure to yield 100 mg of the target compound as a crude yellow oil.

[0445] Step 6: 4-(Benzyloxy)-3-((dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide

[0446] 4-(Benzyloxy)-3-((dimethylamino)methyl)-2-fluorobenzenesulfonamide (100 mg, 1 eq.) was placed in a 25 mL single-necked flask. THF (5 mL) was added, followed by phenyl (1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamate (70 mg, 0.8 eq.). LiOH (11 mg, 1.5 eq.) was added while stirring at room temperature. Stirring was continued at room temperature for 2 h. LCMS confirmed the formation of the target compound. For post-processing and purification, the reaction mixture was filtered and rotary evaporated. The crude product was purified by TLC (DCM / MeOH = 10:1) to afford 80 mg of a yellow solid.

[0447] Step 7: 3-((Dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)-4-hydroxybenzenesulfonamide

[0448] 4-(Benzyloxy)-3-((dimethylamino)methyl)-2-fluoro-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)benzenesulfonamide (80 mg, 1 eq.) was placed in a 25 mL single-necked flask. Ethanol (3 mL) and DCM (3 mL) were added. The solution did not dissolve. Pd / C (60% aqueous solution, 50 mg) was added with stirring at room temperature to displace H2. The mixture was stirred at room temperature for 3 h. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was filtered through Celite, and the filter cake was rinsed with 50 mL of DCM:MeOH (2:1). The filtrate was rotary evaporated and flash purified (0.5‰ TFA) and lyophilized to obtain the target compound as a white solid (20 mg). MS: 448 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ12.80-10.52(m,1H),9.63(s,1H),8.38-8.23(m,1H),7.84(t,J=8.8Hz,1 H),6.98-6.90(m,2H),4.31(s,2H),2.83-2.74(m,10H),2.54(t,J=7.6Hz,4H),1.98-1.87(m,4H).

[0449] Example 32: 4-(Dimethylamino)-N-((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)chromane-8-sulfonamide

[0450] Synthesis route:

[0451] Step 1: 8-Bromo-N,N-dimethylchroman-4-amine

[0452] 8-Bromochrome-4-one (240 mg, 1 eq.) was weighed into a 20 mL microwave tube. MeOH (3 mL), dimethylamine (2 M in THF, 1 mL, 2 eq.), zinc chloride (1 M in THF, 4.5 mL, 4 eq.), and NaBH3CN (290 mg, 4 eq.) were added. The tube was sealed and heated to 65°C for 72 h. LCMS indicated the formation of the title compound. Workup and purification: The reaction mixture was added to 20 mL of water and extracted with DCM:MeOH = 10:1 (30 mL x 2). The mixture was dried, rotary evaporated, and purified by reverse flash chromatography (acetonitrile / water + 0.05% HCOOH) to afford 60 mg of the product as a pale yellow oil.

[0453] Step 2: 8-(Benzylmercapto)-N,N-dimethylchroman-4-amine

[0454] 8-Bromo-N,N-dimethylchroman-4-amine (60 mg, 1 eq.) was placed in a 20 mL microwave tube. Toluene (3 mL), benzyl mercaptan (58 mg, 2 eq.), DIEA (150 mg, 5 eq.), Pd2(dba)3 (21 mg, 0.1 eq.), and Xantphos (27 mg, 0.2 eq.) were then added under nitrogen. The reaction was heated to 115°C for 24 h. LCMS indicated the formation of the target compound. Workup and purification: The reaction mixture was filtered and rotary evaporated. The crude product was flash purified (acetonitrile / water + 0.05% HCOOH) to afford 48 mg of the target compound as a pale yellow oil.

[0455] Step 3: 4-(Dimethylamino)chromane-8-sulfonamide

[0456] 6M HCl (0.12 mL) was placed in a 20 mL single-necked bottle. MeCN (3 mL) was added, stirred, and cooled to 0°C. NCS (64 mg, 3 eq.) was added. 8-(Benzylmercapto)-N,N-dimethylchroman-4-amine (48 mg, 1 eq.) was dissolved in 2 mL of MeCN and added dropwise to the reaction mixture at 0°C. Stir for 15 minutes to prepare a reserve solution. In a separate 40 mL single-necked bottle, ammonia water (4 mL) was added dropwise to the reserve solution while stirring at 0°C. Stir at room temperature for 20 minutes. LCMS confirmed the formation of the target compound. Post-processing and purification: The reaction mixture was rotary evaporated to remove MeCN and extracted with DCM:MeOH = 9:1 (30 mL x 2). After drying, the mixture was concentrated under reduced pressure to yield 80 mg of the target compound as a crude yellow oil.

[0457] Step 4: 4-(Dimethylamino)-N-((1,2,3,5,6,7-hexahydro-S-indacen-4-yl)carbamoyl)chromane-8-sulfonamide

[0458] 4-(Dimethylamino)chromane-8-sulfonamide (80 mg, 1 eq.) was weighed into a 25 mL single-necked vial and THF (6 mL) was added. Phenyl (1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamate (73 mg, 0.8 eq.) was added with stirring at room temperature. LiOH (12 mg, 1.5 eq.) was then added with stirring at room temperature. The mixture was stirred at room temperature for 2 hours. LCMS confirmed the formation of the target compound. Post-treatment and purification: The reaction mixture was dissolved in 1 mL of MeOH and purified by flash chromatography (0.05% NH4HCO3). The target compound was lyophilized to obtain 13 mg of a white solid. MS: 456 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.28(s,1H),8.01(s,1H),7.66(d,J=7.8Hz,2H),7.01(t,J=7.8Hz,1H),6.91(s,1H),4.53-4.46( m,1H), 4.33-4.24(m,1H), 3.86-3.79(m,1H),2.76(t,J=7.4Hz,4H),2.52(t,J=6.8Hz,4H)2.20(s,6H),2.01-1.85(m,6H).

[0459] Biological evaluation: Study on the inhibition of NLRP3 activity of the compounds of the present invention

[0460] Experimental content

[0461] 1) Using the mouse macrophage cell line J774A.1, NLRP3 was activated using LPS as the primary signal and ATP as the secondary signal. Activated NLRP3 releases mature IL-1β, which can be determined by ELISA. Compounds were then added to investigate their effects on IL-1β release.

[0462] 2) Using the mouse macrophage cell line J774A.1, NLRP3 was activated using APOE peptides as primary and secondary signals. Upon activation, NLRP3 releases mature IL-1β, which can be assessed by ELISA. Furthermore, the effects of compounds on IL-1β release can be observed.

[0463] 3) Using the mouse macrophage cell line J774A.1, NLRP3 was activated using LPS as the primary signal and ATP as the secondary signal. Upon activation, NLRP3 releases mature IL-1β, which can be assessed by ELISA. Furthermore, inhibition curves were generated by adding different concentrations of the same compound.

[0464] 4) Using the human monocytic THP-1 cell line, PMA was used to induce differentiation into monocyte-macrophage-like cells. NLRP3 was activated using LPS as the primary signal and Nig (nigericin) as the secondary signal. Activated NLRP3 releases mature IL-1β, which can be determined by ELISA. Further addition of compounds to this assay can be used to assess their effects on IL-1β release.

[0465] 5) Using the human monocytic THP-1 cell line, PMA was used to induce differentiation into monocyte-macrophage-like cells. NLRP3 was activated using LPS as the primary signal and Nig (nigericin) as the secondary signal. Upon activation, NLRP3 releases mature IL-1β, which can be assessed by ELISA. Inhibition curves were generated by adding different concentrations of the same compound.

[0466] 6) Using human whole blood, NLRP3 was activated using LPS as the primary signal and nigericin as the secondary signal. Upon activation, NLRP3 releases mature IL-1β, which can be assessed by ELISA. Furthermore, inhibition curves were generated by adding different concentrations of the same compound.

[0467] 7) In the LPS-induced sepsis model in C57 mice, LPS injection triggers NLRP3 activation and IL-1β release, affecting mouse survival. Adding compounds beforehand can investigate their effects on IL-1β release and mouse survival.

[0468] 8) Compounds are injected into the tail vein of mice, and their pharmacokinetic properties can be analyzed by measuring the concentrations of compounds in plasma, liver, and brain tissue.

[0469] 9) Determination of hERG inhibition.

[0470] Experimental Example 1: Compounds inhibit NLRP3 classical pathway activation in the mouse cell line J774A.1

[0471] J774A.1 cells were cultured at 1.0 × 10 6Cells were plated at a density of 100 cells / mL in 48-well plates, with 300 μL per well. NLRP3 was subsequently activated with LPS plus 5 mM ATP (adenosine triphosphate) or 10 μM Nig (nigericin). Cell culture medium consisted of: Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, reference number: C12430500) + 10% fetal bovine serum (Gibco, reference number: 10099-141) + 1% sodium pyruvate (Gibco, reference number: 11360-070) + 1% penicillin-streptomycin (Solarbio, reference number: P1400). The J774A.1 mouse monocytic macrophage cell line was purchased from the Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (resource number: 1101MOU-PUMC000222). ATP was purchased from Sigma, catalog number: L2654. Nig was purchased from Shanghai Yuanye Biotechnology, catalog number: S45490.

[0472] Experimental groups: negative control group, LPS alone incubation control group, LPS combined with ATP or Nig positive control group, and example compound experimental group.

[0473] After the plated J774A.1 cells adhered, the culture medium was replaced with cell culture medium containing 1 μg / mL LPS in all groups except the negative control group, which was replaced with cell culture medium. The cells were then incubated overnight. After 18 hours, the culture medium was replaced again. The culture medium in the Example compound experimental group was completely replaced with cell culture medium containing the compound; the negative control group, the LPS alone incubation control group, and the LPS combined with ATP / Nig positive control group were replaced with cell culture medium. One hour later, the culture medium in the LPS combined with ATP / Nig positive control group and the Example compound experimental group was completely replaced with cell culture medium containing 5 mM ATP or 10 μM Nig. One hour later, the cell supernatant was collected for IL-1β detection.

[0474] Experimental results

[0475] Because LPS+ATP / Nig activates NLRP3 and releases mature IL-1β, which can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the inhibitory effect of NLRP3. The results are shown in Figures 1-4.

[0476] In this experimental example, effective inhibition of IL-1β release refers to a reduction of 80% or more in IL-1β release compared to the positive control, while weak inhibition refers to a reduction of 20%-80% in IL-1β release compared to the positive control. The results showed that Example 16 had a weak inhibitory effect on IL-1β release at a concentration of 1 μM, while MCC950, Examples 1, 5, 17, 20, 21, 24, 25, 26, 27, and 28 effectively inhibited IL-1β release at a concentration of 1 μM (Figure 1). Examples 2, 3, 4, and 6 effectively inhibited IL-1β release at a concentration of 1 μM, while Examples 8 and 9 only had a weak inhibitory effect at a concentration of 1 μM (Figure 2). Examples 7, 14, 15, 18, 19, 22, and 23 effectively inhibited IL-1β release at a concentration of 1 μM, while Example 10 had no inhibitory effect at a concentration of 1 μM (Figure 3). Example 11 can effectively inhibit the release of IL-1β at a concentration of 1 μM, Example 12 has a weaker inhibitory effect on the release of IL-1β at a concentration of 1 μM, and Example 13 has no inhibitory effect at a concentration of 1 μM ( FIG. 4 ).

[0477] Experimental Example 2: Compounds inhibit APOE peptide-induced NLRP3 activation in the mouse cell line J774A.1

[0478] J774A.1 cells were cultured at 1.0 × 10 6Cells were plated at a density of 100 cells / mL in 48-well plates, with 300 μL per well. NLRP3 activation was then performed using an APOE peptide. The cell culture medium consisted of: Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, Reference Number: C12430500) + 10% fetal bovine serum (Gibco, Reference Number: 10099-141) + 1% sodium pyruvate (Gibco, Reference Number: 11360-070) + 1% penicillin-streptomycin (Solarbio, Reference Number: P1400). The J774A.1 mouse monocytic macrophage cell line was purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences (Resource Number: 1101MOU-PUMC000222). APOE2 / 3 peptide segment 1-151 was obtained by Biosios (Beijing) Biotechnology Co., Ltd. through recombinant protein expression and purification. The steps are as follows: the sequence shown below (SEQ ID NO: 1) was inserted into the pET-28A plasmid, transformed into the BL-21 (DE3) expression strain, and expressed by IPTG low-temperature induction. The bacteria were collected by centrifugation and then ultrasonically disrupted. The supernatant after centrifugation was purified by nickel ion affinity chromatography (AKTA pure), and the product was concentrated by ultrafiltration and identified by BCA+ protein electrophoresis. Sequence: CCATGGGCCATCATCATCATCATCACGGTGGCTCCGGCGGTAGCAAGGTTGAACAGGCTGTTGAAACCGAACCGGAACCGGAACTGCGTCAGCAAACCGAGTGGCAGTCTGGCCAGCGTTGGGAG CTGGCGCTGGGCCGCTTTTGGGACTACCTGCGTTGGGTACAGACTCTGTCCGAACAGGTTCAGGAAGAACTGCTGTCTTCCCAGGTAACCCAGGAGCTGCGCGCACTGATGGACGAGACCATGAAAGA ACTGAAAGCCTACAAGTCCGAACTGGAAGAACAGCTGACGCCGGTGCGGAAGAAACTCGTGTCTCGCCTGTCTAAAGAACTGCAGGCTGCGCAGGCGCGCCTGGGCGCGGATATGGAAGATGTTTGCG GTCGTCTGGTACAGTACCGTGGCGAAGTTCAAGCTATGCTGGGCCAGAGCACCGAAGAACTGCGTGTTCGCCTGGCATCCCACCTGCGCAAACTGCGCAAACGTCTGCTGCGTGACTAACTCGAG(SEQ ID NO: 1).

[0479] Experimental groups: negative control group, APOE-treated control group, and example compound experimental group.

[0480] After the plated J774A.1 cells adhered, the culture medium was replaced. The culture medium for the APOE-treated control group was replaced with culture medium containing 30 μg / mL APOE peptide, and the culture medium for the example compound experimental group was replaced with culture medium containing 30 μg / mL APOE peptide combined with the compound. The negative control group was replaced with culture medium, and the cells were incubated overnight. After 18 hours, the cell supernatant was collected for IL-1β analysis.

[0481] Experimental results

[0482] Because APOE peptides activate NLRP3 and release mature IL-1β, and this release can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the effect of NLRP3 inhibition. The results are shown in Figure 5.

[0483] In this experimental example, effective inhibition refers to a reduction of 70% or more compared to the release amount of the positive control minus the negative control. The results showed that Examples 3, 5, 14, 17, 18, 19, 20, 22, 23, 24, 25, and 26 effectively inhibited IL-1β release at a concentration of 10 μM (Figure 5).

[0484] Experimental Example 3: Inhibition curve of NLRP3 classical pathway activation by compounds in the mouse cell line J774A.1

[0485] J774A.1 cells were cultured at 1.0 × 10 6 Cells were plated at a density of 100 cells / mL in 48-well plates, with 300 μL per well. NLRP3 was subsequently activated with LPS plus ATP or Nig. The cell culture medium consisted of: Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, reference number: C12430500) + 10% fetal bovine serum (Gibco, reference number: 10099-141) + 1% sodium pyruvate (Gibco, reference number: 11360-070) + 1% penicillin-streptomycin mixture (Solarbio, reference number: P1400). The J774A.1 mouse monocytic macrophage cell line was purchased from the Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (resource number: 1101MOU-PUMC000222). ATP was purchased from Sigma, catalog number: L2654. Nig was purchased from Shanghai Yuanye Biotechnology, catalog number: S45490.

[0486] Experimental groups: negative control group, LPS alone incubation control group, LPS combined with ATP / Nig positive control group, and experimental groups with different concentrations of example compounds.

[0487] After the plated J774A.1 cells adhered, the culture medium was replaced with cell culture medium containing 1 μg / mL LPS in all groups except the negative control group, which was replaced with cell culture medium. The cells were then incubated overnight. After 18 hours, the culture medium was replaced again. The culture medium in the Example compound experimental group was completely replaced with culture medium containing various concentrations of the compound. The negative control group, the LPS alone incubation control group, and the LPS combined with ATP / Nig positive control group were replaced with cell culture medium. One hour later, the culture medium in the LPS combined with ATP / Nig positive control group and the Example compound experimental groups at various concentrations was completely replaced with culture medium containing 5 mM ATP or 10 μM Nig. One hour later, the cell supernatant was collected for IL-1β assay.

[0488] Experimental results

[0489] Because LPS+ATP activates NLRP3 and releases mature IL-1β, and this release can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the NLRP3 inhibitory effect. The inhibitory effect strength of compounds at different concentrations can be used to construct an inhibition curve. 50 The inhibitory effects of the compounds were evaluated. The results are shown in Tables 1 and 2.

[0490] The results showed that the IC of Example 3 50 is 203.4 nM; IC of Example 5 50 The IC of Example 19 is 224.3 nM. 50 is 113.9 nM (Table 1); IC of Example 1 50 is 64.6 nM; IC of Example 17 50 The IC value of Example 22 is 194.3 nM; 50 is 127.4 nM; IC of Example 26 50 The IC value of Example 27 is 81.61 nM. 50 is 79.6 nM; IC of Example 30 50 is 144.2 nM; IC of Example 31 50 The IC value of Example 32 is 203.2 nM; 50 The IC of MCC950 is 389.6 nM. 50 was 121.5 nM (Table 2).

[0491] Table 1 (IC under LPS+ATP activation model in experimental example 3J774A.1 cells) 50 Measurement results)

[0492] Table 2 (IC under LPS+Nig activation model of J774A.1 cells in experimental example 3)50 Measurement results)

[0493] Experimental Example 4: Compounds inhibit activation of the NLRP3 classical pathway in the human cell line THP-1

[0494] THP-1 cells were cultured at 1.0 × 10 6 Cells were plated at a density of 100 μL / well in a 96-well plate. PMA-induced differentiation and cell rest were followed by activation of NLRP3 using LPS and Nig. The cell culture medium consisted of 1640 medium (Gibco, reference number: C11875500BT) supplemented with 10% fetal bovine serum (Gibco, reference number: 11360-070) and a 1% penicillin-streptomycin mixture (Solarbio, reference number: P1400). The THP-1 human acute monocytic leukemia cell line was purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences (resource number: 1101HUM-PUMC000057). PMA was purchased from Sgima, catalog number: P1585. Nig was purchased from Shanghai Yuanye Biotechnology, catalog number: S45490.

[0495] Experimental groups: negative control group, LPS alone incubation control group, LPS combined with Nig positive control group, 1 μM example compound experimental group.

[0496] 100 ng / mL PMA was added to THP-1 cells at the same time as plating. After incubation for 24 hours, the cells were washed three times with PBS, the medium was replaced, and the cells were allowed to rest for 24 hours. The medium was then completely replaced with 1 μg / mL LPS and incubated overnight. The next day, the medium was completely replaced in the wells with LPS, and the specified example compounds were incubated for 1 hour. 5 μM Nig was then directly added and incubated for 45 minutes. The cell supernatant was then collected for IL-1β detection.

[0497] Experimental results

[0498] Because LPS+Nig activates NLRP3 and releases mature IL-1β, which can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the inhibitory effect of NLRP3. The results are shown in Figures 6 and 7.

[0499] In this experimental example, effective inhibition of IL-1β release refers to a 50% or greater reduction in IL-1β release compared to the positive control. The results show that MCC950, Examples 17, and 27 can effectively inhibit IL-1β release at a concentration of 1 μM ( Figure 6 ). Examples 29, 31, and 32 can also effectively inhibit IL-1β release at a concentration of 1 μM ( Figures 7-9 ).

[0500] Experimental Example 5: Inhibition curve of compound inhibition of NLRP3 classical pathway activation in human cell line THP-1

[0501] THP-1 cells were cultured at 1.0 × 10 6 Cells were plated at a density of 100 μL / well in a 96-well plate. PMA-induced differentiation and cell rest were followed by activation of NLRP3 using LPS and Nig. The cell culture medium consisted of 1640 medium (Gibco, reference number: C11875500BT) supplemented with 10% fetal bovine serum (Gibco, reference number: 11360-070) and a 1% penicillin-streptomycin mixture (Solarbio, reference number: P1400). The THP-1 human acute monocytic leukemia cell line was purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences (resource number: 1101HUM-PUMC000057). PMA was purchased from Sgima, catalog number: P1585. Nig was purchased from Shanghai Yuanye Biotechnology, catalog number: S45490.

[0502] Experimental groups: negative control group, LPS alone incubation control group, LPS combined with Nig positive control group, and experimental groups with different concentrations of example compounds.

[0503] 100 ng / mL PMA was added to THP-1 cells at the same time as plating. After incubation for 24 hours, the cells were washed three times with PBS, the culture medium was replaced, and the cells were allowed to rest for 24 hours. The culture medium was then completely replaced with 1 μg / mL LPS and incubated overnight. The next day, the culture medium was completely replaced in the wells with LPS, and different concentrations of the specified example compounds were incubated for 1 hour. 5 μM Nig was then directly added and incubated for 45 minutes. The cell supernatant was then collected for IL-1β detection.

[0504] Experimental results

[0505] Because LPS+Nig activates NLRP3 and releases mature IL-1β, which can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the NLRP3 inhibitory effect. The inhibitory effect strength of compounds at different concentrations can be used to construct an inhibition curve. 50 The inhibitory effects of the compounds were evaluated. The results are shown in Tables 1 and 2.

[0506] The results showed that the IC of Example 19 50 The IC value of Example 30 is 278.0 nM; 50 was 36.7 nM; MCC950 was 315.0 nM (Table 3).

[0507] Table 3 (IC under the LPS+Nig activation model of THP-1 cells in Experimental Example 3) 50Measurement results)

[0508] Experimental Example 6: Plotting of inhibition curves of the inhibition of NLRP3 classical pathway activation by the compounds in the example on healthy human whole blood

[0509] 10 mL of human whole blood was collected aseptically from a vein and plated onto a 96-well plate, with 198 μL per well. 2 μL of 100X serial dilutions of the example compounds at the indicated concentrations were then added. Immediately thereafter, 10 μL of 21 μg / mL serial dilutions of LPS were added. Three hours later, nigericin at a working concentration of 5 μM or 1 mM ATP was added. After 1 hour of stimulation, whole blood was collected and the supernatant was centrifuged. IL-1β in the supernatant was assayed by ELISA. Heparin sodium injection was purchased from Changsheng Dry Red; LPS was purchased from Sigma, Catalog No. L2654; ATP was purchased from Sigma, Catalog No. L2654; nigericin (Nig) was purchased from Shanghai Yuanye Biotechnology, Catalog No. S45490; PBS (1×) pH 7.4 was purchased from EallBio, Catalog No. 03.15018C; and a human IL-1β ELISA kit was purchased from Thermo Invitrogen, Catalog No. 88-7261-88.

[0510] Experimental groups: negative control group, LPS alone incubation control group, LPS combined with Nig / ATP positive control group, 1 μM example compound experimental group.

[0511] Aseptically collect 10 mL of human whole blood from a vein, pre-coagulant with sodium heparin, and place in a 50 mL centrifuge tube. Plate 198 μL of collected whole blood directly into a 96-well plate. Add 2 μL of a 100× serial dilution of the example compound at the indicated concentrations. Immediately add 10 μL of a 21 μg / mL serial dilution of LPS. Three hours later, add ATP at a working concentration of 5 μM Nig / 1 mM. After stimulation for 1 hour, collect whole blood, centrifuge, and collect the supernatant. IL-1β in the sample supernatant is then assayed by ELISA.

[0512] Experimental results

[0513] Because the classical pathway activates NLRP3 and releases mature IL-1β, and this release can be inhibited by NLRP3 inhibitors, the relative change in IL-1β release can directly reflect the NLRP3 inhibitory effect. The inhibitory effect strength of different concentrations of compounds can be used to construct an inhibition curve. 50 The inhibitory effects of the compounds were evaluated. The results are shown in Table 4.

[0514] The results showed that in the LPS+1mM ATP model system, the IC 50 The IC value of Example 27 is 151.3 μM.50 The IC of MCC950 was 55.8μM (Table 4). 50 is 3.22 μM; Example 19 is 1.27 μM (Table 5).

[0515] Table 4 (IC under the experimental example 6 human whole blood LPS + ATP classical pathway activation model 50 Measurement results)

[0516] Table 5 (IC under the experimental example 6 human whole blood LPS + Nig classical pathway activation model 50 Measurement results)

[0517] Experimental Example 7: LPS-induced sepsis model: The compound of the previous example inhibits NLRP3 activation

[0518] Intraperitoneal injection of 20 mg / kg LPS induced sepsis in C57BL / 6 mice and significantly increased serum IL-1β levels. The effects of pre-injection of the example compounds on IL-1β elevation and mouse survival were investigated. LPS was purchased from Sigma, Cat. No. L2630; 6-8 week-old C57BL / 6J male mice were purchased from the China Food and Drug Administration.

[0519] Experimental groups: sham model group, model group, and example compound administration group.

[0520] The Example compound was injected intraperitoneally at 30 mg / kg. One hour later, the modeling group and the Example compound-treated group were injected intraperitoneally with 20 mg / kg LPS to establish the model. The sham modeling group was injected with a control solvent. Serum samples were collected from one group of mice 2.5 and 4 hours after modeling for analysis of IL-1β levels. Survival rates were assessed for another group of mice after modeling.

[0521] Experimental results

[0522] The results of IL-1β detection in serum 2.5h and 4h after modeling are shown in Figure 10 (a) (5 mice per group), and the statistical results of mouse survival rate are shown in Figure 10 (b) (10 mice per group). The statistical analysis results showed that in terms of IL-1β levels, there was no significant difference between MCC950 and the modeling group at 2.5h (ns, P>0.05), and the difference was significant at 4h (****, P<0.0001); compared with the modeling group, the differences at 2.5h and 4h in Example 19 were all significant (**, P<0.01, 2.5h; ****, P<0.0001, 4h). In terms of survival rate, Example 19 significantly improved the survival rate of mice relative to the modeling group (P<0.0001, ****), and Example 19 significantly further improved the survival rate relative to MCC950 (P<0.05, *).

[0523] Experimental Example 8: Inhibition of NLRP3 activation by the compound of the example above in the MSU-induced mouse peritonitis model

[0524] Intraperitoneal injection of LPS and monosodium urate (MSU) crystals in mice induced NLRP3 activation and high IL-1β release. Pre-oral administration of an NLRP3 inhibitor inhibited IL-1β release. LPS was purchased from Sigma, Catalog No. L2654. MSU was purchased from Bede Pharmaceuticals, Catalog No. BD367417. Eight-week-old C57BL / 6J female mice were purchased from the China Food and Drug Administration.

[0525] The example compound was orally administered, and 1.25 μg of LPS was intraperitoneally injected 2 hours later. MSU was also intraperitoneally injected 2 hours later. Ascites was collected 30 minutes later, and the IL-1β protein in the ascites was detected.

[0526] Experimental groups: modeling group, example compound administration group.

[0527] Experimental results

[0528] The IL-1β level in ascites is shown in Figure 11 (9-14 animals per group). Statistical analysis showed that compared with the modeling group, Example 19 significantly inhibited the IL-1β level (**, P<0.01), while MCC950 only showed a trend of inhibition (ns, P=0.06).

[0529] Experimental Example 9: Analysis of the pharmacokinetic properties of compounds

[0530] C57 mice were intravenously administered with a dose of 5 mg / kg in each group. Blood was collected from the eyeballs of the mice at 1 min, 30 min, 1 h, and 2 h after drug exposure. Plasma was then centrifuged at 4 ° C and 3000 rpm for 10 min. Acetonitrile was added to precipitate proteins at a volume ratio of 1:3 for plasma:acetonitrile. After centrifugation, the supernatant was filtered and the compound concentration was detected by LC-MS (Agilent 1260-G6125, SIM mode). In addition, 2 h after drug injection, the mice were perfused by heart and their brains were removed. The tissue was ground and centrifuged to obtain the supernatant. Acetonitrile was added to precipitate proteins at a volume ratio of 1:3 for supernatant:acetonitrile. After centrifugation, the supernatant was filtered and the compound concentration was detected by LC-MS (Agilent 1260-G6125, SIM mode).

[0531] Experimental groups: solvent control group and drug administration group.

[0532] Experimental results

[0533] The results of plasma pharmacokinetic analysis of Example 3, Example 5, Example 19 and the control drug MCC950 are shown in Figures 12 to 18.

[0534] The results showed that the half-life of Example 3 was 63 min, the area under the 1-120 min drug-time curve was 257227 ng·h / mL, and the brain drug concentration at 120 min was 35492 ng / mL.

[0535] The half-life of Example 5 was 138 min, the area under the 1-120 min drug-time curve was 67433 ng·h / mL, and the brain drug concentration at 120 min was 3869 ng / mL.

[0536] The half-life of Example 19 was 139 min, the area under the 1-120 min drug-time curve was 14664 ng·h / mL, and the brain drug concentration at 120 min was 242 ng / mL.

[0537] The half-life of the control drug MCC950 tested in parallel was 77 minutes, the area under the 1-120 minute drug-time curve was 29642 ng·h / mL, and the brain drug concentration at 120 minutes was 0 ng / mL (below the detection limit).

[0538] The half-life of Example 17 was 231 min, the area under the 1-120 min drug-time curve was 15511 ng·h / mL, and the brain drug concentration at 120 min was 184 ng / mL.

[0539] The half-life of Example 27 was 173 min, the area under the 1-120 min drug-time curve was 47287 ng·h / mL, and the brain drug concentration at 120 min was 96 ng / mL.

[0540] The half-life of Example 29 was 99 min, the area under the 1-120 min drug-time curve was 14861 ng·h / mL, and the brain drug concentration at 120 min was 197 ng / mL.

[0541] Experimental Example 10: Analysis of metabolic properties of compound drugs in rats

[0542] SD rats were intravenously administered with a dosage of 2.5 mg / kg in each group. Blood was collected at 1 min, 30 min, 1 h, 2 h, 4 h, 6 h, and 24 h, and then centrifuged at 4 ° C, 3000 rpm for 10 min to obtain plasma. Acetonitrile was added at a volume ratio of plasma: acetonitrile of 1:3 to precipitate protein. After centrifugation, the supernatant was collected and filtered, and the compound concentration was detected by LC-MS (Agilent 1260-G6125, SIM mode).

[0543] Experimental groups: solvent control group and drug administration group.

[0544] Experimental results

[0545] The results of plasma pharmacokinetic analysis of Example 5, Example 19 and the control drug MCC950 are shown in Figures 19 to 21.

[0546] The results showed that the half-life of Example 5 was 116 min, and the area under the 1-1440 min drug-time curve was 33916 ng·h / mL.

[0547] The half-life of Example 19 was 231 min, and the area under the 1-1440 min drug-time curve was 56453 ng·h / mL.

[0548] The half-life of the control drug MCC950 tested in parallel was 16 minutes, and the area under the 1-1440 minute drug-time curve was 4376 ng·h / mL.

[0549] Experimental Example 11: Cardiotoxicity Evaluation of Example Compounds—Determination of hERG Inhibition

[0550] 5.1 Cell culture

[0551] In this case study, HEK-293 cells stably expressing the hERG potassium channel were used. The hERG potassium channel cells were purchased from Creacell (Cat. No. A-0320). The cell culture method is as follows:

[0552] HEK-293 cells stably expressing hERG potassium channels were cultured in DMEM medium (hereinafter referred to as complete medium) containing 10% fetal bovine serum (brand: Gibco, reference number: 10099-141) and 0.8 mg / mL G418 (Geneticin, ST081, Beyotime) at 37°C and a carbon dioxide concentration of 5%.

[0553] Cell passaging: Remove old culture medium and wash once with PBS, then add 1 mL of TrypLE TM Express solution (Gibco 12604-021) was added and incubated at 37°C for about 1 minute. When the cells detached from the bottom of the dish, about 5 mL of complete culture medium preheated at 37°C was added. The cell suspension was gently pipetted with a pipette to separate the aggregated cells. The cell suspension was transferred to a sterile centrifuge tube and centrifuged at 1000 rpm for 5 minutes to collect the cells. For expansion or maintenance culture, the cells were inoculated into 10 cm cell culture dishes, with 6 x 10 cells in each cell culture dish. 5 cells (final volume: 5 mL).

[0554] To maintain the electrophysiological activity of cells, the cell density must not exceed 80%.

[0555] Before patch clamp testing, cells were stained with TrypLE TM Express (Gibco12604-021) was separated, culture medium was added to terminate digestion, and then centrifuged, the cells were resuspended and counted, and the cell density was adjusted to 2-3×10 6 cells / mL, and then gently mix the cells on a balanced shaker at room temperature for 15-20 minutes before testing on the instrument.

[0556] 5.2 Electrophysiological recording

[0557] 5.2.1 Record the liquid used

[0558] Extracellular fluid: K-007-1

[0559] 140 mM NaCl, 3.5 mM KCl, 1 mM MgCl2·6H2O, 2 mM CaCl2·2H2O, 10 mM D-Glucose, 10 mM HEPES, 1.25 mM NaH2PO4·2H2O, NaOH adjusted to pH = 7.4.

[0560] Intracellular fluid: K-002-2

[0561] 20mM KCl, 115mM K-Aspartic, 1mM MgCl2·6H2O, 5mM EGTA, 10mM HEPES, 2mM Na2-ATP, KOH adjust pH=7.2.

[0562] The extracellular solution should be stored for one week. After preparing the intracellular solution, aliquot into 10 mL tubes and store frozen at -20°C. Use freshly thawed intracellular solution each day. Use all intracellular solution within one week. If the solution has been used for more than one week, discard the old solution and prepare fresh.

[0563] 5.2.2 Patch clamp assay

[0564] In this special report, the fully automated patch clamp QPatch 48X (Sophion) device was used for electrophysiological testing.

[0565] First, the prepared cells are placed in the centrifuge of the Qpatch workstation. The cells are washed using multiple centrifugation / suspension cycles, and the cell culture medium is replaced with extracellular fluid. An MTP-96 plate is removed and placed in the MTP source position. A QPlate chip is removed and placed in the QPlate source position. A robotic arm scans the barcodes on the MTP-96 plate and QPlate chip and grabs them to the measurement station. Intracellular and extracellular fluids are drawn from the liquid reservoirs and added to the intracellular fluid reservoir and cell and compound reservoirs of the QPlate chip, respectively. At the measurement station, all measurement sites on the QPlate undergo initial quality control. This quality control process involves aspirating the cell suspension from the cell container in the centrifuge and positioning the cells onto the chip wells using a pressure controller to establish a high-resistance seal and establish whole-cell recording mode. Once a stable control current baseline is achieved, test compounds are sequentially drawn from the test compound MTP-96 plate in order of concentration and applied to the cells.

[0566] The voltage stimulation protocol for whole-cell patch clamp recording of hERG currents is as follows: After forming a whole-cell seal, the cell membrane voltage is clamped at -80 mV. The clamping voltage is depolarized from -80 mV to -50 mV for 0.5 s (to detect leakage current), then stepped to 30 mV for 2.5 s, and then quickly restored to -50 mV for 4 s to stimulate the hERG channel tail current. Data are collected repeatedly every 10 s to observe the effects of drugs on hERG tail current. Experimental data are collected by the QPatch screening workstation and stored in the database server.

[0567] Each drug concentration was administered twice, with a duration of at least 5 minutes. The current measured in each cell in external solution without compound served as its own control, and the measurements were repeated in duplicate. All electrophysiological experiments were performed at room temperature.

[0568] 5.3 Data Quality Standards

[0569] The following criteria are used to determine whether the data is acceptable:

[0570] (1) Sealing resistance>1GΩ

[0571] (2) The initial access resistance is less than 15MΩ

[0572] (3) Access resistance ends <15MΩ

[0573] (4) Initial tail current peak > 200pA

[0574] (5) The peak value of the initial tail current is greater than the peak value of the activation current

[0575] (6) There is no obvious spontaneous decay of tail current

[0576] (7) There is no obvious leakage current at a membrane potential of -80mV (the absolute value of the maximum current peak with no obvious leakage)

[0577] 5.4 Data Analysis

[0578] The second of the two dosings was used for data analysis. For each drug concentration, the average of the last three data points before the next dosing concentration was taken to represent the current value after the action of that concentration. The current value representing each drug concentration was normalized to the reference current value serving as the blank control, and the inhibition rate corresponding to each drug concentration was calculated.

[0579] Experimental results

[0580] The hERG inhibition rates of several examples at 1 μM and 10 μM were tested using the above method and compared with the antiarrhythmic drug dofetilide. The IC 50 The inhibition rate of each example is shown in the following table.

[0581] The above results indicate that the typical embodiment of this project has good safety in terms of toxicity associated with hERG inhibition.

[0582] Although the embodiments disclosed in this application are as described above, the contents described are merely embodiments adopted to facilitate understanding of this application and are not intended to limit this application. Any person skilled in the art to which this application belongs may make any modifications and changes in the form and details of the implementation without departing from the spirit and scope disclosed in this application. However, the scope of patent protection of this application shall still be based on the scope defined by the attached claims.

Claims

1. A sulfonylurea derivative or a pharmaceutically acceptable salt thereof, wherein the structure of the sulfonylurea derivative is as shown in Formula I, in: R1 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl; R2 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 2-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl; R3 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Alkylamino, aryl, aryloxy, arylC 1-6 alkoxy, heteroaryl, carboxyl, and heteroalkyl; R4 is selected from H, halogen, nitro, amino, hydroxyl, C 1-6 Alkoxy, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 2-6 alkylamino, aryl, aryloxy, heteroaryl, carboxyl, and heteroalkyl; Wherein, the four substituents R1, R2, R3, and R4 are not H at the same time; R5 is C 1-6 alkyl; R6 is C 1-6 alkyl; When R4 is C 1-6 When it is an alkyl group, R6 and R4 together form a heterocyclic hydrocarbon group; Or when R3 is C 1-6 When it is an alkyl group, R6 and R3 together form a heterocyclic hydrocarbon group; Or when R4 is C 1-6 In the case of an alkoxy group, the methylene group connected to the N atom forms a heterocyclic hydrocarbon group together with R4.

2. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein the halogen is F, Cl, Br or I, preferably F or Cl.

3. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein the R1 is selected from H, halogen, nitro or amino, preferably H, F, Cl, -NO2 or -NH2.

4. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein R2 is H or halogen, preferably H or F.

5. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein R3 is selected from H, C 1-3 Alkoxy, halogenated C 1-3 Alkoxy, aryloxy, aryl C 1-3 Alkoxy, hydroxy, halogen or amino, preferably H, -OCH3, -OBn, F, Cl, -NH2, -OCF3, -OCH2CH3, -OCH(CH3)2 or -OH.

6. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein R4 is selected from H, halogen, C 1-3 Alkyl, C 1-3 Alkoxy, amino, hydroxyl or nitro, preferably H, -NO2, -OCH2CH3, -NH2, F, Cl, -CH3 or -OH; when R4 is -OCH2CH3, the methylene group connected to the N atom forms a six-membered heterocyclic hydrocarbon group together with R4.

7. The sulfonylurea derivative or pharmaceutically acceptable salt thereof according to claim 1, wherein R5 and R6 are each independently methyl or ethyl, preferably, R5 and R6 are both methyl or both ethyl; R6 and R4 together form a six-membered heterocyclic hydrocarbon group; or R6 and R3 together form a six-membered heterocyclic hydrocarbon group.

8. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein the sulfonylurea derivative is selected from:

9. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to claim 8, wherein the sulfonylurea derivative is selected from:

10. The sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 9, for use as: (i) NLRP3 inflammasome inhibitors; and / or (ii) modulators of one or more of IL-1β, IL-17, IL-18, IL-1α, IL-37, IL-33 and Th17 cells.

11. A composition comprising the sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 9, and a pharmaceutically acceptable excipient.

12. The sulfonylurea derivative according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof or the composition according to claim 11 for use in treating or preventing a disease, disorder or condition, wherein the disease, disorder or condition is: (i) immune system disease, disorder or condition; (ii) an inflammatory disease, disorder or condition or an autoimmune disease, disorder or condition; (iii) skin diseases, disorders or conditions; (iv) diseases, disorders or conditions of the cardiovascular system; (v) tumors; (vi) diseases, disorders or conditions of the renal system; (vii) gastrointestinal diseases, disorders or conditions; (viii) respiratory diseases, illnesses or conditions; (ix) diseases, disorders or conditions of the endocrine system; (x) central nervous system (CNS) diseases, disorders or conditions; and / or (xi) Local or systemic infection.

13. Use of a sulfonylurea derivative or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10 or a composition according to claim 11 in the preparation of a medicament for treating or preventing a disease, disorder or condition, wherein the disease, disorder or condition is: (i) immune system disease, disorder or condition; (ii) an inflammatory disease, disorder or condition or an autoimmune disease, disorder or condition; (iii) skin diseases, disorders or conditions; (iv) diseases, disorders or conditions of the cardiovascular system; (v) tumors; (vi) diseases, disorders or conditions of the renal system; (vii) gastrointestinal diseases, disorders or conditions; (viii) respiratory diseases, illnesses or conditions; (ix) diseases, disorders or conditions of the endocrine system; (x) central nervous system (CNS) diseases, disorders or conditions; and / or (xi) Local or systemic infection.

14. The sulfonylurea derivative or pharmaceutically acceptable salt thereof or composition for use according to claim 12 or the use according to claim 13, wherein the disease, disorder or condition is selected from the group consisting of constitutive inflammation, including cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS) and neonatal-onset multisystem inflammatory disease (NOMID), autoinflammatory diseases, familial Mediterranean fever (FMF), TNF receptor-associated periodic syndrome (TRAPS), mevalonate kinase deficiency (MKD), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Majeed syndrome, suppurative arthritis, pyoderma gangrenosum and acne syndrome (PAPA), A20 haploinsufficiency (HA20), childhood granulomatous arthritis (PGA), PLCG2-associated antibody deficiency and immune dysregulation (PLAID), PLCG2-associated autoinflammation, antibody deficiency and immune dysregulation (APLAID) and sideroblastic erythrocytes. The following are some of the most common diseases: autoimmune diseases, including multiple sclerosis (MS), type 1 diabetes, psoriasis, rheumatoid arthritis, Behcet's disease, Sjögren's syndrome, and Schnitz syndrome; macrophage activation syndrome; Blau syndrome; respiratory diseases, including chronic obstructive pulmonary disease (COPD), asthma such as allergic asthma and steroid-resistant asthma, asbestosis, silicosis, and cystic fibrosis; dermatitis, including contact dermatitis; central nervous system diseases, including Parkinson's disease, Alzheimer's disease, Brain damage from Alzheimer's disease, motor neurone disease, Huntington's disease, cerebral malaria, and pneumococcal meningitis; metabolic diseases, including type 2 diabetes, atherosclerosis, obesity, gout, pseudogout; eye diseases, including those of the ocular epithelium, age-related macular degeneration (AMD), uveitis, corneal infections, and dry eye; kidney diseases, including chronic kidney disease, oxalate nephropathy, nephrocalcinosis, and diabetic nephropathy; liver diseases, including nonalcoholic steatohepatitis (NASH) and alcoholic liver disease; skin inflammatory reactions, including contact hypersensitivity and sunburn; Arthritic reactions, including osteoarthritis, systemic juvenile idiopathic arthritis, adult-onset Still's disease, relapsing polychondritis; viral infections, including alphaviruses (Chikungunya, Ross River) and flaviviruses (dengue, Zika), influenza, HIV; hidradenitis suppurativa (HS) and other cyst-causing skin diseases; cancer, including lung metastasis, pancreatic cancer, gastric cancer, myelodysplastic syndrome, leukemia; polymyositis; stroke, including ischemic stroke; myocardial infarction, including recurrent myocardial infarction; congestive heart failure; embolism; cardiovascular disease; graft-versus-host disease; hypertension; colitis; helminthic infections; Bacterial infection; sepsis; septic shock; abdominal aortic aneurysm; wound healing; depression, psychological stress; ischemia-reperfusion injury and any disease in which an individual has been identified to carry a germline or somatic non-silent mutation in NLRP3.

15. The sulfonylurea derivative or pharmaceutically acceptable salt thereof or composition for use according to claim 12 or the use according to claim 13, wherein the disease, disorder or condition is: (i) autoinflammatory diseases such as cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS), familial Mediterranean fever (FMF), neonatal-onset multisystem inflammatory disease (NOMID), tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Magid syndrome, or pyogenic arthritis, pyoderma gangrenosum, and acne (PAPA); (ii) Parkinson's disease or Huntington's disease; (iii) gout or juvenile idiopathic arthritis; (iv) nonalcoholic steatohepatitis (NASH); (v) oxalate nephropathy or nephrocalcinosis; (vi) uveitis; (vii) Hidradenitis suppurativa (HS); (viii) myelodysplastic syndrome, macrophage activation syndrome, Schnitz syndrome, adult-onset Still's disease, or Behcet's disease; or (ix) Sepsis and septic shock.

16. A method for treating or preventing a disease, disorder or condition, comprising administering to a subject in need thereof a sulfonylurea derivative according to any one of claims 1 to 10 or a pharmaceutically acceptable salt thereof, or a composition according to claim 11, wherein the disease, disorder or condition is: (i) immune system disease, disorder or condition; (ii) an inflammatory disease, disorder or condition or an autoimmune disease, disorder or condition; (iii) skin diseases, disorders or conditions; (iv) diseases, disorders or conditions of the cardiovascular system; (v) tumors; (vi) diseases, disorders or conditions of the renal system; (vii) gastrointestinal diseases, disorders or conditions; (viii) respiratory diseases, illnesses or conditions; (ix) diseases, disorders or conditions of the endocrine system; (x) central nervous system (CNS) diseases, disorders or conditions; and / or (xi) Local or systemic infection.

17. The method of claim 16, wherein the disease, disorder or condition is selected from the group consisting of constitutive inflammation, including cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS) and neonatal-onset multisystem inflammatory disease (NOMID), autoinflammatory diseases, familial Mediterranean fever (FMF), TNF receptor-associated periodic syndrome (TRAPS), mevalonate kinase deficiency (MKD), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Majeed syndrome, suppurative arthritis, pyoderma gangrenosum and acne syndrome (PAPA), A20 haploinsufficiency (HA20), childhood granulomatous arthritis (PGA), PLCG2-associated antibody deficiency and immune dysregulation (PLAID), PLCG2-associated autoinflammatory, antibody deficiency and immune dysregulation (APLAID) and sideroblastic anemia with B-cell immunodeficiency, periodic fever and developmental delay (SIFD); autoimmune diseases, including multiple sclerosis (MS), type 1 diabetes, psoriasis, rheumatoid arthritis, Behcet's disease, Sjögren's syndrome, and Schnitz syndrome; macrophage activation syndrome; Blau syndrome; respiratory diseases, including chronic obstructive pulmonary disorder (COPD), asthma such as allergic asthma and steroid-resistant asthma, asbestosis, silicosis, and cystic fibrosis; dermatitis, including contact dermatitis; central nervous system diseases, including Parkinson's disease, Alzheimer's disease, motor neurone disease, brain damage due to leukemia, Huntington's disease, cerebral malaria, and pneumococcal meningitis; metabolic diseases, including type 2 diabetes, atherosclerosis, obesity, gout, pseudogout; ocular diseases, including those of the ocular epithelium, age-related macular degeneration (AMD), uveitis, corneal infections, and dry eye; renal diseases, including chronic renal disease, oxalate nephropathy, nephrocalcinosis, and diabetic nephropathy; liver diseases, including nonalcoholic steatohepatitis (NASH) and alcoholic liver disease; inflammatory skin reactions, including contact hypersensitivity and sunburn; Arthritic reactions, including osteoarthritis, systemic juvenile idiopathic arthritis, adult-onset Still's disease, relapsing polychondritis; viral infections, including alphaviruses (Chikungunya, Ross River) and flaviviruses (dengue, Zika), influenza, HIV; hidradenitis suppurativa (HS) and other cyst-causing skin diseases; cancer, including lung metastasis, pancreatic cancer, gastric cancer, myelodysplastic syndrome, leukemia; polymyositis; stroke, including ischemic stroke; myocardial infarction, including recurrent myocardial infarction; congestive heart failure; embolism; cardiovascular disease; graft-versus-host disease; hypertension; colitis; helminthic infections; Bacterial infection; sepsis; septic shock; abdominal aortic aneurysm; wound healing; depression, psychological stress; ischemia-reperfusion injury and any disease in which an individual has been identified to carry a germline or somatic non-silent mutation in NLRP3.

18. The method of claim 16 or claim 17, wherein the disease, disorder or condition is: (i) autoinflammatory diseases such as cryptopyrin-associated periodic syndrome (CAPS), Muckle-Wells syndrome (MWS), familial cold autoinflammatory syndrome (FCAS), familial Mediterranean fever (FMF), neonatal-onset multisystem inflammatory disease (NOMID), tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS), hyperimmunoglobulinemia D and periodic fever syndrome (HIDS), interleukin-1 receptor antagonist deficiency (DIRA), Magid syndrome, or pyogenic arthritis, pyoderma gangrenosum, and acne (PAPA); (ii) Parkinson's disease or Huntington's disease; (iii) gout or juvenile idiopathic arthritis; (iv) nonalcoholic steatohepatitis (NASH); (v) oxalate nephropathy or nephrocalcinosis; (vi) uveitis; (vii) Hidradenitis suppurativa (HS); (viii) myelodysplastic syndrome, macrophage activation syndrome, Schnitz syndrome, adult-onset Still's disease, or Behcet's disease; or (ix) Sepsis and septic shock.

Images